|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
UMR 7561 CNRS-Université Henri Poincaré Nancy 1, Faculté de Médecine, Vandoeuvre-lès-Nancy, France
1Correspondence: UMR 7561 CNRS-Université Henri Poincaré Nancy 1, Faculté de Médecine, BP 184, 54505 Vandoeuvre-lès-Nancy, France. E-mail: ouzzine{at}medecine.uhp-nancy.fr
| ABSTRACT |
|---|
|
|
|---|
Key Words: glycosyltransferases proteoglycans regulation gene silencing
| INTRODUCTION |
|---|
|
|
|---|
The biosynthesis of GAG chains is initiated by the formation of a tetrasaccharide, GlcAβ1,3Galβ1,3Galβ1,4Xylβ-O attached to the hydroxyl group of specific serine residues of different core proteins (5)
. This linkage tetrasaccharide is formed by the stepwise addition of each sugar residue catalyzed by O-xylosyltransferase I (XT-I), β1,4-galactosyltransferase 7 (GalT-I), β1,3-galactosyltransferase 6 (GalT-II), and β1,3-glucuronosyltransferase I (GlcAT-I) and serves as a primer for heparan sulfate (HS) or CS chain elongation. The importance of GAGs in the regulation of cell function and organ development has been established (6
, 7)
. Moreover, the essential role of glycosyltransferases (GTs) in synthesis and deposition of GAG chains in rat cartilage has been demonstrated in our previous studies (8
, 9)
.
An imbalance between synthesis and degradation of PGs is a salient feature of both RA and OA (3)
. So far, investigators studying alterations in cartilage PG metabolism in animal models and human joint diseases have largely focused on the mechanism of PG degradation. Accordingly, the enzymes that degrade cartilage PGs have been cloned and studied as potential targets for RA and OA therapy (10
11
12)
. However, the loss of PGs also arises from an altered anabolic response of the chondrocyte, which is not only critical for normal cartilage homeostasis but also of potential significance during metabolic changes in arthritis, especially when chondrocytes attempt to repair the degraded ECM. In this regard, disruption of the anabolic capacity of chondrocytes, in particular synthesis and assembly of GAG chains of PGs, may be critical for the progression of cartilage degeneration. Yet, little direct evidence exists to demonstrate that disruption of GTs responsible for synthesis of GAG chains may lead to loss of PGs and cartilage dysfunction in joint diseases. Also, it is unclear whether or not changes in the expression of these enzymes occur and to what extent these events are linked to the disease progression, which is of central importance in human OA and RA pathology.
The goals of the current study were to investigate whether changes in GT expression reflect altered GAG synthesis and deposition in joint diseases and to define the importance of GTs in the cartilage repair process that occurs at the early stages of the disease. Our findings show that the expression of the GT gene XT-I, which initiates PG-GAG chain synthesis by transferring the first sugar residue (xylose) to specific serine residues of PG core proteins, is down-regulated in cartilage isolated from an animal model of arthritis and is associated with reduced PG synthesis. In addition, XT-I expression is down-regulated by interleukin-1β, the proinflammatory cytokine initiating and maintaining cartilage destruction in joint diseases. We also demonstrated that XT-I gene expression was induced at early phases of cartilage repair and provided evidence for the important role of the p38 mitogen-activated protein kinase (p38 MAPK) signaling pathway in this process. Thus, our results shed light on the importance of GTs in cartilage repair and highlight the possibility of up-regulating their expression by targeting the p38 MAPK signaling pathway. These results may have important implications for therapeutic strategies aimed to promote cartilage repair.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Rats were sensitized by a subcutaneous injection at two sites on the back with 0.1 mg of methylated bovine serum albumin (mBSA) in 0.1 ml of 0.9% NaCl emulsified with an equal volume of Freunds complete adjuvant (Sigma-Aldrich, St. Louis, MO, USA) (13)
. One week later, rats were boosted with 0.1 mg of mBSA in Freunds complete adjuvant subcutaneously in the upper back region. Monoarthritis was induced 2 weeks later in the sensitized rats by intraarticular injection in the right knee joint of 50 µg antigen, while the left knee joint received 50 µl of saline. Animals were sacrificed at 4, 7, or 10 days after arthritis induction.
Measurement of knee joint swelling and histological changes in AIA
Swelling of the right and left knees was assessed at various times during the experimental period by measuring the mediolateral joint diameter. Histological sections of femorotibial joints were stained either with H&E or with toluidine blue. Within each joint, the synovium, cartilage, bone and soft tissue were examined for synovial hyperplasia, inflammation, bone and cartilage destruction, edema, and pannus formation.
Induction and evaluation of papain-induced cartilage repair and treatment with MAPKs inhibitors
Induction of cartilage repair by injection of papain in rat knee joints was performed essentially as described by van der Kraan et al. (14)
. The right knee joint of rats was injected once, intraarticularly through the patellar ligament, with 50 µl saline (control) or 50 µl solution of 0.5% (w/v) papain (Sigma-Aldrich). The contralateral left knee was injected with 50 µl saline. Groups of 6 rats were killed by cervical dislocation 6, 12, 72, or 96 h after intraarticular injection of saline or papain. Both the patellae and limbs were fixed in 4% (w/v) paraformaldehyde in neutral-buffered formalin for 24 h, decalcified, processed, embedded in paraffin, sectioned, and stained with toluidine blue.
To investigate the signaling pathways involved in PG synthesis and GT expression during cartilage repair, six groups of rats were injected with 50 µl of saline in the left knee and received a range of treatments (also in a total volume of 50 µl) in the contralateral knee. Group 1 received papain only; group 2 received papain and the p38 MAPK inhibitor SB203580 (20 µM) 12 h after papain injection; group 3 received papain and the MEK pathway inhibitor PD98059 (30 µM) 12 h after papain injection; group 4 received SB203580 only; group 5 received PD98059 only; and group 6 received saline only (control). Analysis of PG synthesis, histology and GT expression was performed 72 h after papain (or vehicle) injection.
Gene silencing of XT-I
Short-hairpin RNA (shRNA) vectors expressing four different shRNAs directed against XT-I sequence were from SuperArray (Frederick, MD, USA). One of these vectors containing the sequence TCGGGACAATGCAAGGTTCAT could suppress XT-I expression by 93% in rat chondrocytes and was used for silencing XT-I in cartilage in vivo. The shRNA vector or control (5 µg) was mixed with transfection reagent Exgen 500 (Euromedex, Souffelweyersheim, France) and delivered to rat joint space via intra-articular injection in a total volume of 50 µl. The expression level of XT-I gene was then analyzed by qPCR. PG synthesis was measured as described below.
Proteoglycan synthesis
Proteoglycan synthesis in patellar cartilage, as measured by 35S-sulfate incorporation, was performed essentially as described by van der Kraan et al. (14)
. Briefly, at 4, 7, and 10 days after mBSA-induced arthritis or 6, 12, 72, and 96 h after papain-induced cartilage repair, groups of 6 rats were killed and the whole patellae with a standard amount of surrounding tissue were excised. Patellae were washed once with sterile calcium and magnesium-free phosphate buffered saline and then incubated for 3 h at 37°C in a humidified 5% CO2 atmosphere with 10 µCi/ml Na235SO4 (Amersham, Les Ulis, France) in DMEM-F12 supplemented with 2 mM L-glutamine, 100 µg/ml streptomycin, and 100 IU/ml penicillin. After incubation, the patellae were thoroughly washed in physiological saline to remove unincorporated label and were incubated overnight at room temperature in 0.5% cetylpyridinium chloride dissolved in 10% formalin buffer. Patellae were then decalcified for 4 h in 5% formic acid, and a punch with a diameter of 2 mm was used to divide the central and peripheral patellar cartilage from the surrounding tissue. Cartilage was dissolved in Soluene-350 (Packard, Rungis, France) overnight at 42°C and the amount of 35S-sulfate incorporated was measured by liquid scintillation counting (Packard, Rungis, France).
Gene expression analysis
Total RNA from freshly isolated cartilage samples was extracted by homogenization in Trizol solution and purified using RNAeasy Kit (Qiagen, Courtaboeuf, France). Total RNA (1 µg) was reversed-transcribed into cDNA using oligo(dT) primer and super Script Reverse Transcriptase (Clontech, Mountain View, CA, USA). qPCR analysis was performed using SYBR Green Master Mix (Qiagen) with the LightCycler detection system (Roche, Meylan, France). RT2 PCR primer sets for rat XylT-I, GalT-I, GalT-II, GlcAT-I, aggrecan, TGF-β1, and ribosomal protein S29 were from SuperArray (Frederick, MD, USA). qPCR cycling parameters were 15 min at 95°C; 40 cycles of 30 s at 95°C, 30 s at 55°C, and 30 s at 72°C. Expression levels of target genes analyzed by qPCR were normalized to ribosomal protein S29 RNA level.
GAG chain analyses by fluorophore-assisted carbohydrate electrophoresis (FACE)
CS chain disaccharide composition analysis was performed on proteinase K-digested cartilage explants by using the FACE method, as described by Calabro et al. (15)
. Electrophoresis was performed at 4°C by using miniature vertical slab gels of 29% (w/v) acrylamide and 1% (w/v) bisacrylamide at 5 W constant power per gel. Fluorescent bands were immediately scanned, and gel images were captured using Gel Doc System (Bio-Rad, Marnes la Coquette, France). CS disaccharide standards were from Dextra Laboratories (Reading, UK).
Cartilage explants culture and IL-1β treatments
Articular cartilage was aseptically excised from rat femoral head caps and maintained in 6-well culture plates in DMEM-F12 medium at 37°C in a humidified atmosphere supplemented with 5% CO2. After 72 h, explants were serum-starved for 24 h and then treated or not (control) with 10 ng/ml of IL-1β (Sigma-Aldrich) for 12 or 24 h. One group of explants was pulsed with 35S-sulfate (5 µCi/ml) for the last 6 h prior to PG analysis, the second group was used for total RNA extraction.
Statistics
Results are expressed as means ± SD of six independent observations for each parameter, and mean differences between experimental groups were analyzed using the one-way ANOVA with a Newman-Keuls post hoc test.
| RESULTS |
|---|
|
|
|---|
Evaluation of disease activity indicated that mean diameter of the knee joint of saline-injected rats did not significantly change during the period of the study. However, injection of the antigen mBSA resulted in an increase in the width of the knee. At day 1, a significant swelling of the mBSA-injected knee joint was observed in all rats. The swelling increased until day 4 and then decreased on days 7 and 10 after arthritis induction, although the swelling was still higher than saline-injected knees during the course of each experiment. In agreement with previous reports, mBSA-injected rat knees displayed marked inflammation, synovial hypercellularity, and pannus formation (data not shown), suggesting that both inflammatory and destructive features were present in the arthritic knee.
The effect of AIA on PG synthesis was evaluated in patellar cartilage of rats at 4, 7, and 10 days after arthritis induction (Fig. 1A
). The data showed that AIA caused a significant and progressive decrease in the rate of PG synthesis. Indeed, compared to controls, the rate of PG synthesis was reduced by
23, 47, and 62% on days 4, 7, and 10, respectively. The reduction in PG synthesis at day 10 after arthritis development was both consistently observed and highly significant for AIA rats, when compared to control rats (P<0.01). Cartilage sections were stained with toluidine blue to assess PG deposition in AIA (Fig. 1B
). The cartilage matrix of saline-injected knees showed a high concentration of PGs, as judged by its intense blue coloration (Fig. 1Ba
). By contrast, antigen mBSA-injected knee joints showed a marked reduction in toluidine blue staining, which indicated loss of PGs from cartilage matrix (Fig. 1Bb
). In addition, analysis of the fine structure and composition of CS-GAG chains by the FACE technique revealed a time-dependent reduction in the content of CS disaccharides from AIA rat cartilage compared to controls (Fig. 1C
). Indeed, a large decrease in the amount of C-4-S disaccharide forming GAG chains as well as nonsulfated GAG disaccharides (
Di0S) was observed 10 days after arthritis induction (Fig. 1C
). Our data also show that the predominant CS-GAG in the adult rat cartilage is the disaccharide C-4-S, consistent with previous findings (9)
.
|
Impaired expression of GT genes in antigen-induced arthritic cartilage in rats
Since the above results indicated a decrease in PG synthesis and deposition in the cartilage of AIA rats, it was of interest to evaluate whether this alteration was related to the expression pattern of GTs. Therefore, we analyzed the kinetics of GT expression in AIA rat cartilage by determining the level of GT expression at different time points by qPCR. Our results showed that AIA rat cartilage displayed a marked reduction in the expression level of the XT-I gene compared to control (Fig. 2
). As shown in Fig. 2A
, the XT-I gene expression level decreased by 5- and 4.2-fold at days 7 and 10, respectively, after arthritis induction. No major changes in the expression of other GT genes, i.e., GalT-I, GalT-II, and GlcAT-I, was observed (data not shown). The expression level of aggrecan gene was also altered and decreased by 3-fold at days 7 and 10 after arthritis induction (Fig. 2B
). All these parameters were substantially indicative of anabolic alterations and suggest that XT-I deficiency, in addition to down-regulation of the expression of the aggrecan core protein gene, is a potential cause for the observed reduction in PG synthesis and content in AIA rat cartilage.
|
IL-1β down-regulates the expression of XT-I and aggrecan in rat cartilage explants
Several studies on both cultured chondrocytes and cartilage explants, and in animal models, have established the potential role of the proinflammatory cytokine IL-1β in decreasing the synthesis of cartilage-specific PGs associated with joint diseases (18
19
20
21)
. We therefore analyzed the effect of IL-1β on the expression of XT-I and aggrecan genes, as well as on PG anabolism in rat cartilage explants. Our data showed that IL-1β decreased PG synthesis by 50% and by 75% after 12 and 24 h treatment, respectively (Fig. 3A
). Interestingly, the expression level of XT-I gene was reduced by 60 and 45% after 12 and 24 h IL-1β treatment, respectively (Fig. 3B
). This result showed, for the first time, that the XT-I gene is down-regulated by IL-1β in cartilage. Similarly, the expression level of the aggrecan core protein gene was reduced by 45 and 40% after 12 and 24 h IL-1β treatment, respectively (Fig. 3C
). Altogether, these data indicated that down-regulation of the expression of XT-I and aggrecan genes could represent a major mechanism involved in the loss of PG and GAG chain synthesis produced by the cytokine IL-1β in RA and OA.
|
Investigation of the role of GTs during cartilage repair process in a rat model of cartilage regeneration
It is extremely difficult to obtain human cartilage samples during progressive stages of cartilage degeneration and repair. We therefore focused our investigations on a rat model of cartilage repair (papain injection in rat knee joints). This model enabled us to explore the mechanisms by which anabolic changes occur during early stages of PG loss and cartilage repair, which allowed us to address the role of GTs in the alterations in GAG synthesis. Also, we could elucidate which signaling cascade mediates the regulation of GT expression during cartilage repair.
Kinetics of PG synthesis and deposition in papain-induced cartilage repair in rats
Intraarticular administration of papain in animals permits the assessment of repair response of articular cartilage after mild PG depletion (14)
. Analysis of the rate of PG synthesis in patellar cartilage after papain injection in rat knee is shown in Fig. 4A
. PG synthesis, as determined by 35S-sulfate incorporation, was initially decreased by 33% at 6 h after papain injection compared to controls. Twelve hours after papain injection, the rate of PG synthesis returned to a level similar to control. At 72 and 96 h after papain treatment, PG synthesis was increased by 30 and 70%, respectively, in patellar cartilage, compared to controls (Fig. 4A
). This finding suggests a reparative process to restore PG loss in cartilage. Histological observations of cartilage sections stained with toluidine blue revealed a marked depletion of PGs during the first few hours after papain treatment (compare Fig. 4Ba, b
) followed by restoration of PG matrix content at later time points (compare Fig. 4Bb, c, d
).
|
Furthermore, disaccharide composition analyses for CS using FACE (Fig. 4C
) demonstrated a strong depletion in the content of disaccharides forming CS-GAG chains during the early stages (12 h). However, significantly increased amounts of C-4-S, C-6-S, as well as nonsulfated GAG disaccharides, were seen 96 h after papain injection. These findings demonstrate that papain-induced PG depletion might provide a potent stimulus for GT gene expression, which presumably could act as a positive feedback mechanism to up-regulate the GAG biosynthesizing potential of chondrocytes.
Repair of articular cartilage in papain-injected rat knees is characterized by increased expression of XT-I gene
We examined whether the increase in PG synthesis during in vivo cartilage repair was related to the regulation of GT gene expression. Our data demonstrated that the expression level of the XT-I gene was induced in cartilage of papain-injected rat knees relative to control (Fig. 5A
). Increased levels of XT-I gene expression (4-fold) were first detected 12 h after papain injection, were maximal at 72 h (10-fold), and decreased thereafter to control levels (Fig. 5A
). However, no major changes in the expression of other GT genes, i.e., GalT-I, GalT-II, and GlcAT-I were observed (data not shown), suggesting an important role for XT-I in the cartilage repair process. In addition, our results demonstrated a time-dependent increase in aggrecan core protein gene expression levels, with the highest increase (30-fold) measured at 72 h after papain injection into knee joints of rats (Fig. 5B
). Further results revealed a time-dependent increase in the expression of TGF-β1, with a peak increase of 2.5-fold at 12 h after papain injection to rat knee joints (Fig. 5C
). This finding suggests a role of TGF-β1 in cartilage repair. Altogether, these findings indicate that up-regulation of the expression of the GT gene XT-I is a mechanism by which CS-GAG synthesis and content are stimulated during cartilage repair. Furthermore, coinduction of the expression of XT-I and aggrecan and the resulting stimulation of PG anabolism indicated that these genes are coregulated and may represent major determinants regulating PG synthesis in cartilage.
|
Gene silencing of XT-I inhibits PG synthesis during cartilage repair in papain-injected rat knees
We examined the importance of XT-I in the cartilage repair process by RNA interference using shRNA. Interestingly, transfection of rat knees with a shRNA vector for XT-I 6 h after papain injection prevented the increase in PG synthesis observed during cartilage repair (Fig. 6
), whereas transfection with control shRNA demonstrated no effect (Fig. 6
). Together, these results indicated that XT-I plays a critical role in PG synthesis during cartilage repair process.
|
Enhancement of PG synthesis and deposition during cartilage repair in papain-injected rat knees is mediated by the p38 MAPK pathway
Our next set of experiments was focused on understanding the intracellular signaling pathways that are activated during cartilage repair. We investigated whether the ERK-1/2 or p38 pathway is involved in PG synthesis induction during matrix restoration. For this purpose, rats were intraarticularly treated with papain in the presence or absence of the p38 MAPK inhibitor SB203580 or the ERK-1/2 kinase (MEK-1/2) inhibitor PD98059, and the rate of PG synthesis in cartilage was determined by 35S-sulfate incorporation. Our results indicate that treatment with the inhibitors alone did not affect the rate of PG synthesis in the cartilage (data not shown). In contrast, as described in Fig. 7A
, SB203580 suppressed XT-I induction and dramatically reduced (4-fold) cartilage PG synthesis in papain-injected knee joint compared to control. In contrast, PD98059 was less potent in inhibiting papain-increased PG synthesis (
1.3-fold).
|
Toluidine blue staining revealed the restoration of PG content 72 h after papain treatment (compare Fig. 7Ba, b
). However, inhibition of p38 MAPK signaling resulted in the failure to restore PG matrix in response to papain treatment (compare Fig. 7Bb, c
). Inhibition of ERK-1/2 with PD98059 also seems to have a moderate affect on papain-induced deposition of PGs (compare Fig. 7Bb, d
). These data indicate that the p38 MAPK signaling pathway may regulate PG synthesis and deposition during articular cartilage repair.
p38 MAPK is required for the induction of XT-I gene expression during matrix repair in the articular cartilage
To investigate the mechanism by which p38 MAPK inhibition reduced PG synthesis during cartilage repair, we performed qPCR analysis of the expression level of GTs after treatment of rat knees with papain in combination with SB203580 or PD98059 (Fig. 7C
). Compared to the level of expression after papain stimulation, we observed that the p38 inhibitor SB203580 blocked the papain-stimulated expression of XT-I gene by 42%, whereas the ERK1/2 inhibitor PD98059 reduced it by 22% (Fig. 7C
). Analysis of aggrecan gene expression levels demonstrated a 35% decrease in papain-stimulated expression of this gene in the presence of SB203580. In contrast, the papain-induced increase in aggrecan gene expression was inhibited by 12% in the presence of PD98059 (Fig. 7C
). Our data also show that treatment with the inhibitors alone did not induce any significant effect on the expression of the XT gene (data not shown). These results, along with the results of 35S-sulfate incorporation and toluidine blue staining, confirm that p38 MAPK and, to a lesser extent ERK-1/2, regulates the expression of XT-I gene in articular cartilage during the repair process. Similarly, the data show that p38 MAPK also regulates aggrecan core protein gene expression during this process.
| DISCUSSION |
|---|
|
|
|---|
Destruction and remodeling of articular cartilage are characteristics of both RA and OA (22)
. While both of them affect the joints, in OA there is relatively little synovial inflammation and the cartilage matrix degradation is frequently associated with enhanced synthesis of PGs (22
23
24
25)
. It is, therefore, evident from the present study that mRNA expression level of GT XT-I was elevated at an early phase during cartilage repair after intraarticular administration of papain. However, the situation was quite different in the RA animal model, with no evidence for cartilage repair during early stages of the disease in AIA in rats. This is likely due to differences in the pathological mechanism driving RA and OA. Interestingly, it has been demonstrated by Cs-Szabo et al. (3)
that, besides widespread degradation of PG molecules in both OA and RA cartilage, a repair process occurs principally in OA cartilage. Such a scenario may help to define the pathogenesis of RA in terms of cartilage repair and GT expression. Overall, it is clear that, while the repair response may be somewhat restricted in RA, one possible explanation for this observation is that the inflammatory state could inhibit the repair response by blocking the expression of GTs. Intriguingly, intraarticular inflammation is a major feature of RA (2)
, and the excessive production of inflammatory cytokines in RA provides an abundant source of mediators that contribute by their antianabolic and procatabolic activity to the loss of GAGs from cartilage matrix (26
, 27)
. Evidence supporting this assumption came from our present results, which showed that the proinflammatory cytokine IL-1β inhibited XT-I gene expression. Thus, the decrease in cartilage PG synthesis and content in AIA rats may result from an inhibitory effect sustained by inflammation on XT-I and aggrecan gene expression, which could negatively influence cartilage repair and play a major role in the development of cartilage degeneration in RA.
The capacity for recovery of PG synthesis in the papain-injected rat model may involve up-regulation of TGF-β1. In agreement with previous reports (14)
, our results showed that the expression of TGF-β1 was up-regulated at an early stage before any significant increase in aggrecan expression and PG synthesis during cartilage repair. Interestingly, TGF-β1 up-regulation after papain injection could provide a mechanistic explanation for increased XT-I expression, indicating a functional role for this growth factor in tissue repair processes. Accordingly, it has been shown that XT-I gene expression was induced by TGF-β1 in human fibroblasts with a parallel increase in CS-GAG content (28)
. We evaluated the importance of XT-I in cartilage repair by silencing its expression using shRNA. Reduced expression of XT-I during cartilage repair prevented the stimulation of PG synthesis observed during the repair process, reinforcing the notion that XT-I is necessary for PG synthesis during matrix restoration. Our results are in agreement with recent evidence showing that gene silencing of XT-I by RNA interference is associated with reduced CS-GAG content in human fibroblasts (28)
. Together, our findings indicate that stimulation of PG synthesis during cartilage repair may be triggered through a mechanism that involves TGF-β1 inducing XT-I expression.
As a possible mechanism of this induction, we wished to identify intracellular signaling pathways that could affect GT expression and PG synthesis responses. Mitogen- and stress-activated protein kinase (MAPK/SAPK)-mediated intracellular signals have been associated with several pathologies, including OA (29)
. Increased p38 MAPK activity appears to be instrumental in TGF-β1-induced regulation of aggrecan gene expression. It has been reported that phosphorylation of both ERK1/2 and p38 MAPK correlate with increased basal aggrecan expression in differentiated ATDC5 cells, indicating that both ERK1/2 and p38 MAPK regulate the expression of aggrecan in differentiated cells (30)
. Interestingly, studies have also shown that inhibition of TGF-β1-induced chondrogenesis and gene expression in mesenchymal progenitor cells results from inhibition of p38 or ERK-1 (31)
. Based on the inhibition of ERK1/2 and p38 MAPK by PD98059 and SB203580, respectively, our results showed that p38 activation on papain treatment was found to be important for the induced GT expression during cartilage repair, particularly that of the XT-I gene. Similar results were observed for the aggrecan core protein gene. Therefore, these results may account for the inhibition of PG synthesis measured during cartilage repair in presence of the inhibitor SB203580. A modest, but significant, inhibition of the GAG synthesis was also observed in the presence of PD98059. A link between ERK and GT regulation had already been suggested by the demonstration that inhibition of ERK1/2 with PD98059 inhibits GlcAT-I promoter activity (32)
. This suggests that the p38 and ERK1/2 pathways may converge on GT target. Little is known about the signaling mechanisms responsible for up-regulation of GT gene expression and restoration of PG matrix during cartilage repair in OA. Furthermore, GT genes were not previously identified as downstream targets of p38 MAPK. A recent study has shown that XT-I expression and CS-GAG synthesis was reduced by inhibition of the p38 MAPK pathway in cardiac fibroblasts (28)
. The data presented here provide evidence for a fundamental signaling mechanism that is operative in chondrocytes regulating PG synthesis and gene expression of the GT XT-I. Inhibition of p38 MAPK was reported to inhibit TGF-β-induced cartilage-specific gene expression in mesenchymal progenitor cells (31)
and PG synthesis in chondrocyte and cartilage explants (33)
. Further studies are needed to elucidate potential links between p38 and other signaling pathways in order to understand how they converge to activate target genes that promote synthesis of CS-GAG chains in chondrocytes.
Clinical implications
Currently, no effective therapies exist that stimulate GAG synthesis in cartilage, and this deficiency is, in part, a reflection of a lack of understanding of the mechanisms involved in the loss of GAG synthesis in joint diseases. The findings reported here highlight the protective function of the endogenous GT XT-I in chondrocytes, and its role in the maintenance of cartilage GAG homeostasis. Significantly, our results show that the quantitative changes in the expression of XT-I would dictate the disease-related variations in GAG synthesis and content. Therefore, pharmacological manipulation of XT-I gene expression might have therapeutic potential for cartilage repair in OA and RA and also possibly in other degenerative joint diseases.
This work was supported by the Programme National de Recherches sur les Maladies Ostéo-Articulaire from the Institut National de la Santé et de la Recherche Médicale, The Agence Nationale de la Recherche (ANR BLAN08-3_313970), the Ligue Régionale contre le Cancer, the Contrat de Programme de Recherche Clinique, and the Programme Hospitalier de Recherche Clinique Centre Hospitalier Universitaire Nancy. We thank Pr. M.W.H. Coughtrie for critical reading of the manuscript.
Received for publication August 5, 2008. Accepted for publication October 9, 2008.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
C. Bui, M. Ouzzine, I. Talhaoui, S. Sharp, K. Prydz, M. W. H. Coughtrie, and S. Fournel-Gigleux Epigenetics: methylation-associated repression of heparan sulfate 3-O-sulfotransferase gene expression contributes to the invasive phenotype of H-EMC-SS chondrosarcoma cells FASEB J, February 1, 2010; 24(2): 436 - 450. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Muller, C. Prante, K. Kleesiek, and C. Gotting Identification and Characterization of the Human Xylosyltransferase I Gene Promoter Region J. Biol. Chem., November 6, 2009; 284(45): 30775 - 30782. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |