FASEB J. FASEB Society Management Services
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published as doi: 10.1096/fj.09-129577.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.09-129577v1
23/9/3037    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paulhe, F.
Right arrow Articles by Wehrle-Haller, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paulhe, F.
Right arrow Articles by Wehrle-Haller, B.
(The FASEB Journal. 2009;23:3037-3048.)
© 2009 FASEB

Dimerization of Kit-ligand and efficient cell-surface presentation requires a conserved Ser-Gly-Gly-Tyr motif in its transmembrane domain

Frédérique Paulhe*,1, Monique Wehrle-Haller*,1, Marie-Claude Jacquier*, Beat A. Imhof{dagger}, Séverine Tabone-Eglinger*,{ddagger} and Bernhard Wehrle-Haller*,2

* Department of Cellular Physiology and Metabolism and

{dagger} Department of Pathology and Immunology, Centre Médical Universitaire, University of Geneva, Geneva, Switzerland; and

{ddagger} Cytokine and Cancer Group, INSERM U590, Centre Léon Bérard, University Claude Bernard, Lyon, France

2 Correspondence: Department of Cellular Physiology, Centre Médical Universitaire, 1.Rue Michel-Servet, 1211 Geneva 4, Switzerland. E-mail: bernhard.wehrle-haller{at}unige.ch


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Kit-ligand (Kitl), also known as stem cell factor, is a membrane-anchored, noncovalently bound dimer signaling via the c-kit receptor tyrosine kinase, required for migration, survival, and proliferation of hematopoietic stem and germ cells, melanocytes, and mastocytes. Despite its fundamental role in morphogenesis and stem cell biology, the mechanisms that regulate Kitl dimerization are not well understood. By employing cell-permeable cross-linker and quantitative bimolecular fluorescence complementation of wild-type and truncated forms of Kitl, we determined that Kitl dimerization is initiated in the endoplasmic reticulum and mediated to similar levels by the transmembrane and the extracellular growth factor domain. Further biochemical and mutational analysis revealed a conserved Ser-Gly-Gly-Tyr-containing motif that is required for transmembrane domain dimerization and efficient cell-surface expression of Kitl. A novel intracellular capture assay with the Kitl transmembrane domain as bait revealed specific interactions with Kitl, but not with unrelated transmembrane proteins. During evolution, the transmembrane dimerization motif appeared in Kitl at the transition from teleosts to tetrapods, which correlates with the emergence of Kitl as a supporter of stem cell populations. Thus, transmembrane-mediated association of membrane-anchored growth factors consists of a novel mechanism to improve paracrine signaling and morphogenesis.—Paulhe, F., Wehrle-Haller, M., Jacquier, M.-C., Imhof, B. A., Tabone-Eglinger, S., Wehrle-Haller, B. Dimerization of Kit-ligand and efficient cell-surface presentation requires a conserved Ser-Gly-Gly-Tyr motif in its transmembrane domain.


Key Words: bimolecular fluorescence complementation • growth factors • intracellular transport • c-Kit • evolution • Flt3-L


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
STEM CELL FACTOR, ALSO KNOWN AS Kit-ligand (Kitl), mast cell growth factor, or Steel factor, belongs to the family of 4-helix-bundle cytokines and growth factors forming a noncovalently associated dimer similar in structure to CSF-1 and Flt3-L (1 2 3 4) . These growth factors are synthesized as transmembrane-anchored precursors with highly conserved cytoplasmic domains (5) . Like CSF-1 and Flt3-L, Kitl is a critical factor during hematopoiesis and implicated in the formation of the hematopoetic stem cell niche via signaling to its receptor tyrosine kinase c-kit (6 7 8 9) . In addition, Kitl is critical for the proliferation, survival, and migration of germ cells, mastocytes, and melanocytes (10) . Kitl mRNA is alternatively spliced, forming two different transmembrane precursors, distinguishable by their sensitivity to cell-surface proteases (11 , 12) . The larger form (Kitl-M1) contains a major proteolytic cleavage site that rapidly generates soluble Kitl protein (S-Kitl), whereas the smaller splice variant (Kitl-M2) lacks this proteolytic site, giving rise to a membrane-bound form. However, the smaller splice variant, too, is processed at alternative proteolytic sites, albeit with less efficiency (12) . S-Kitl mediates cell migration of melanocyte precursors (13 , 14) and is required for the efficient recruitment of mast cells to the periphery (13 , 15) . In contrast, the membrane-bound form of Kitl delivers homing, survival, and proliferation signals to melanocytes in the epidermis and to hematopoietic stem cells in the bone marrow (15 , 16) .

The Kitl signal can only be transduced when Kitl is correctly presented to the responsive cells. For example, survival of melanocytes or spermatogonia requires basolateral expression of Kitl in keratinocytes of the epidermis and Sertoli cells of the testes, respectively (17 , 18) . This morphogenetic information is encoded in the cytoplasmic tail of Kitl, which contains a critical leucine residue required for basolateral sorting, as well as a valine-based ER-export signal at its extreme C terminus (19 , 20) . These functional motifs further explain why alteration of the cytoplasmic tail of Kitl abrogates not only polarized expression but reduces also the number of Kitl molecules on the cell surface, consequently diminishing Kitl-dependent mastocytes, germ cells, and melanocytes (18 , 19 , 21 , 22) .

Despite the importance of the basolateral sorting and ER-export signals, it is indispensable that the extracellular domain of Kitl associates to form a dimer in order to efficiently activate its receptor c-kit (8 , 9) . With the exception of one report proposing that the altered cytoplasmic tail of the KitlSl-17H allele results in reduced Kitl dimerization (22) , it has been assumed that Kitl dimers form spontaneously by association of the extracellular c-kit binding domains. This view has been nourished by the formation of S-Kitl dimers, when overexpressed in bacterial or eukaryotic expression systems (23 , 24) . Compared to the full-length precursor, however, S-Kitl accumulates in the ER of Cos-7 cells before being secreted (20) . Accordingly, mice expressing only S-Kitl (KitlSl-d/Sl-d) exhibit defects in coat-pigmentation, hematopoiesis, and primordial germ cell migration that are similar to homozygous KitlSl-39R mice, in which the loss of a conserved N-glycosylation site could perturb the intracellular transport of the mutant Kitl protein (25 26 27) .

Although these results reveal a critical role for Kitl transport to the cell surface in vivo, they do not indicate when and how dimerization of Kitl occurs. Here, by using bimolecular fluorescence complementation (BiFC) and biochemical dimerization assays, we identified a Ser-Gly-Gly-Tyr dimerization motif in the transmembrane domain (TMD) of Kitl, which assists in Kitl dimerization in the ER and is required for efficient cell-surface expression of Kitl.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Kit-ligand, BiFC, and Tac-Kitl chimeric constructs
Wild-type and mutant mouse Kitl-EGFP-M2, del36, del2, and S-Kitl, as well as the HA-tagged Kitl (Kitl-HA-M2) used for the predator/prey analysis and Tac-Kitl-M2 chimera used for the dimerization assay have been described previously (19 , 20) . Kitl-mRFP-M2 was generated by replacing the enhanced green fluorescent protein (EGFP) sequence (between ClaI and PinAI sites) in Kitl-EGFP-M2 with the mRFP sequence (28) , amplified with the following primers (forward: CTCATCGATCGCCACCATAGCCTCCTCCGA, reverse: AGTACCGGTTGAGGCGCCGGTGGAGTGG; restriction sites in bold).

For BiFC, first the citrin fluorophore (Q69M mutation) was created from enhanced yellow fluorescent protein (EYFP) using primer overlap extension. The citrin fluorophore enhances protein folding, photostability, and chloride and pH insensitivity of full-length or complemented EYFP (29 , 30) . Subsequently, the corresponding N- and C-terminal fragments of citrin, consisting of aa 1–173 and 174–239 (31 , 32) , were cloned between the above-mentioned ClaI and PinAI sites using the respective reverse (TATACCGGTTCCCTCGATGTTGTGGCGGA) and forward (ATAATCGATAGGGGACGGCAGCGTGCAG) primers (restriction sites in bold; citrin coding sequence underscored).

The different Tac/Kitl chimeras used for the dimerization assay were constructed by TMD and cytoplasmic tail swapping using the junctions from the ecto- to TMD and from the TMD- to cytoplasmic-domain, as follows. 1) Tac: TTDLQVAVAA; Kitl: DSGLQWTAMA; Tac/Kitl: TTDLQWTAMA. 2) Tac: GLTWQRRQRKS; Kitl: ALYWKKKQSS; Tac/Kitl: GLTWQRRQSS; Kitl/Tac: ALYWQRRQRKS (anchor amino acids for swapping in bold; TMD residues underscored). Mutagenesis of the TMD was performed with complementary sets of primers using PCR overlap extension. All constructs were verified by sequencing.

The Kitl signal peptide (SP)-containing, but extracellular growth factor domain-free, SP-EGFP-M2 construct was created by insertion of complementary annealed primers between a unique BglII (located just after the signal peptide) and a HindIII site (located inside the myc-tag) (forward: GATCTCTGGTGAGCAGA, reverse: AGCTTCTGCTCACCAGA). This shortened the sequence spVKTK/EICG ...Kitl ...TLGP/EQKLImyc to spVKTK/EISG/EQKLImyc (see Fig. 4A ).


Figure 1
View larger version (107K):
[in this window]
[in a new window]

  		Figure 1. Segregation of wild-type and ER-exit mutant of Kitl along the secretory pathway. Confocal fluorescence of living Cos-7 cells transiently cotransfected with the Kitl-M2 constructs carrying either EGFP (Kitl-EGFP-M2) or mRFP (Kitl-mRFP-M2). A–C) Wild-type EGFP- (A) or mRFP-tagged Kitl-M2 (B) colocalize at the cell surface and a perinuclear compartment (C). D–F) EGFP- (D) or mRFP-tagged versions of the ER-exit mutant del36 (E) colocalize in the ER (F). G–I) On cotransfection of the EGFP-tagged wild-type (G) and the mRFP-tagged del36 mutant (H), more del36-mutant proteins appear to be expressed at the cell surface (I). G'–I') Magnified views of boxed areas in panels G–I. Scale bar = 65 µm (A–I).


Figure 2
View larger version (44K):
[in this window]
[in a new window]

  		Figure 2. Dimerization of Kitl occurs independently of ER export. Western blot analysis of lysates of COS-7 cells transiently transfected for 48 h with mock (control) and HA-epitope-tagged wild-type (wt Kitl) or del36-mutant (del36 Kitl) Kitl-M2. Before lysis, cells were treated for 30 min at 37°C with (+) or without (–) 0.1 mM of the cell-permeable bivalent chemical crosslinker DSS. After lysis, ER-resident Kitl proteins were revealed by their sensitivity to Endo-H digestion (faster migrating bands). Samples were separated on 7.5% SDS-PAGE, and Kitl proteins were revealed by a polyclonal anti-mouse Kitl rabbit antiserum. Molecular weight markers are at left and right of blots. Note cross-linking and thus formation of dimers of wild-type cell-surface (Endo-H resistant) and ER-localized (Endo-H sensitive) del36 mutant of Kitl-M2 proteins, respectively.


Figure 3
View larger version (55K):
[in this window]
[in a new window]

  		Figure 3. BiFC between wild-type and mutant Kitl proteins. A) Schematic representation of wild-type Kitl-M2 tagged with either the N- or C-terminal citrin fragment. Note that the myc-epitope tag serves both as a spacer to separate the Kitl receptor-binding domain (RBD) from the citrin fragments, and to identify noncomplemented proteins. B–I) Epifluorescence of fixed COS-7 cells 48 h after transient transfection with wild-type or mutant Kitl constructs carrying either the N-terminal (e.g., Kitl-NY) or C-terminal (e.g., Kitl-CY) fragment of citrin. BiFC (citrin fluorescence) after coexpression of wild-type with wild-type (B), del36 with del36 mutant (C), wild-type with del36 mutant (D), wild-type with del2 mutant (F), and wild-type with S-Kitl (H). Respective localization of cell-surface and ER-resident proteins (e.g., nuclear membrane; arrowheads in insets E, I) was revealed by myc-epitope-specific Texas Red staining of permeabilized cells (E, G, I). Scale bar = 36 µm. J–M) Quantification of BiFC by histogram analysis of citrin (J, L, M) and cell-surface anti-myc PE fluorescence (K) of nonpermeabilized, transiently transfected COS-7 cells. Citrin fluorescence was evaluated from anti-myc-positive cells. Background fluorescence of BiFC system or anti-myc labeling was determined from cells transfected with twice the C-terminal citrin fragment (Kitl-CY and Kitl-CY) or mock-transfected cells (K), respectively. Combinations of wild-type or mutant Kitl constructs tagged with N-terminal (NY) or C-terminal (CY) citrin fragments are indicated in each histogram (J–M). Data are from 1 of 3 similar experiments.


Figure 4
View larger version (51K):
[in this window]
[in a new window]

  		Figure 4. BiFC in the absence of the growth factor domain of Kitl. A) Schematic view of fluorescently tagged Kitl-M2 lacking the extracellular c-kit receptor-binding domain (SP-EGFP-M2). B–I) Epifluorescence images of fixed COS-7 cells transiently cotransfected for 48 h with mRFP-tagged full-length Kitl construct (Kitl-mRFP-M2) (B) and EGFP-tagged N-terminally truncated Kitl (SP-EGFP-M2) (C). BiFC (D, F, H) anti-myc Texas-red staining (E, G, I) of permeabilized Cos-7 cells transiently transfected with two truncated (SP-NY and SP-CY, D) or full-length and truncated Kitl constructs (Kitl-NY and SP-CY, F; SP-NY and Kitl-CY, H). Scale bar = 34 µm. J–M) Quantification of BiFC by histogram analysis of citrin fluorescence of nonpermeabilized, transiently transfected COS-7 cells stained with antic-myc antibodies (not shown). Citrin fluorescence was determined only from anti-myc-positive cells. Background fluorescence of BiFC system was determined from cells transfected with twice the N-terminal citrin fragment (Kitl-NY and Kitl-NY). Combinations of wild-type or mutant Kitl constructs tagged with N-terminal (NY) or C-terminal (CY) citrin fragments are indicated in each histogram. Data are from 1 of 3 similar experiments.

Cell culture, transfection, and fluorescence microscopy
COS-7 and MDCK-II cells were cultured in 10% fetal calf serum (PAA Laboratories, Linz, Austria) in Dulbecco’s modified Eagle’s medium (DMEM; Life Technologies, Paisley, Scotland), as described previously (19 , 20) .

Stable transfection of MDCK-II cells was performed as described previously (19) . Transient transfection of COS-7 cells was performed on glass coverslips with Fugen 6 (Roche Diagnostics, Rotkreuz, Switzerland), according to the manufacturer recommendations. For microscopy, cells were fixed for 5 min in prewarmed 4% paraformaldehyde/PBS followed by extensive washing and subsequent storage in PBS. Cells were either directly analyzed in PBS or processed for anti-myc-epitope immunofluorescence staining. Depending on the protocol, cells were permeabilized for 15 min in PBS containing 1% Triton X-100 and 1% BSA, or blocked in PBS containing 1% BSA without permeabilization. Cells were subsequently incubated with monoclonal anti-myc antibody (clone 9E10; American Type Culture Collection, Manassas, VA, USA) for 1 h at room temperature in PBS-1% BSA. After 3 washes in PBS-1% BSA, cells were incubated with Texas Red-labeled goat anti-mouse antibody (115-075-003; Jackson ImmunoResearch Laboratories, West Grove, PA, USA) for 1 h at room temperature and then washed 3 times and mounted in PBS for microscopy.

Epifluorescence and confocal microcopy were performed with a PlanNeofluar X63 NA 1.4 oil immersion objective (Zeiss, Zurich, Switzerland) on either a Zeiss-Axiovert100 or a Zeiss-LSM510 confocal microscope (Zeiss, Zurich, Switzerland). Epifluorescence images of EGFP (filter set XF116; Omega, Brattelboro, VT, USA), EYFP or citrin (BiFC) (XF1036/XF2063/ XF3050; Omega), and mRFP or Texas Red (Zeiss) were acquired with a Hamamatsu C4742–95-10 digital charge-coupled device camera (Hamamatsu Photonics, Tokyo, Japan) controlled by the Openlab software (Improvision, Coventry, UK).

DSS cross-linking and endoglycosidase-H digestion
Transient transfected COS-7 cells were washed 3 times with prewarmed cross-linking buffer (140 mM NaCl, 5 mM KCl, 0.5 mM MgSO4, 1.5 mM CaCl2, 0.05% NaHCO3, and 0.1% glucose at pH 7.5). After the cells were washed, they were treated for 30 min at 37°C with 0.1 mM of disuccinimidyl suberate (DSS) (Pierce, Perbio Science, Bonn, Germany) in cross-linking buffer. Cells were subsequently washed twice in cross-linking buffer at 4°C and blocked for 5 min in DMEM containing 10% FCS at 4°C. After 2 additional washes with cold cross-linking buffer, cells were lysed in 0.5 ml of protease inhibitors containing cell lysis buffer (120 mM NaCl; 50 mM Tris-HCl, pH 8.0; 1% Nonidet P-40; 0.5% deoxycholate; 0.1% SDS; 1 mM phenylmethylsulfonyl fluoride; and 1 µg/ml chymostatin, leupeptin, antipain, and pepstatin, each) for 10 min at 4°C. Lysates were denatured for 5 min at 95°C and then cooled; aliquots were digested with 3 mU/ml endoglycosidase H (Endo-H; New England Biolabs, Beverly, MA, USA) for 24 h at 37°C. Digested and control samples were terminated by heating for 5 min at 95°C in SDS-PAGE sample buffer. Samples were separated under reducing conditions by 10% SDS-PAGE together with a prestained molecular weight marker (SDS 7B; Sigma, St. Louis, MO, USA) and transferred to nitrocellulose membranes, according to standard protocols (see below).

IL-2 receptor-{alpha}-dependent dimerization analysis and Western blot analysis
COS-7 cells transiently transfected for 48 h with different Tac/Kitl chimeric constructs were washed once with ice-cold PBS. Then, cellular membranes were extracted with 0.5 ml of protease inhibitor containing lysis buffer (see above) with occasional rocking for 10 min on ice. Lysates were carefully collected after inclining the culture plate. Samples of lysates were subsequently boiled for 5 min in 1x SDS-PAGE buffer without reducing agents. Proteins were separated on 7.5% SDS-PAGE under nonreducing conditions alongside a broad-range (6–175 kDa), prestained protein marker (New England Biolabs), and transferred to nitrocellulose according to standard protocols.

Nitrocellulose membranes were blocked overnight with 1% BSA in TBS containing 0.2% Tween-20 (TBST), and incubated with either a polyclonal rabbit antiserum against mouse Kitl (18) or the 7G7 mouse monoclonal anti-Tac antibody (33) in blocking buffer. After membranes were washed with TBST, membranes were incubated with affinity-purified, peroxidase-conjugated goat anti-rabbit or goat anti-mouse antibodies (Jackson ImmunoResearch Laboratories) and revealed with ECL reagents (Amersham, Piscataway, NJ, USA). Quantification of bands was performed from digitally scanned blots using the Openlab software (Improvision, Coventry, England).

FACS analysis
COS-7 cells in DMEM-10% FCS were cultured and transfected in 6-well plates as described above. After 36 h for BiFC or 2 d for the predator/prey assay, cells were collected by treatment with nonenzymatic cell dissociation solution (Sigma), in order to prevent proteolytic release of cell-surface Kitl-EGFP molecules. Cells were subsequently blocked in PBS-1% BSA and stained for cell-surface exposed myc-epitope (BiFC assay), EGFP molecules, and HA and Tac epitopes on ice. Monoclonal antibodies directed against the myc epitope (9E-10), EGFP (MMS-118R; Covance, Berkeley, CA, USA), HA (16B12; BAbCO, Richmond, CA, USA) or Tac (7G7) were applied for 45 min in PBS-1% BSA, followed by washing and incubation with R-phycoerythrin conjugated goat anti-mouse antibodies (SouthernBiotech, Birmingham, AL, USA). Cells were analyzed on a FACScan (BD Biosciences, San Jose, CA, USA) for citrin or EGFP (FL-1) and for PE (FL-2). Histogram analysis (geometric mean) and fluorescence profiles were established using CellQuest (BD Biosciences). BiFC or predator/prey experiments were performed at least 3 times, and one representative experiment was used for analysis.

Measurement of fluorescence intensity of the cell-surface expression of Kitl mutants
To quantify the levels of cell-surface vs. intracellular localization of TMD mutant EGFP-tagged Kitl, stable expressing MDCK-II cell populations were cultured for 4 d on glass coverslips prior to fixation. Serial z sections were acquired at 0.6-µm intervals with the pinhole closed to one airy unit. Using the metamorph software (Visitron Systems, Puchheim, Germany), we obtained a new image containing the sum of all fluorescence intensities in the different z sections. On these composed images, individual cells were selected, and the integrated fluorescence intensity was determined over the entire cell, the cell surface, or intracellular vesicular compartment. From 3 independent experiments each, the mean of 10 representative cells was used to calculate the percentage of membrane fluorescence over total cellular fluorescence.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Segregation of wild-type and mutant Kitl molecules along the secretory pathway
Heterozygous mice carrying one Kitl-null allele demonstrate haplo-insufficiency with respect to coat pigmentation, resulting in belly spots and white foreheads. This haplo-insufficiency is maintained in heterozygous animals, where the mutant alleles exhibit normal c-kit-binding domains, lacking a TMD or displaying an altered cytoplasmic domain (KitlSl-d; KitlSl-17H), respectively (11 , 17 , 34) . This failure to compensate the phenotype could indicate a defect in the dimerization between wild-type and mutant forms of Kitl.

To visualize the respective localization and dimerization of wild type with mutant Kitl proteins, we coexpressed differently colored Kitl isoforms and analyzed their localization by confocal microscopy. As shown in Fig. 1A-C , wild-type forms of EGFP- and mRFP-tagged Kitl perfectly colocalized in a perinuclear compartment and the cell surface (20) . Deletion of the C-terminal valine in the cytoplasmic tail of Kitl (del36) resulted in ER retention (20) of both the EGFP and mRFP-tagged forms (Fig. 1D-F ). Coexpression of wild-type and del36 Kitl appeared to increase membrane expression of del36 Kitl, while the localization of wild-type Kitl was unchanged (Fig. 1G-I ). Similar phenotypes were observed subsequent to swapping the fluorescent tags (data not shown), suggesting that the different tags do not interfere with the behavior of the two proteins.

This result suggests that dimerization between wild-type and del36 Kitl may occur, increasing cell-surface localization of the del36 mutant, without, however, completely correcting the ER-retention phenotype of the del36 mutant. This raised questions concerning the monomer concentration of the del36 mutant in the ER compartment, and thus the ability to form heterodimers with newly synthesized wild-type forms of Kitl, and the problem of identification and tracing potential heterodimeric Kitl molecules in the cell.

Dimerization of ER-retained Kitl
Because it is impossible to define the monomer concentration of ER-retained del36 Kitl, we opted to analyze whether del36 Kitl molecules were able to undergo dimerization in the ER compartment. By employing a chemical cross-linking strategy with a cell-permeable cross-linker (DSS), we determined whether ER-resident del36-mutant Kitl proteins existed as dimers or monomers. Transiently transfected COS-7 cells expressing either wild-type or del36-mutant Kitl were treated for 30 min with DSS at 37°C. After cell lysis, samples were heat-denatured and treated with Endo-H in order to identify ER-resident proteins by their faster migration on SDS-PAGE (Fig. 2 ). In non-DSS-treated control cells, the majority of wild-type Kitl was in an Endo-H-resistant form, while a significant portion of del36-mutant Kitl was found in an Endo-H-sensitive, ER-resident form. After addition of DSS, similar fractions of both wild-type and del36-mutant Kitl ligand protein were cross-linked to form SDS-resistant dimers, irrespective of being expressed at the surface or in the ER as an Endo-H-sensitive dimer, respectively. These data demonstrate that Kitl dimerization occurs already in the ER compartment, independently of recruitment to ER exit sites.

BiFC to reveal Kitl dimers
To visualize heterodimeric Kitl, formed between wild-type and mutant Kitl proteins, it was necessary to distinguish them from the bulk of homodimeric molecules. To this end, we employed the strategy of BiFC of the citrin variant (Q69M mutation) of the EYFP. The citrin molecule was split at residue 173, creating an N-terminal (residues 1–173; NY) and a C-terminal fragment (residues 174–239; CY) inserted at the same site as EGFP and mRFP used above (Fig. 3A ).

We first determined whether individually tagged (NY or CY) wild-type Kitl constructs were expressed normally, revealing cell-surface staining of the c-myc epitope in the absence of citrin fluorescence (data not shown). The coexpression of wild-type Kitl constructs carrying either the N- or C-terminal citrin domain resulted in BiFC at the cell surface and in a perinuclear Golgi-like compartment (Fig. 3B ), indicating formation of heterodimers between the two wild-type Kitl constructs. Notably, the BiFC signal, although at lower intensity, was found in the same locations as observed with EGFP or mRFP tags (compare Figs. 3B and 1A ).

We also validated the BiFC system for the ER-retained C-terminal deletion mutant del36. In this case, BiFC was observed in the ER and nuclear membrane, confirming that Kitl dimerization can occur in the absence of an ER-export signal (Fig. 3C ).

Kitl TMD is required for efficient BiFC
To analyze the formation and behavior of heterodimeric Kitl molecules, we cotransfected wild-type and mutant variants of Kitl containing either the N- or C-terminal fragment of citrin in COS-7 cells. Cotransfection of the del36 mutant with wild-type Kitl resulted in a BiFC signal localized to perinuclear region and the plasma membrane, mimicking the distribution of wild-type Kitl, while anti-myc staining revealed additional ER and nuclear membrane staining (Fig. 3D, E ). A similar result was obtained with Kitl heterodimers, in which the mutant molecule was lacking either the cytoplasmic domain (del2; Fig. 3F, G ) (20) or both the TMD and cytoplasmic domain (S-Kitl; Fig. 3H, I ). The BiFC signal at the cell surface, but absence from the ER of the wt/S-Kitl heterodimer, suggested that dimerization occurred in the ER and that efficient cell-surface transport was achieved with only one functional ER-export signal per Kitl heterodimer.

To exploit the BiFC system for quantitative measurements of dimerization, we compared the citrin fluorescence with the cell-surface expression by anti-myc staining of intact cells by FACS. Compared to COS-7 cells double-transfected with the two wild-type Kitl constructs, the background-corrected geometric mean of the citrin fluorescence for cells transfected with both del36 constructs increased to 552% (Fig. 3J ), while surface expression was half that of wild-type Kitl (Fig. 3K ).

Coexpression of wild-type Kitl with the del36 mutant increased the geometric mean of the citrin fluorescence by 2-fold compared to wild type (Fig. 3L ). In contrast, coexpression of S-Kitl with wild-type Kitl reduced BiFC to 1/3 of wild-type levels (Fig. 3M ). This reduction in BiFC between soluble and membrane-bound Kitl, despite ER-retained S-Kitl, strongly suggests that the transmembrane anchor plays an important role in Kitl dimerization.

Kitl dimerization occurs in the absence of the extracellular growth factor domain
To demonstrate that the TMD of Kitl induces dimerization, we prepared a reporter construct consisting of the Kitl SP followed by a myc epitope and EGFP tag, but lacking the extracellular growth factor domain (Fig. 4A ). This construct perfectly colocalized with mRFP-tagged full-length Kitl in double-transfected cells (Fig. 4B, C ). Furthermore, when used for BiFC, this extracellular deletion mutant formed heterodimeric proteins with itself and wild-type Kitl, localizing to the cell surface in all cases (Fig. 4D-I ).

Quantification of BiFC by FACS revealed a background-corrected geometric mean for cells transfected with both SP constructs of 47% of wild-type (Fig. 4J ). When compared to S-Kitl (37%), coexpression of the SP construct with wild-type Kitl resulted in slightly higher BiFC levels of 43% (Fig. 4K ). These data indicated that the TMD of Kitl possesses a dimerization capacity mediating the formation of Kitl dimers, which is similar to the dimerization capacity of the extracellular growth factor domain.

To directly show the importance of the TMD for Kitl dimerization and working toward the identification of a potential dimerization motif, we exchanged the majority of the TMD with a series of leucines and isoleucine substitutions (WTAMAFPALISLVIGFAFGAFYW; Kitl- TM replaced with WTAMAFPALISLVILLLLLLILL; Kitl-TM9L). When expressed as EGFP-tagged construct in COS-7 cells, no apparent difference in localization to wild-type Kitl could be detected (data not shown). However, when coexpressed with wild-type Kitl in the BiFC assay, BiFC levels were reduced to 53%, which were very similar to the BiFC levels obtained when this TM9L mutant was coexpressed with S-Kitl (55%) (Fig. 4L, M ). However, in contrast to wild-type or S-Kitl, the TM9L mutant failed to efficiently complement with the SP construct missing the extracellular growth factor domain (14%) (Fig. 4M ). These results demonstrate the independent contribution of both the TMD and the extracellular growth factor domain in the formation of Kitl dimers.

TMD dimerization depends on a conserved Ser-Gly-Gly-Tyr motif
To dissect and to identify the dimerization motif in the Kitl TMD, we needed a more sensible dimerization system. Thus, we used a previously described chimeric Kitl-reporter construct consisting of the extracellular domain of the IL-2 receptor-{alpha} (Tac) fused to the TMD and cytoplasmic domain of Kitl (19) . On nonreduced Western blots, this construct migrated predominantly as a dimer, while wild-type Tac formed monomers and dimers in similar amounts (Fig. 5A, B ). Swapping the respective TMDs between these two constructs revealed that the Kitl-TMD was sufficient to induce efficient dimerization of this Tac reporter (Fig. 5A, B, F ). To understand the mechanism of this reporter, we analyzed the disulfide bridge pattern in the Tac ectodomain (35) . In the crystal structure, all 10 cysteines formed pairs (Fig. 5A ), while the 11th cysteine at position 192, not included in the crystal structure, remained as a potentially free cysteine to form the observed Tac dimers. To test this notion, we mutated Cys192 to serine (C192S) in the context of the Tac-Kitl chimeric reporter construct and analyzed the dimerization of this construct. The absence of Cys192 resulted in the reduction of disulfide-linked dimers, thus proposing Cys192 in stabilizing the dimerization of the Tac-reporter constructs (Fig. 5A-C, F ).


Figure 5
View larger version (42K):
[in this window]
[in a new window]

  		Figure 5. Mutational analysis of dimerization motif in Kitl TMD. A) Schematic view of Tac/Kitl chimera serving as a dimerization reporter. SP and 5 disulfide bridges are indicated (brackets). A spacer region containing Cys192 separates the extracellular Tac domain from the TMD and cytoplasmic (cyto) domains. T, Tac; K, Kitl. B) Western blot of nonreduced samples from transiently transfected COS-7 cells corresponding to the 4 constructs in A plus the C192S mutant of the Tac-Kitltm-Kitlcyto construct, all revealed with 7G7 anti-Tac mAbs. C) Schematic view of the disulfide-linked Tac/Kitl dimer. D) Sequence comparison between TMD and juxtamembrane sequences of Kitl from different species. Highly conserved regions are boxed; mutated residues are indicated above the sequence. E) Western blot as in B, showing Tac/Kitl chimeras carrying point mutations in either the cytoplasmic (L7A/V11A; del36) or TMDs (SGGY: S11L/G15V/G19V/Y22L; GGY: G15V/G19V/Y22L; G15V; G19V). Note the differences in dimer/monomer quantity. F, G) Quantification of dimer/monomer ratio of indicated mutants. To compare different experiments (means ± SE; n>3), the dimer/monomer ratio of nonmodified Tac has been set to 1 and used for normalization.

The analysis of the TMD sequence conservation among Kitl from different origins revealed the presence of a glycine repeat motif, which has been previously reported to be involved in TMD dimerization of glycophorin A (36) . Thus, mutations encompassing these glycines and juxtaposed serine and tyrosine residues, potentially implicated in TMD interactions (37) , were introduced into the Tac-Kitl chimera. Mutation in the cytoplasmic domains, such as del36 or L7A/V11A, did not affect dimerization, while single mutations in the TMD, such as S11L, G15V, G19V, and Y22L, reduced dimerization to 35–53% of wild-type levels (Fig. 5G ). The double-G15V/G19V mutation reduced dimerization levels to 29%. This level was further reduced to 21% when the tyrosine 22 to leucine mutation was included (G15V/G19V/Y22L). An even stronger inhibition (9%) was observed after adding the serine 11 to leucine mutation (S11L/G15V/G19V/ /Y22L) (Fig. 5E, G ). These data suggest a Ser-Gly-Gly-Tyr dimerization motif in the TMD of Kitl.

The TMD dimerization motif is required for efficient cell-surface expression of Kitl
To determine the role of the TMD dimerization motif in intracellular transport or steady-state localization of Kitl, we stably expressed wild-type or TMD-mutated EGFP-tagged Kitl constructs into MDCK-II cells (19) . When cells were reaching confluence, we noted a reduction in cell-surface expression of G15V/G19V and TM9L mutant Kitl, which was associated with an increase in intracellular vesicular staining (Fig. 6A-C ). In order not to perturb Kitl localization, potentially occurring during cell detachment when prepared for FACS analysis, we quantified the amount of EGFP fluorescence at the cell surface or perinuclear vesicular compartment of individual cells by image analysis of serial confocal sections. This analysis revealed slight but consistent (10%) reduction in cell-surface staining for the G15V/G19V double mutant and a 40% reduction in cell-surface staining for the TM9L mutant (Fig. 6D ). These data revealed an important function of the TMD dimerization motif in the stabilization of Kitl at the cell surface.


Figure 6
View larger version (111K):
[in this window]
[in a new window]

  		Figure 6. Quantification of cell-surface expression of TMD mutant Kitl. A–C) Reconstructed images of superimposed serial confocal sections (0.6 µm) across monolayers of MDCK-II cells stably expressing wild-type (A), G15V/G19V (B), or TM9L-mutant (C) EGFP-tagged membrane-bound Kitl. Note surface labeling of TMD-mutant constructs compared to intracellular fluorescence. Scale bar = 50 µm. D) Quantification of amount of cell-surface fluorescence in respect to total cellular fluorescence of wild-type and TMD-mutant constructs; means ± SD from 3 different experiments.

TMD-dependent intracellular capture of Kitl
To further understand the role or dynamics of the association of Kitl via the TMD, we asked whether the dimerization motif had the specificity and affinity to capture and divert Kitl proteins traveling through the secretory pathway. To set up such a predator/prey system, we introduced a dileucine-based endocytosis/lysosomal-targeting motif (ExxxLL) (38 , 39) into the Kitl cytoplasmic domain by mutation of Gln27 to Leu (EISMLQ27 to EISMLL) (Fig. 7A ). This Kitl-GFP-Q27L mutant or the extracellular growth factor domain-deleted version (SP-GFP-Q27L) were no longer expressed at the cell surface, as determined by the absence of anti-c-myc cell-surface staining of nonpermeabilized cells (Fig. 7D, F ). Instead, these constructs demonstrated vesicular staining in the perinuclear area, as well as the cell periphery (Fig. 7D ), which colocalized with DsRed-tagged clathrin light chain, confirming that these constructs localized to an endocytic compartment (data not shown).


Figure 7
View larger version (48K):
[in this window]
[in a new window]

  		Figure 7. TMD-dependent capture and rerouting of wild-type Kitl. A) Schematic view of the Kitl lysosomal targeting construct. Note mutation of the basolateral sorting signal of Kitl (EEDNEISMLQ27) into an ExxxLL internalization motif by the Q27L mutation (EISMLL27). B–D') Epifluorescence for EGFP (B–D), or Texas Red staining for cell-surface exposed (nonpermeabilized) myc epitope (B'–D'). Cells were transfected with either wild-type (Kitl-GFP-M2) (B), c-kit binding domain free Q27L mutant [SP-GFP-M2(Q27L)] (D) or both Kitl constructs (C). Corresponding cell-surface exposed myc-epitope tags are revealed under identical exposure and processing conditions (B'–D'). E–H) FACS for EGFP (E) or staining for cell-surface exposed (nonpermeabilized) EGFP (F), HA (G),and Tac epitopes (H). Wild-type (Kitl-GFP-M2), c-kit binding domain-free Q27L mutant [SP-GFP-M2(Q27L)], or full-length Q27L mutant [Kitl-GFP-M2(Q27L)] were transiently expressed alone (E, F) or in combination with either HA-epitope-tagged Kitl (Kitl-HA-M2) (G) or wild-type Tac protein (H). FACS data are from 1 of 3 similar experiments. Scale bar = 25 µm.

When the truncated predator construct (SP-GFP-Q27L) was coexpressed with wild-type Kitl-GFP (prey), the staining for the anti-myc epitope at the cell surface strongly reduced, when compared to cells expressing only the wild-type Kitl construct (Fig. 7B, C ). To quantify the reduction in cell-surface staining, we analyzed the overall and the cell-surface expression levels of the predator and prey constructs by FACS. COS-7 cells transfected with either the prey or predator constructs revealed similar EGFP fluorescence (wt-Kitl-GFP-M2, Kitl-GFP-Q27L and SP-GFP-Q27L) (Fig. 7E ). However, only wild-type Kitl, but not Q27L-mutant Kitl proteins, were detected at the cell surface when probed with anti-EGFP antibodies (Fig. 7F ). Next, we coexpressed EGFP-tagged wild-type (control) or Q27L-mutant (predator) Kitl together with wild-type HA-epitope-tagged Kitl protein (prey) and evaluated the quantity of HA epitopes expressed at the cell surface of EGFP-positive cells. In the presence of the predator (Q27L) but not wild-type EGFP-Kitl, the HA expression at the cell surface was greatly diminished (Fig. 7J ). Interestingly, the SP-GFP-Q27L predator construct, lacking the extracellular growth factor domain, was consistently more efficient in capturing HA-tagged Kitl (prey) than the full-length Kitl-GFP-Q27L construct (Fig. 7J ). To prove the specificity of the predator constructs toward Kitl protein, they were coexpressed with the nonrelated transmembrane protein Tac. Notably, coexpression of neither the prey nor the predator EGFP-Kitl constructs modified the cell-surface expression of Tac (Fig. 7H ).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Kitl belongs to the large family of 4-helix-bundle cytokines and growth factors (3) . Many members of this family, such as GM-CSF, human growth hormone, or IL-2, bind as monomers to their respective cytokine receptors (40) . However, Kitl and the related CSF-1 and Flt3-L form exceptions, since they bind and activate type III receptor tyrosine kinases, which require homodimeric complexes for successful signaling (8 , 9) . Therefore, the degree of signaling via Kitl, CSF-1, and Flt3-L is directly proportional to their ability to form dimeric ligand complexes. In contrast to the disulfide-linked CSF-1 dimer, for which the biological activity is conserved within the bone matrix for subsequent osteoclast-dependent bone resorption, Kitl and Flt3-L are noncovalently linked dimers. They dissociate at low ligand concentrations, explaining the accumulation of nonactive Kitl monomers in the blood (23) . Thus, progressive dissociation of Kitl dimers on cell-surface release creates steep short-range gradients that are relevant for the recruitment of circulating mastocytes into the dermis, the attraction of primordial germ cells to the genital ridges or the directed migration of melanocyte precursors onto the lateral neural crest migration pathway (13 , 14 , 25 , 41 , 42) . In the latter two cases, the expression of membrane-bound Kitl dimer in the target tissue assures homing and survival once these cell populations reached their destination. Similarly, this short-range chemotactic signal could capture circulating T-cell precursors into the thymus, or hematopoietic stem cells into the stem cell niche in the bone marrow. In both locations, Kitl signaling is essential for the proliferation and maintenance of these c-kit expressing stem cell populations (6 , 43) . Moreover, metalloprotease-mediated cleavage of membrane-bound Kitl interrupts this mechanical and signaling connection, which results in the liberation of hematopoietic stem cells from the bone marrow into the circulation (16) .

Nonabundant proteins such as Kitl require efficient oligomerization and transport mechanisms. Glycoprotein folding in the ER, (e.g., of Kitl) is initiated by the recognition of the unfolded peptides by ER-resident chaperones, such as the glucose-regulated proteins (GRPs). This is followed by cotranslational N-glycosylation at conserved residues that provide binding sites for luminal lectins, such as calnexin and calreticulin, which, in turn, causes glycosylation-assisted folding (44) . The importance of glycosylation for the folding of the Kitl extracellular domain is demonstrated by the severe phenotype of the KitlSl-39R allele, which lacks one of the conserved Kitl N-glycosylation sites (25 26 27) . Two other N-glycosylation sites are located immediately at the Kitl-dimerization surface. If these sites are occupied by luminal lectins, Kitl dimerization could be prevented. This reversible block of the dimerization interface, as well as the presence of numerous other luminal proteins in the ER, would strongly reduce spontaneous dimerization of soluble Kitl protein. Here, we propose that homophilic interactions at the level of the Kitl TMD, induce the formation of folding intermediates that favor subsequent dimerization of the growth factor domain. The role of the membrane anchor in Kitl is therefore 2-fold: First, it reduces the diffusion within the ER when compared to an ER-soluble protein, and second, the asymmetric features of the TMD induce clustering, which further increase the local concentration of Kitl proteins, forming the prerequisite for efficient dimerization of the growth factor domain.

The prototypical Gly-xxx-Gly TMD dimerization motif was first identified and structurally characterized in glycophorin A from the red blood cell membrane (36) . In the case of Kitl, as demonstrated by the relatively weak phenotype of the G15V/G19V double mutant (Figs. 5 and 6 ), the glycine residues require additional conserved residues, such as serine and tyrosine, that are located in the preceding and subsequent turns of the transmembrane helix. These residues appear to be responsible for the high specificity and affinity of the Kitl TMD dimerization motif. Serines do not only allow close contact between helices because of their small side chains but contribute also to the formation of interhelical hydrogen bonds, further stabilizing TMD association (37) . Furthermore, aromatic side chains can provide additional interactions between Gly-xxx-Gly-associated transmembrane helices (45) , suggesting that Phe16 and Phe18, as well as Tyr22 and Trp23, all deleted in the TM9L mutant, contribute to form a particular strong and selective dimerization interface (Fig. 8A ). In comparison to Kitl, the TMD of CSF-1 shows an unusual Gly-Gly motif, while the most striking feature in Flt3-L is a unique proline residue in the center of the TMD. Proline residues in these positions often induce kinks in transmembrane helices, which have been proposed to play roles in transmembrane protein folding or signaling but not TMD association (46) . Thus, the conserved proline in Flt3-L may help to partition the protein into specific domains within the ER membrane, without specifically enhancing its dimerization or transport to the cell surface.


Figure 8
View larger version (44K):
[in this window]
[in a new window]

  		Figure 8. Model of the dimerized Kitl TMD. A) Rotated views of a model of dimerized Kitl TMD. One transmembrane helix (dark blue) is shown as a surface representation, with the respective color code at bottom; other helix is shown as a stick model. Critical glycines are green and serine is red in the surface representation. Positions of conserved aromatic amino acids are indicated between the two views of the model (shaded in the sequence). Note groove formed by glycines on one side of the transmembrane helix, allowing close contact and formation of an extensive dimerization surface. Potential stabilization of the TMD dimer could be mediated by interactions or stacking of aromatic side chains (Phe16-Phe18 and Tyr22-Trp23). B) Sequence conservations among Kitl TMDs from different species. The sLxxGFxxGxxxW consensus can be easily detected in tretrapod sequences but not in teleosts (zebrafish). Neither Flt3-L nor CSF-1 exhibits a similar motif or other typical TMD dimerization motif. C) Putative mechanisms of Kitl TMD isomerization at sites of c-kit/Kitl interactions. Note that this mechanism is based on efficient capture of wt Kitl proteins by truncated SP-Kitl-Q27L proteins. Model in panel A was constructed with Swiss-PdbViewer and displayed using VMD software.

Although Kitl association with lipid rafts has not been reported, trimerization of hemagglutinin (HA) from influenza requires its TMD, which contains a raft localization signal (47 , 48) . In the absence of the TMD, lectin-type chaperones mediate folding and cell-surface transport of soluble HA, without, however, inducing trimerization normally observed with wild-type HA (48 , 49) . Similarly, in the case of Kitl, it appears that dimerization is controlled independently from ER-export and cell-surface transport. Nevertheless, the phenotype of the TM9L mutant suggests that an increase in monomeric Kitl is associated with reduced steady state levels of Kitl at the cell surface, therefore, reducing the efficiency of signaling toward c-kit-expressing cells in two ways.

In this respect, note that the phylogenetic analysis of the Kitl TMD sequence reveals a strong conservation of the Ser-Gly-Gly-Tyr/Phe motif, first appearing during the teleost to tetrapod transition (Fig. 8B ). The TMD of both zebrafish Kitl isoforms exhibits an individual proline residue (50) , similar in position to that of mammalian Flt3-L, potentially confirming a common origin of these two ligands. However, the absence of a TMD dimerization motif suggests that the dimerization efficiency of Kitl in teleosts is less developed than in tetrapods, possibly affecting the signaling capacity of Kitl. Whether this difference in TMD accounts for the exclusive role of Kitl/c-kit in melanocyte migration and survival can only be speculated (51) . In zebrafish, cells of the hematopoietic or germ cell lineage do not depend on either of the two Kitl orthologs (50 , 51) , which is in contrast to Xenopus leavis, where the development of the mesenchyme-derived hematopoietic precursor cells depend on epithelially expressed Kitl, strongly resembling paracrine signaling frequently observed for Kitl in mammals (52) .

Therefore, the specific dimerization motif in the TMD of Kitl not only gives insight into the mechanisms of growth factor maturation but also suggests that improved Kitl function could be involved in the evolution of tetrapods. Whether the improved signaling function of Kitl, for example, for the survival and expansion of hematopoietic and germinal stem cells, was an important selection criterion for evolution remains to be shown. On the other hand, our predator/prey assay revealed a hitherto unrecognized role of the TMD of membrane-anchored growth factors. Because the TMD in Kitl represents an additional dimerization motif independently from the extracellular growth factor domain, it is feasible that TMDs can dynamically exchange among neighboring Kitl dimers, via TMD isomerization (Fig. 8C ). Such a process would induce Kitl clusters that could serve both mechanical and signaling functions in order to anchor and nourish stem cells in their niches created by Kitl-presenting cells.

Finally, the identification of this TMD dimerization motif in Kitl would allow the design of therapeutic peptides that selectively disrupt Kitl dimerization and signaling (53) , in an attempt to moderate Kitl activity and thus to regulate inflammation-mediated recruitment of mastocytes during chronic inflammation or allergic reactions (42) .


   ACKNOWLEDGMENTS
 
We thank Drs. Pierre Cosson (Centre Médical Universitaire, Geneva, Switzerland) and Roger Tsien (University of California, San Diego, CA, USA) for reagents, and Drs. Jim Weston, Benoît Gauthier, and Jean-Yves Blay for helpful discussions and critical reading of the manuscript. We are grateful to the support by the Swiss National Science Foundation (3100A0-103805) and Nevus Outreach. S.T.-E. is the recipient of a fellowship from the CONTICANET of the University of Lyon (Lyon, France).


   FOOTNOTES
 
1 These authors contributed equally to this work.

Received for publication January 10, 2009. Accepted for publication April 2, 2009.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Jiang, X., Gurel, O., Mendiaz, E. A., Stearns, G. W., Clogston, C. L., Lu, H. S., Osslund, T. D., Syed, R. S., Langley, K. E., Hendrickson, W. A. (2000) Structure of the active core of human stem cell factor and analysis of binding to its receptor kit. EMBO J. 19,3192-3203[CrossRef][Medline]
  2. Pandit, J., Bohm, A., Jancarik, J., Halenbeck, R., Koths, K., Kim, S. H. (1992) Three-dimensional structure of dimeric human recombinant macrophage colony-stimulating factor. Science 258,1358-1362[Abstract/Free Full Text]
  3. Savvides, S. N., Boone, T., Andrew Karplus, P. (2000) Flt3 ligand structure and unexpected commonalities of helical bundles and cystine knots. Nat. Struct. Biol. 7,486-491[CrossRef][Medline]
  4. Zhang, Z., Zhang, R., Joachimiak, A., Schlessinger, J., Kong, X. P. (2000) Crystal structure of human stem cell factor: implication for stem cell factor receptor dimerization and activation. Proc. Natl. Acad. Sci. U. S. A. 97,7732-7737[Abstract/Free Full Text]
  5. Wehrle-Haller, B. (2003) The role of kit-ligand in melanocyte development and epidermal homeostasis. Pigment Cell Res. 16,287-296[CrossRef][Medline]
  6. Wilson, A., Trumpp, A. (2006) Bone-marrow haematopoietic-stem-cell niches. Nat. Rev. Immunol. 6,93-106[CrossRef][Medline]
  7. Yin, T., Li, L. (2006) The stem cell niches in bone. J. Clin. Invest. 116,1195-1201[CrossRef][Medline]
  8. Liu, H., Chen, X., Focia, P. J., He, X. (2007) Structural basis for stem cell factor-KIT signaling and activation of class III receptor tyrosine kinases. EMBO J. 26,891-901[CrossRef][Medline]
  9. Yuzawa, S., Opatowsky, Y., Zhang, Z., Mandiyan, V., Lax, I., Schlessinger, J. (2007) Structural basis for activation of the receptor tyrosine kinase KIT by stem cell factor. Cell 130,323-334[CrossRef][Medline]
  10. Williams, D. E., de Vries, P., Namen, A. E., Widmer, M. B., Lyman, S. D. (1992) The steel factor. Dev. Biol. 151,368-376[CrossRef][Medline]
  11. Flanagan, J. G., Chan, D. C., Leder, P. (1991) Transmembrane form of the kit ligand growth factor is determined by alternative splicing and is missing in the Sld mutant. Cell 64,1025-1035[CrossRef][Medline]
  12. Huang, E. J., Nocka, K. H., Buck, J., Besmer, P. (1992) Differential expression and processing of two cell associated forms of the kit-ligand: KL-1 and KL-2. Mol. Biol. Cell 3,349-362[Abstract]
  13. Tajima, Y., Moore, M. A., Soares, V., Ono, M., Kissel, H., Besmer, P. (1998) Consequences of exclusive expression in vivo of Kit-ligand lacking the major proteolytic cleavage site. Proc. Natl. Acad. Sci. U. S. A. 95,11903-11908[Abstract/Free Full Text]
  14. Wehrle-Haller, B., Weston, J. A. (1995) Soluble and cell-bound forms of steel factor activity play distinct roles in melanocyte precursor dispersal and survival on the lateral neural crest migration pathway. Development 121,731-742[Abstract]
  15. Kunisada, T., Lu, S. Z., Yoshida, H., Nishikawa, S., Mizoguchi, M., Hayashi, S., Tyrrell, L., Williams, D. A., Wang, X., Longley, B. J. (1998) Murine cutaneous mastocytosis and epidermal melanocytosis induced by keratinocyte expression of transgenic stem cell factor. J. Exp. Med. 187,1565-1573[Abstract/Free Full Text]
  16. Heissig, B., Hattori, K., Dias, S., Friedrich, M., Ferris, B., Hackett, N. R., Crystal, R. G., Besmer, P., Lyden, D., Moore, M. A., Werb, Z., Rafii, S. (2002) Recruitment of stem and progenitor cells from the bone marrow niche requires MMP-9 mediated release of kit-ligand. Cell 109,625-637[CrossRef][Medline]
  17. Brannan, C. I., Bedell, M. A., Resnick, J. L., Eppig, J. J., Handel, M. A., Williams, D. E., Lyman, S. D., Donovan, P. J., Jenkins, N. A., Copeland, N. G. (1992) Developmental abnormalities in Steel17H mice result from a splicing defect in the steel factor cytoplasmic tail. Genes Dev. 6,1832-1842[Abstract/Free Full Text]
  18. Wehrle-Haller, B., Weston, J. A. (1999) Altered cell-surface targeting of stem cell factor causes loss of melanocyte precursors in Steel17H mutant mice. Dev. Biol. 210,71-86[CrossRef][Medline]
  19. Wehrle-Haller, B., Imhof, B. A. (2001) Stem cell factor presentation to c-Kit. Identification of a basolateral targeting domain. J. Biol. Chem. 276,12667-12674[Abstract/Free Full Text]
  20. Paulhe, F., Imhof, B. A., Wehrle-Haller, B. (2004) A specific endoplasmic reticulum export signal drives transport of stem cell factor (Kitl) to the cell surface. J. Biol. Chem. 279,55545-55555[Abstract/Free Full Text]
  21. Cheng, H. J., Flanagan, J. G. (1994) Transmembrane kit ligand cleavage does not require a signal in the cytoplasmic domain and occurs at a site dependent on spacing from the membrane. Molec. Biol. Cell 5,943-953[Abstract]
  22. Tajima, Y., Huang, E. J., Vosseller, K., Ono, M., Moore, M. A., Besmer, P. (1998) Role of dimerization of the membrane-associated growth factor kit ligand in juxtacrine signaling: the Sl17H mutation affects dimerization and stability-phenotypes in hematopoiesis. J. Exp. Med. 187,1451-1461[Abstract/Free Full Text]
  23. Hsu, Y. R., Wu, G. M., Mendiaz, E. A., Syed, R., Wypych, J., Toso, R., Mann, M. B., Boone, T. C., Narhi, L. O., Lu, H. S., Langley, K. E. (1997) The majority of stem cell factor exists as monomer under physiological conditions. Implications for dimerization mediating biological activity. J. Biol. Chem. 272,6406-6415[Abstract/Free Full Text]
  24. Lu, H. S., Chang, W. C., Mendiaz, E. A., Mann, M. B., Langley, K. E., Hsu, Y. R. (1995) Spontaneous dissociation-association of monomers of the human-stem-cell-factor dimer. Biochem. J. 305,563-568[Medline]
  25. Mahakali Zama, A., Hudson, F. P., 3rd, Bedell, M. A. (2005) Analysis of hypomorphic KitlSl mutants suggests different requirements for KITL in proliferation and migration of mouse primordial germ cells. Biol. Reprod. 73,639-647[Abstract/Free Full Text]
  26. Rajaraman, S., Davis, W. S., Mahakali-Zama, A., Evans, H. K., Russell, L. B., Bedell, M. A. (2002) An allelic series of mutations in the kit ligand gene of mice. I. Identification of point mutations in seven ethylnitrosourea-induced Kitl(Steel) alleles. Genetics 162,331-340[Abstract/Free Full Text]
  27. Rajaraman, S., Davis, W. S., Mahakali-Zama, A., Evans, H. K., Russell, L. B., Bedell, M. A. (2002) An allelic series of mutations in the Kit ligand gene of mice. II. Effects of ethylnitrosourea-induced Kitl point mutations on survival and peripheral blood cells of Kitl(Steel) mice. Genetics 162,341-353[Abstract/Free Full Text]
  28. Campbell, R. E., Tour, O., Palmer, A. E., Steinbach, P. A., Baird, G. S., Zacharias, D. A., Tsien, R. Y. (2002) A monomeric red fluorescent protein. Proc. Natl. Acad. Sci. U. S. A. 99,7877-7882[Abstract/Free Full Text]
  29. Griesbeck, O., Baird, G. S., Campbell, R. E., Zacharias, D. A., Tsien, R. Y. (2001) Reducing the environmental sensitivity of yellow fluorescent protein. Mechanism and applications. J. Biol. Chem. 276,29188-29194[Abstract/Free Full Text]
  30. Nyfeler, B., Hauri, H. P. (2007) Visualization of protein interactions inside the secretory pathway. Biochem. Soc. Trans. 35,970-973[CrossRef][Medline]
  31. Hu, C. D., Chinenov, Y., Kerppola, T. K. (2002) Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation. Mol. Cell 9,789-798[CrossRef][Medline]
  32. Hu, C. D., Kerppola, T. K. (2003) Simultaneous visualization of multiple protein interactions in living cells using multicolor fluorescence complementation analysis. Nat. Biotechnol. 21,539-545[CrossRef][Medline]
  33. Rubin, L. A., Kurman, C. C., Biddison, W. E., Goldman, N. D., Nelson, D. L. (1985) A monoclonal antibody 7G7/B6, binds to an epitope on the human interleukin-2 (IL-2) receptor that is distinct from that recognized by IL-2 or anti-Tac. Hybridoma 4,91-102[Medline]
  34. Brannan, C. I., Lyman, S. D., Williams, D. E., Eisenman, J., Anderson, D. M., Cosman, D., Bedell, M. A., Jenkins, N. A., Copeland, N. G. (1991) Steel-Dickie mutation encodes a c-kit ligand lacking transmembrane and cytoplasmic domains. Proc. Natl. Acad. Sci. U. S. A. 88,4671-4674[Abstract/Free Full Text]
  35. Rickert, M., Wang, X., Boulanger, M. J., Goriatcheva, N., Garcia, K. C. (2005) The structure of interleukin-2 complexed with its alpha receptor. Science 308,1477-1480[Abstract/Free Full Text]
  36. Lemmon, M. A., Treutlein, H. R., Adams, P. D., Brunger, A. T., Engelman, D. M. (1994) A dimerization motif for transmembrane {alpha}-helices. Nat. Struct. Biol. 1,157-163[CrossRef][Medline]
  37. Schneider, D., Engelman, D. M. (2004) Motifs of two small residues can assist but are not sufficient to mediate transmembrane helix interactions. J. Mol. Biol. 343,799-804[CrossRef][Medline]
  38. Johnson, K. F., Kornfeld, S. (1992) A His-Leu-Leu sequence near the carboxyl terminus of the cytoplasmic domain of the cation-dependent mannose 6-phosphate receptor is necessary for the lysosomal enzyme sorting function. J. Biol. Chem. 267,17110-17115[Abstract/Free Full Text]
  39. Letourneur, F., Klausner, R. D. (1992) A novel di-leucine motif and a tyrosine-based motif independently mediate lysosomal targeting and endocytosis of CD3 chains. Cell 69,1143-1157[CrossRef][Medline]
  40. Wang, X., Rickert, M., Garcia, K. C. (2005) Structure of the quaternary complex of interleukin-2 with its {alpha}, β, and {gamma}c receptors. Science 310,1159-1163[Abstract/Free Full Text]
  41. Wehrle-Haller, B., Meller, M., Weston, J. A. (2001) Analysis of melanocyte precursors in Nf1 mutants reveals that MGF/KIT signaling promotes directed cell migration independent of its function in cell survival. Dev. Biol. 232,471-483[CrossRef][Medline]
  42. Waskow, C., Bartels, S., Schlenner, S. M., Costa, C., Rodewald, H. R. (2007) Kit is essential for PMA-inflammation-induced mast-cell accumulation in the skin. Blood 109,5363-5370[Abstract/Free Full Text]
  43. Rodewald, H. R., Kretzschmar, K., Swat, W., Takeda, S. (1995) Intrathymically expressed c-kit ligand (stem cell factor) is a major factor driving expansion of very immature thymocytes in vivo. Immunity 3,313-319[CrossRef][Medline]
  44. Aridor, M. (2007) Visiting the ER: the endoplasmic reticulum as a target for therapeutics in traffic related diseases. Adv. Drug. Deliv. Rev. 59,759-781[CrossRef][Medline]
  45. Unterreitmeier, S., Fuchs, A., Schaffler, T., Heym, R. G., Frishman, D., Langosch, D. (2007) Phenylalanine promotes interaction of transmembrane domains via GxxxG motifs. J. Mol. Biol. 374,705-718[CrossRef][Medline]
  46. Cordes, F. S., Bright, J. N., Sansom, M. S. (2002) Proline-induced distortions of transmembrane helices. J. Mol. Biol. 323,951-960[CrossRef][Medline]
  47. Scheiffele, P., Roth, M. G., Simons, K. (1997) Interaction of influenza virus haemagglutinin with sphingolipid-cholesterol membrane domains via its transmembrane domain. EMBO J. 16,5501-5508[CrossRef][Medline]
  48. Singh, I., Doms, R. W., Wagner, K. R., Helenius, A. (1990) Intracellular transport of soluble and membrane-bound glycoproteins: folding, assembly and secretion of anchor-free influenza hemagglutinin. EMBO J. 9,631-639[Medline]
  49. Tatu, U., Hammond, C., Helenius, A. (1995) Folding and oligomerization of influenza hemagglutinin in the ER and the intermediate compartment. EMBO J. 14,1340-1348[Medline]
  50. Hultman, K. A., Bahary, N., Zon, L. I., Johnson, S. L. (2007) Gene duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a. PLoS Genet. 3,e17[CrossRef][Medline]
  51. Parichy, D. M., Rawls, J. F., Pratt, S. J., Whitfield, T. T., Johnson, S. L. (1999) Zebrafish sparse corresponds to an orthologue of c-kit and is required for the morphogenesis of a subpopulation of melanocytes, but is not essential for hematopoiesis or primordial germ cell development. Development 126,3425-3436[Abstract]
  52. Goldman, D. C., Berg, L. K., Heinrich, M. C., Christian, J. L. (2006) Ectodermally derived steel/stem cell factor functions non-cell autonomously during primitive erythropoiesis in Xenopus. Blood 107,3114-3121[Abstract/Free Full Text]
  53. Yin, H., Slusky, J. S., Berger, B. W., Walters, R. S., Vilaire, G., Litvinov, R. I., Lear, J. D., Caputo, G. A., Bennett, J. S., DeGrado, W. F. (2007) Computational design of peptides that target transmembrane helices. Science 315,1817-1822[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.09-129577v1
23/9/3037    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Paulhe, F.
Right arrow Articles by Wehrle-Haller, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Paulhe, F.
Right arrow Articles by Wehrle-Haller, B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS