FASEB J. Mp Biomedicals
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.08-111096.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Supplemental Data
Right arrow Erratum (v23,p3637)
Right arrow All Versions of this Article:
fj.08-111096v1
23/1/21    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kasperczyk, H.
Right arrow Articles by Fulda, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kasperczyk, H.
Right arrow Articles by Fulda, S.
(The FASEB Journal. 2009;23:21-33.)
© 2009 FASEB

Characterization of sonic hedgehog as a novel NF-{kappa}B target gene that promotes NF-{kappa}B-mediated apoptosis resistance and tumor growth in vivo

Hubert Kasperczyk*, Bernd Baumann{dagger}, Klaus-Michael Debatin* and Simone Fulda*,1

* University Children’s Hospital, Ulm, Germany; and

{dagger} Institute of Physiological Chemistry, Ulm University, Ulm, Germany

1 Correspondence: University Children’s Hospital, Eythstr. 24, D-89075 Ulm, Germany. E-mail: simone.fulda{at}uniklinik-ulm.de


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
To explore mechanisms controlling sonic hedgehog (Shh) expression in human cancers, we investigated regulation of Shh by the transcription factor NF-{kappa}B. We identify putative NF-{kappa}B binding sites in the human Shh promoter region that specifically bind NF-{kappa}B complexes. Further, NF-{kappa}B activation by tumor necrosis factor {alpha} (TNF-{alpha}) or p65 overexpression stimulates Shh promoter activity and p65 binds to Shh promoter in vivo. NF-{kappa}B-mediated transcriptional activation of Shh is mapped to a minimal NF-{kappa}B consensus site at position +139 of Shh promoter. NF-{kappa}B activation results in increased Shh mRNA and protein expression in vitro and, notably, also in vivo in a genetic mouse model of inducible NF-{kappa}B activity. Specific NF-{kappa}B inhibition by inhibitory NF-{kappa}B{alpha} (I{kappa}-B{alpha}) superrepressor or p65 knockdown inhibits NF-{kappa}B-induced Shh promoter activation and Shh expression. NF-{kappa}B-mediated Shh expression promotes proliferation and confers resistance to TRAIL-induced apoptosis. Silencing of Shh prevents NF-{kappa}B-stimulated proliferation, while the addition of Shh rescues the proliferation defect imposed by NF-{kappa}B inhibition. Notably, NF-{kappa}B-stimulated tumor growth is significantly impaired by Shh knockdown in an in vivo model of pancreatic cancer. By demonstrating that NF-{kappa}B regulates Shh expression, which contributes to NF-{kappa}B-mediated proliferation and apoptosis resistance in vitro and in vivo, our findings have important implications to target aberrant Shh expression in human cancers.—Kasperczyk, H., Baumann, B., Debatin, K.-M., Fulda, S. Characterization of sonic hedgehog as a novel NF-{kappa}B target gene that promotes NF-{kappa}B-mediated apoptosis resistance and tumor growth in vivo.


Key Words: cancer • cell death


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
NF-{kappa}B IS A KEY TRANSCRIPTION FACTOR that orchestrates numerous processes, both in normal development and also during oncogenesis, including proliferation, apoptosis, and inflammatory responses (1) . NF-{kappa}B is composed of heterodimers or homodimers of the NF-{kappa}B/Rel family of proteins (2) . In most quiescent cells, NF-{kappa}B complexes are sequestered in the cytoplasm by their interaction with inhibitory NF-{kappa}B (I{kappa}B) proteins and, therefore, remain inactive (3) . NF-{kappa}B activity is induced in response to a variety of stimuli, for example, inflammatory cytokines or cellular stress (2) . Most stimuli cause activation of I{kappa}B kinase (IKK) complexes, which phosphorylate I{kappa}B proteins, triggering their degradation via the proteasome (2) . Thereby, NF-{kappa}B complexes are released to translocate into the nucleus, where they bind to a specific consensus sequence and regulate the transcription of target genes (2) . NF-{kappa}B target genes include genes encoding inflammatory cytokines, growth factors, and antiapoptotic proteins (1) . NF-{kappa}B is constitutively active in a variety of human cancers, for example, pancreatic carcinomal, in which it has been implicated in oncogenesis (4) .

The hedgehog pathway is an evolutionally highly conserved signaling cascade that has a nonredundant function in the control of many developmental processes (5) . The morphogen sonic hegdehog (Shh) most commonly affects cell fate during embryogenesis (5) . In addition, Shh is involved in regulating cell growth and survival, for example, in tissue stem and progenitor cells (6) . Besides its pivotal role in normal physiology, the hedgehog pathway has also been implicated to contribute to cancer formation and progression (7) . Distinct mutations in key components of the hedgehog signaling cascade, e.g., mutation of the Shh receptor Patched1, have been identified in human cancers that result in pathological activation of the hedgehog pathway (7) . In addition to genetic alterations, ligand-dependent stimulation of hedgehog signaling has recently been shown to promote tumor cell growth and survival in different types of human cancers, e.g., pancreatic, lung or prostate carcinoma or gastrointestinal tract cancers (8 9 10 11 12) . Chemical blockade of the pathway by cyclopamine was shown to inhibit proliferation, suggesting that ligand-induced abnormal activation of the hedgehog pathway plays an important role in promoting tumor growth (8 , 11) . However, the factors that regulate Shh expression in human cancers are still poorly understood.

One clue toward the identification of upstream regulators of Shh is the link between chronic inflammation and carcinogenesis (13) . During tissue repair, a late phase of inflammation, developmental pathways such as the hedgehog cascade are activated in adult tissue stem or progenitor cells to initiate the repair (14) . Similarly, aberrant stimulation of the hedgehog pathway in cancer stem or progenitor cells may foster cancer cell proliferation and survival (6 , 7) . Since many inflammatory cytokines are potent activators of NF-{kappa}B, we hypothesized that NF-{kappa}B may regulate Shh. Therefore, in order to identify novel mechanisms that regulate Shh expression in human cancers, we investigated whether NF-{kappa}B controls Shh expression.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Cell culture, chemicals, and proliferation assay
ASPC1, PaTuII, and PancTu1 pancreatic carcinoma cells, RD rhabdomyosarcoma cells, and HEK 293 human embryonic kidney cells were maintained in RPMI 1640 or Dulbecco modified Eagle medium (DMEM) (Life Technologies, Inc., Eggenstein, Germany) supplemented with 10% heat-inactivated fetal calf serum (FCS) (Biochrom, Berlin, Germany), 100 U/ml penicillin (Biochrom), 100 µg/ml streptomycin (Biochrom), 10 mM HEPES (Biochrom), and 2 mM L-glutamine (Biochrom). All chemicals were obtained from Sigma (Steinheim, Germany) unless otherwise indicated. TNF-{alpha} was purchased from Biochrom; Shh, and TRAIL from R&D Systems, Inc. (Wiesbaden, Germany). Proliferation was determined by counting cell numbers using Casy NT (Schärfe System, Reutlingen, Germany), according to the manufacturer’s instructions.

Retroviral transduction and transfection
The pCFG5-IEGZ retroviral vector system, as described by Denk et al. (15) , was used for retroviral transduction. PT67 producer cells (Clontech, Palo Alto, CA, USA) were transfected with empty pCFG5-IEGZ vector or pCFG5-IEGZ vector containing I{kappa}B{alpha}-sr or constitutive active IKK2 using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s recommendation. Twenty-four hours after transfection, PT67 producer cells were selected for 3 wk with 0.25 mg/ml Zeocin (Invitrogen) until all cells appeared green under the fluorescence microscope. Cells were seeded 24 h before infection into 6-well plates at a density of 1 x 105 cells/well. To produce virus-containing supernatants, PT67 producer cells were cultivated for 24 h in medium without zeocin. At the day of infection, the PT67 cell supernatant was obtained and filtered through a 0.45-µm filter, and 8 µg/ml of polybrene (Sigma) was added to the filtrates. Retrovirus containing PT67 cell supernatants was used to transduce cells. Two days later, retroviral transduction was confirmed by fluorescence microscopy or FACS analysis, and selection was done with 0.5 mg/ml zeocin. HEK 293 cells were transiently transfected with a plasmid encoding the N-terminal fragment of human Shh (PShhHN1-CMV5) that was kindly provided by R. Toftgard (Karolinska Institute, Sweden) using Fugene 6 Transfection Reagent (Roche, Mannheim, Germany). For RNA interference (RNAi) -mediated knockdown, cells were transfected with 60 pmol p65 or Shh SMARTpool RNAi or nontargeting control RNAi (Dharmacon, Lafayette, CO, USA) using TransMessenger transfection reagent (Qiagen, Hilden, Germany).

Nuclear protein extraction and electrophoretic mobility shift assay
Adherent cells were collected from 10-cm dishes by scraping and centrifugation (10,005 g for 5 min at 4°C). After washing once with ice-cold PBS, cell pellets were resuspended in 200 µl low-salt buffer (10 mM HEPES-OH, pH 7.9; 1.5 mM MgCl2; 10 mM KCl) and incubated for 10 min on ice. After addition of 20 µl of a 10% Nonidet P-40 solution, samples were mixed vigorously for 30 s. Nuclei were collected by centrifugation and resuspended in 50-µl high-salt buffer (20 mM HEPES-OH, pH 7.9; 420 mM NaCl; 1.5 mM MgCl2; 0.2 mM EDTA; 25% glycerol). Both buffers were supplemented with a protease-inhibitor cocktail (Sigma); 0.2 mM PMSF; 0.5 mM dithiothreitol (DTT) and 1 mM sodium-ortho-vanadate before use. Nuclei were incubated 15 min on ice and vortexed periodically. Nuclear extracts were obtained by centrifugation at 12,500 g for 10 min at 4°C and stored at –80°C. Protein concentration was determined with the BCA protein assay kit (Pierce, Rockford, IL), according to manufacturer’s instruction. The following oligonucleotides were used for electrophoretic mobility shift assay (EMSA): standard NF-{kappa}B probe: 5'-AGTTGAGGGGACTTTCCCAGGC (sense) and 5'-GCCTGGGAAAGTCCCCTCAACT (antisense); {kappa}B1: 5'-AGTTGAGGGGACTCTCC CAGGC (sense) and 5'-GCCTGGGAGAGTC CCCTCAACT (antisense); {kappa}B2: 5'-AGTTGAGGGGATTCTCCCAGGC (sense) and 5'-GCCTG GGAGAATCCC CTCAACT (antisense); {kappa}B3: 5'-AGTTGAGGGGCATTTCCCAG GC (sense) and 5'-GCCTGGGAAATGCCCCTCAACT (antisense); {kappa}B4 5'-AGTTGAGGGGAAATCCCCAGGC (sense) and 5'-GCCTGGGGATTTCCCCTCAACT (antisense); {kappa}B5: 5'-AGTTGAGGGGAAAATCCCAGGC (sense) and 5'-GCCTGGGATTTTCCCCTCAACT (antisense); {kappa}Bi1.1: 5'-AGTTGAGGGGAATCCCC CAGGC (sense) and 5'-GCCTGGGGGATTCCCCTCAACT (antisense); {kappa}Bi1.2: 5'-AGTTGAGGGGAACCCCCCAGGC (sense) and 5'-GCCTGGGGGGTTCCCCTCAACT (antisense); {kappa}Bi1.3: 5'-AGTTGAGGGAAACTCCCCAGGC (sense) and 5'-GCCTGGGGAGTTTCCCTCAACT (antisense); mtkB: 5'-AGTTGAGCCTGAACCCCCAGGC (sense) and 5'-GCCTGGGGGTTCAGGCTCAACT (antisense); and Sp1: 5'-ATTCGATCGGGGCGGGGCGAG (sense) and 5'-GCTCGCCCCGCCCCGATCGAA (antisense). All oligonucleodides were purchased from Biomers.net (Ulm, Germany), where they were HPLC-purified. Single-stranded oligonucleotides were labeled with {gamma}-32P-ATP (Amersham, Freiburg, Germany) by T4-polynucleotide kinase (MBI Fermentas, St. Leon-Rot, Germany). A 2-fold molar excess of unlabeled complementary oligonucleotides was annealed, and double-stranded oligonucleotides were purified on spin columns (Micro Bio-Spin P30; Bio-Rad, Munich, Germany). Binding reactions were performed for 30 min on ice in 20 µl buffer (1 mM MgCl2, 0.5 mM EDTA, 0.5 mM DTT, 50 mM NaCl, 10 mM Tris-HCl, pH 7.5; 4% glycerol) containing 5 µg nuclear extract protein, 1 µg poly(dI:dC) (Sigma), and 10,000 cpm-labeled oligonucleotide. For supershift experiments, 1 µg of c-Rel, p50, or p65 rabbit polyclonal antibodies (all from Santa Cruz Biotechnology, Santa Cruz, CA, USA) were added to the binding reactions and incubated 1 h on ice before addition of labeled oligonucleotides. Binding complexes were resolved by electrophoresis in vertical nondenaturing 6% polyacrylamide gels, using 0.3x TBE as running buffer. Gels were dried, and radioactive signals were detected by autoradiography films (Amersham, Freiburg, Germany).

Western blot analysis
Western blot analysis was performed, as described previously (16) . Rabbit polyclonal I{kappa}B{alpha} antibody (Santa Cruz Biotechnology), rabbit polyclonal Shh antibody (Santa Cruz Biotechnology), rabbit polyclonal IKK2 antibody (Santa Cruz Biotechnology), rabbit polyclonal RelA or RelB antibody (Santa Cruz Biotechnology), mouse monoclonal β-actin antibody (Sigma), or mouse monoclonal {alpha}-tubulin antibody (Calbiochem, Schwalbach, Germany) were used as primary antibodies, followed by goat anti-rabbit immunoglobulin G (IgG) or goat anti-mouse IgG (1:10,000; Santa Cruz Biotechnology) as secondary antibodies. Enhanced chemiluminescence (ECL; Amersham) was used for detection. Expression of {alpha}-tubulin or β-actin was used as control for equal gel loading. Densitometric analysis was performed using the program Scion Image (Scion Corp., Frederick, MD, USA).

Determination of apoptosis and caspase activity
Apoptosis was determined by FACS analysis of DNA fragmentation of propidium iodide-stained nuclei as described (17) . Caspase-3 activity was determined in living nonfixed, nonlysed cells by flow cytometry, as described (18) , using a caspase-3 substrate conjugated to rhodamine R110 (zDEVD-R110; Molecular Probes, Karlsruhe, Germany).

Reverse transcription, polymerase chain reaction (PCR) analysis, and chromatin immunoprecipitation (ChIP)
RNA was isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany). For cDNA synthesis, 1 µg RNA was transcribed using the ImPro-II reverse transcription system (Promega, Madison, WI, USA). LightCycler Faststart DNA Master SYBR Green (Roche Applied Science, Mannheim, Germany) was used for real-time PCR analysis, according to the manufacturer’s instructions, using the following primers: Shh 5' CAGCGGAAGGTATGAAGG 3' and Shh 5' CCGAGCAGTGGATATGTG 3'. The ChIP assay kit (Upstate, Lake Placid, NY, USA) was performed according to the manufacturer’s instructions using rabbit anti-p65 polyclonal antibody or IgG isotype control antibody (Santa Cruz Biotechnology) for immunoprecipitation and the following primers: 5'-GAGCTCCACAA GCTCTCCAGGCTTGC-3' and antisense 5'-CTCGAGTCCTCGCTCCGGCTCGCCCGC-3'. PCR products were resolved on an ethidium bromide-stained 2% agarose gel.

Cloning
To generate Shh luciferase reporter gene constructs, a 3500-bp fragment containing the human Shh promoter and 5' upstream region was amplified out of human genomic DNA (Invitrogen) using the Sawady Mid Range PCR System (Peqlab, Erlangen, Germany), according to the manufacturer’s recommendation. Deletion and mutation constructs were generated by restriction digest and ligation of double-stranded oligonucleotides or PCR products generated by restriction site containing primers and by site-directed mutagenesis. The following primer sequences were used: –3245/+255: fwd 5' CATGCTCGAGGACAGCTCGGAAGTCATCAG 3' and rev 5' CAGTGGATCCCGGCTTCAGCTGGACTTGAC 3'; –2990/+255: fwd 5' TAGCGGTACCAAGGAGGCTGCCTGGCTTC 3' and rev 5' ACATCACTGGGTGGTGCCTG 3'; –21818/+255: fwd 5' TAGCGGTACCTTAGGGCAGGGAGGTTTC 3' and rev 5' ACATCACTGGGTGGTGCCTG 3'; –1811/+255: fwd 5' CAGCTGAATTCGCATGTCG 3' and rev 5' ATGCGAATTCAGCTGGTAC 3'; and –322/+255: fwd 5' CAGCTGAATTCGCTC 3' and rev 5' TTAAGAGCGAATTCAGCTGGTAC 3'. The resulting fragments were cloned upstream of the luciferase gene into the promoterless pGL3 luciferase reporter vector (Promega). All plasmids were controlled by sequencing.

Luciferase assays
The Dual-Luciferase Reporter Assay System (Promega) was used to determine firefly and Renilla luciferase activities according to the manufacturer’s instructions. Cells in 12-well plates were transfected with 3x{kappa}B-firefly luciferase vector and Renilla luciferase vector under control of the ubiquitin promoter (2) per well using Fugene 6 Transfection Reagent (Roche). After 16 h, cells were stimulated as indicated and lysed with Passive Lysis Buffer (Promega). Samples were stored at –20°C. Measurements were performed with a Berthold luminometer (Berthold Technologies, Bad Wildbad, Germany), and firefly luciferase values were normalized to Renilla luciferase values. Normalizing the activity of the experimental reporter (i.e., firefly luciferase) to the activity of the internal control (i.e., Renilla luciferase) minimizes experimental variability caused, e.g., by differences in transfection efficiency.

Chorioallantoic membrane (CAM) assay
CAM assay was done as described previously (19 , 20) . Briefly, 5 x 105 tumor cells were resuspended in 25 µl of serum-free medium and 25 µl of Matrigel Matrix (BD Biosciences) and implanted on fertilized chicken eggs on day 8 of incubation. Tumors were sampled with the surrounding CAM 4 days after seeding, fixed in 4% paraformaldehyde, paraffin embedded, cut in 5-µm sections, and analyzed by immunohistochemistry with 1:1 hematoxylin and 0.5% eosin, as described previously (20) . The images were digitally recorded at a magnification of x5 with an Axiophot microscope (Carl Zeiss, Oberkochen, Germany). Tumor areas from the digitalized color photomicrographs were analyzed with SimplePCI digital imaging software (Compix Inc., Cranberry, PA, USA).

In vivo studies
Double transgenic mice expressing the reverse tetracycline-responsive transactivator (rtTA) gene under the control of the rat elastase promoter to mediate acinar cell-specific expression of IKK2 alleles were previously described (21) . Expression of constitutive active IKK2 was induced by single injection of doxycycline (100 mg/kg i.p.). Pancreatic extracts of single-transgenic IKK2-CA control mice (CA 1xTg) and double-transgenic Ela.rtTAxIKK2-CA mice (Ela.CA 2xTg) were prepared 48 h after doxycycline injection.

Statistical analysis
Statistical significance was assessed by Student’s t test (two-tailed distribution, two-sample unequal variance) or Mann-Whitney U test, where appropriate.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Identification of putative NF-{kappa}B binding sites in the promoter and upstream region of the human Shh gene
The human Shh promoter contains two alternative transcriptional start sites, a canonical TATA- and CCAAT-box in proximity to the first transcriptional start site and another TATA-box near the second transcriptional start site (Fig. 1A ) (22) . To explore whether NF-{kappa}B regulates Shh, we searched the promoter and 5' upstream region of the human Shh gene for potential binding sites of transcription factors by computer-assisted analysis using Match program (23) . One putative NF-{kappa}B consensus site was found in the promoter region, and four additional NF-{kappa}B binding sites were located 5' upstream (Fig. 1B ). We also included the first two intronic regions of the Shh gene in our analysis, since binding of transcription factors to intronic regions can modulate promoter activity. An additional three putative NF-{kappa}B binding sites were situated in intron 1 of the human Shh gene, whereas no putative NF-{kappa}B binding sites were found in intron 2 (Fig. 1B ).


Figure 1
View larger version (10K):
[in this window]
[in a new window]

 
Figure 1. Promoter and 5' upstream region of the human Shh gene. A) Nucleotide sequence of the human Shh promoter. Arrows correspond to the two transcriptional start sites, TSS 1 and TSS 2. TATA and CCAAT boxes, and putative sites for transcription factors, are indicated by boxes. Positions were counted relative to the first TSS. B) Schematic diagram of the promoter, 5' upstream region, and first intronic region of the human Shh gene. Arrows correspond to TSS 1 and TSS 2; putative NF-{kappa}B consensus sites in the promoter and 5' upstream region ({kappa}B1 to {kappa}B5), and in the first intronic region ({kappa}Bi1.1 to {kappa}Bi1.3), are indicated. Numbering is relative to the first TSS.

DNA-binding activity of NF-{kappa}B consensus sites in the Shh promoter region
Next, we investigated whether the putative NF-{kappa}B binding sites in the Shh promoter region are able to specifically bind NF-{kappa}B complexes. We used pancreatic carcinoma cells as a model to study regulation of Shh by NF-{kappa}B, since aberrant activation of the hedgehog pathway by Shh has recently been implicated in pancreatic cancer (8 , 11 , 24) . Nuclear extracts of untreated or TNF-{alpha}-stimulated cells were mixed with radioactive labeled oligonucleotides specific for the distinct putative NF-{kappa}B binding sites, and the resulting NF-{kappa}B binding complexes were resolved by EMSA. Interestingly, we found that all putative NF-{kappa}B binding sites within the human Shh promoter region bound NF-{kappa}B complexes on NF-{kappa}B stimulation by TNF-{alpha} (Fig. 2 ; ; Supplemental Table 1A). In addition, there was some constitutive DNA binding of NF-{kappa}B complexes to all putative NF-{kappa}B binding sites in unstimulated cells (Fig. 2A ). A labeled standard consensus NF-{kappa}B probe and the corresponding labeled mutant NF-{kappa}B probe (16) were used as positive and negative controls, the specificity of NF-{kappa}B DNA-binding was confirmed by cold competition experiments using unlabeled standard consensus NF-{kappa}B probe at 100-fold excess and Sp1-specific oligonucleotides served as quality control for nuclear extracts (Fig. 2A ).


Figure 2
View larger version (45K):
[in this window]
[in a new window]

 
Figure 2. DNA-binding activity of NF-{kappa}B consensus sites in the Shh promoter region. A) DNA-binding activity of putative NF-{kappa}B binding sites. Nuclear extracts of ASPC1 pancreatic carcinoma cells that were left untreated (–) or were treated for 1 h with 10 ng/ml TNF-{alpha} (+) were incubated with radioactive labeled oligonucleotides specific for the distinct NF-{kappa}B binding sites within the Shh promoter region ({kappa}B1 to {kappa}B5, {kappa}Bi1.1 to {kappa}Bi1.3), a standard NF-{kappa}B consensus probe (std{kappa}B), or the mutated standard NF-{kappa}B consensus probe (mt{kappa}B). Competition (comp.) was done with the unlabeled standard NF-{kappa}B consensus probe at 100-fold excess. Sp1 specific probe served as quality control for nuclear extracts. NF-{kappa}B binding complexes were resolved by EMSA. B) Competition of NF-{kappa}B DNA binding. Nuclear extracts of ASPC1 pancreatic carcinoma cells that were left untreated (–) or were treated for 1 h with 10 ng/ml TNF-{alpha} (+) were incubated with a radioactive labeled standard NF-{kappa}B consensus probe in the absence or presence of unlabeled oligonucleotides specific for the distinct putative NF-{kappa}B binding sites within the Shh promoter region ({kappa}B1 to {kappa}B5, {kappa}Bi1.1 to {kappa}Bi1.3), the unlabeled mutated standard NF-{kappa}B consensus probe (mt{kappa}B), or the (continued on next page) unlabeled standard NF-{kappa}B consensus probe (std{kappa}B). NF-{kappa}B binding complexes were resolved by EMSA. C) Composition of NF-{kappa}B complexes. Nuclear extracts of ASPC1 pancreatic carcinoma cells that were left untreated (–) or were treated for 1 h with 10 ng/ml TNF-{alpha} (+) were mixed with a standard NF-{kappa}B consensus probe (std{kappa}B) or oligonucleotides specific for distinct NF-{kappa}B binding sites within the Shh promoter or intronic region ({kappa}B1, {kappa}B4, {kappa}Bi1.1) in the absence or presence of antibodies recognizing c-Rel, p50, or p65 NF-{kappa}B subunits. NF-{kappa}B complexes were analyzed by EMSA for NF-{kappa}B DNA-binding activity.

In a second approach to examine DNA binding of the predicted NF-{kappa}B binding sites within the human Shh promoter region, we explored in cold competition experiments whether DNA binding of the radioactive labeled standard consensus NF-{kappa}B probe was antagonized by excess of the different unlabeled oligonucleotides specific for the distinct putative NF-{kappa}B binding sites within the Shh promoter region. Of note, DNA binding of NF-{kappa}B complexes to the standard consensus NF-{kappa}B site was strongly or almost completely inhibited when any of the tested unlabeled oligonucleotides was present at excess in the reaction mixture (Fig. 2B ; Supplemental Table 1B). Unlabeled standard consensus NF-{kappa}B probe at 100-fold excess served as a positive control and unlabeled mutant NF-{kappa}B consensus probe at excess served as negative control (Fig. 2B ).

To analyze the composition of NF-{kappa}B DNA-binding complexes, we performed EMSA supershift experiments. Antibodies recognizing p65 and p50 subunits caused a prominent supershift of NF-{kappa}B DNA-binding complexes using three of the putative NF-{kappa}B DNA-binding sites as examples (Fig. 2C ). No or very weak shifting of NF-{kappa}B DNA-binding complexes was observed using c-Rel-specific antibodies (Fig. 2C ). The standard NF-{kappa}B consensus probe, used as positive control, was similarly shifted by p65- and p50-specific antibodies (Fig. 2C ). Together, this set of experiments demonstrates that all putative NF-{kappa}B binding sites within the Shh promoter region bind NF-{kappa}B complexes in vivo that predominantly consist of p65 and p50 NF-{kappa}B subunits.

Transcriptional activation of the Shh promoter by NF-{kappa}B
Next, we asked whether NF-{kappa}B transcriptionally activates the Shh promoter. To address this question, we amplified out of human genomic DNA a 3500-bp fragment that contains the human Shh promoter and 5' upstream region with the five putative NF-{kappa}B binding sites for promoter studies. The resulting fragment was cloned upstream of the luciferase gene into the promoterless pGL3 luciferase reporter vector and was termed –3245/+255 with respect to the 5' and 3' positions relative to the first transcriptional start site of the human Shh promoter (Fig. 3A ). To map the core regions of the Shh promoter that respond to NF-{kappa}B activation, we also generated a series of 5' deletion constructs (Fig. 3A ).


Figure 3
View larger version (7K):
[in this window]
[in a new window]

 
Figure 3. Regulation of constitutive Shh promoter activity by NF-{kappa}B. A) Deletion analysis of the human Shh promoter. Top: schematic diagram of the promoter and 5' upstream region of the human Shh gene. Arrows correspond to the two transcriptional start sites, TSS 1 and TSS 2; NF-{kappa}B consensus sites {kappa}B1 to {kappa}B5 are indicated. Numbering is relative to the first TSS. Bottom: increasing 5' deletion constructs and their 5' and 3' positions with respect to the first TSS. Asterisk indicates the point mutation introduced into the NF-{kappa}B binding site. B) Constitutive Shh promoter activity. HEK 293 cells were transiently transfected with Shh promoter constructs as shown in A, full-length Shh promoter construct containing one intronic NF-{kappa}B site (–3245/i1.1, –3245/i1.2), pGL3 vector, or a vector containing 3x{kappa}B sites. The 5' positions of Shh promoter constructs relative to the first TSS are indicated. Activity of firefly and Renilla luciferase was analyzed by dual luciferase assay; data represent normalized luciferase activity. Values are means ± SE of 3 triplicate experiments. *P < 0.05; Student’s t test.

First, we determined in unstimulated cells minimal elements required for constitutive Shh promoter activity. Luciferase activity of the full-length construct (–3245/+255) was markedly increased compared to pGL3 empty vector or to firefly luciferase reporter vector containing 3x{kappa}B binding sites, a standard NF-{kappa}B reporter gene construct (Fig. 3B ), indicating that the Shh promoter displays a relatively high basal transcriptional activity. Stepwise 5' deletion of the full-length Shh promoter construct revealed that deletion construct –2990/+255 that lacks the most upstream NF-{kappa}B binding site at position –3201 displayed a similar constitutive transcriptional activity compared to the full-length construct (–3245/+255) (Fig. 3B ), suggesting that the NF-{kappa}B binding site at position –3201 is dispensable for basal transcriptional activity. By comparison, stepwise 5' deletions of the NF-{kappa}B binding sites at positions –2882, –2157, and –1610 each significantly reduced constitutive activity of the Shh promoter (Fig. 3B , compare constructs –2188/+255, –1811/+255, or –322/+255 to construct –3245/+255), indicating that each of these NF-{kappa}B binding sites contributes to the basal transcriptional activity of the Shh promoter. The shortest reporter gene construct (–322/+255) that contains a single NF-{kappa}B binding site at position +139 was sufficient to maintain an ~10-fold increase in basal transcriptional activity of the Shh promoter compared to the promoterless pGL3 luciferase reporter vector (Fig. 3B ), demonstrating that it harbors minimal promoter elements required for basal Shh promoter activity. To further study the functional role of the NF-{kappa}B binding site at position +139, we disrupted this site by site-directed mutagenesis. Notably, inactivation of this NF-{kappa}B consensus motif significantly reduced constitutive Shh promoter activity (Fig. 3B , compare constructs –322/+255 and –322mt/+255), suggesting that the NF-{kappa}B binding site at position +139 contributes to basal Shh promoter activity. Reporter gene constructs containing one of the intronic NF-{kappa}B binding sites in addition to the full-length promoter fragment revealed that these intronic NF-{kappa}B binding sites have no significant impact on the constitutive Shh promoter activity (Fig. 3B , compare constructs –3245/i1.1/+255 and –3245/i1.2/+255 to construct –3245/+255).

Next, we investigated Shh transcriptional activity in response to NF-{kappa}B activation using two approaches to stimulate NF-{kappa}B, i.e., the prototypical NF-{kappa}B inducer TNF-{alpha} and overexpression of the NF-{kappa}B subunit p65. Control experiments showed that TNF-{alpha} stimulation and p65 overexpression strongly induced NF-{kappa}B activity using a standard NF-{kappa}B reporter vector containing 3x{kappa}B binding sites (Fig. 4A-D ). Notably, NF-{kappa}B activation by TNF-{alpha} or p65 overexpression significantly enhanced transcriptional activity of the full-length Shh promoter construct containing all five NF-{kappa}B binding sites (–3245/+255) compared to untreated cells (Fig. 4A, C ). Experiments using stepwise 5' deletion promoter constructs revealed that deletion of the NF-{kappa}B site at position –3201 had no impact on TNF-{alpha}- or p65-triggered Shh promoter activation, while deletion of NF-{kappa}B sites at positions –2882, –2157, or –1610 significantly reduced Shh transcriptional activation by TNF-{alpha} or p65 (Fig. 4A, C ). Of note, the shortest promoter construct (–322/+255) with one single NF-{kappa}B consensus motif at position +139 also exhibited an induction of activity by TNF-{alpha} or p65 (Fig. 4A, C ), suggesting that this site contributes to NF-{kappa}B-stimulated Shh promoter activation. Reporter gene constructs containing one of the intronic NF-{kappa}B binding sites in addition to the full-length promoter fragment (–3245/i1.1 and –3245/i1.2) showed a similar increase in Shh promoter activity on TNF-{alpha} stimulation compared to the full-length construct without the intronic NF-{kappa}B sites (–3245/+255) (Fig. 4A ).


Figure 4
View larger version (17K):
[in this window]
[in a new window]

 
Figure 4. Transcriptional activation of the Shh promoter by NF-{kappa}B. A, B) Shh promoter activation by TNF-{alpha}-stimulated NF-{kappa}B activation. HEK 293 cells were transiently transfected with Shh promoter constructs as shown in Fig. 3 A, full-length Shh promoter construct containing one intronic NF-{kappa}B site (–3245/i1.1, –3245/i1.2), pGL3 vector, or a vector containing 3x{kappa}B sites. The 5' positions of Shh promoter constructs relative to the first transcriptional start site are indicated. B) Cells were cotransfected with Shh promoter constructs and a vector encoding I{kappa}B{alpha}-sr (open bars) or control vector (solid bars). Eighteen hours after transfection, cells were treated with 10 ng/ml TNF-{alpha} for 24 h. Activity of firefly and Renilla luciferase was analyzed by dual luciferase assay. Data represent normalized luciferase activity (A) or fold increase in luciferase activity over unstimulated cells (B). Values are means ± SE of 3 triplicate experiments. C, D) Shh promoter activation by NF-{kappa}B. HEK 293 cells were transiently transfected with Shh promoter constructs as shown in Fig. 3 A, pGL3 vector or a vector containing 3x{kappa}B sites together with control vector (open bars) or a vector encoding p65 (solid bars). The 5' positions of Shh promoter constructs relative to the first transcriptional start site are indicated. Activity of firefly and Renilla luciferase was analyzed 24 h after transfection by dual luciferase assay, and normalized luciferase activity was calculated. Data represent normalized luciferase activity (C) and fold increase in luciferase activity over unstimulated cells (D). Values are means ± SE of 3 triplicate experiments. E) ChIP assay. ASPC1 cells treated with 10 ng/ml TNF-{alpha} were subject to ChIP analysis using p65 antibody or IgG isotype control antibody. Immunoprecipitated DNA was PCR amplified using primers specific for the Shh promoter; 1% input of sonicated chromatin was used prior to immunoprecipitation. Amplified PCR products were detected on an ethidium bromide-stained agarose gel. *P < 0.05; Student’s t test.

To confirm that the observed increase in Shh transcriptional activity was mediated by NF-{kappa}B, we specifically blocked NF-{kappa}B activation using the dominant-negative mutant I{kappa}B{alpha} superrepressor (I{kappa}B{alpha}-sr) that cannot be phosphorylated at serine 32/36. Control experiments using the standard luciferase reporter construct (3x{kappa}B) confirmed that ectopic expression of I{kappa}B{alpha}-sr blocked TNF-{alpha}-stimulated NF-{kappa}B activation (Fig. 4B ). Inhibition of TNF-{alpha}-induced NF-{kappa}B activation by I{kappa}B{alpha}-sr completely prevented the increase in Shh transcriptional activity in response to TNF-{alpha} stimulation for all Shh reporter gene constructs tested (Fig. 4B ), demonstrating that NF-{kappa}B is necessary for TNF-{alpha}-triggered transcriptional activation of the Shh promoter.

To directly test the requirement of the NF-{kappa}B binding site at position +139 for Shh transcriptional activation, we used the mutant promoter construct –322mt/+255, in which the NF-{kappa}B consensus site was inactivated by site-specific mutagenesis. Notably, disruption of the NF-{kappa}B binding site at position +139 significantly reduced the TNF-{alpha}-stimulated increase in Shh promoter activity compared to wild-type construct (Fig. 4B ) and completely abolished p65-stimulated Shh promoter activation (Fig. 4D ). This demonstrates that the NF-{kappa}B binding site at position +139 is required for NF-{kappa}B-mediated up-regulation of Shh transcriptional activity.

To investigate whether NF-{kappa}B binds to the Shh promoter in vivo, we performed ChIP experiments using an antibody to p65 subunit of NF-{kappa}B. TNF-{alpha}-stimulated NF-{kappa}B activation resulted in increased binding of p65 to the Shh promoter region (Fig. 4E ). Together, this set of experiments demonstrates that the Shh promoter is under the transcriptional control of NF-{kappa}B.

NF-{kappa}B induces Shh expression in human cancers
In the next step, we explored whether the increase in Shh transcriptional activity on NF-{kappa}B activation results in elevated Shh expression. NF-{kappa}B activation by TNF-{alpha} led to a time-dependent up-regulation of Shh mRNA accompanied by enhanced expression of the biologically active form of Shh protein (Fig. 5A, B ) (25) . Control experiments using protein lysates of 293 cells transiently transfected with a plasmid encoding the 19 kDa N-terminal Shh fragment confirmed the specificity of the Shh antibody (Fig. 5C ). These findings demonstrate that TNF-{alpha}-induced transcriptional activation of the Shh promoter leads to increased Shh mRNA and protein expression.


Figure 5
View larger version (6K):
[in this window]
[in a new window]

 
Figure 5. Induction of Shh expression by NF-{kappa}B activation. ASPC1 pancreatic carcinoma cells were treated for indicated times with 10 ng/ml TNF-{alpha}. A) Shh mRNA expression was analyzed by real-time PCR analysis; data represent relative Shh mRNA expression of TNF-{alpha}-treated samples compared to the untreated sample. Values are means ± SE of 3 triplicate experiments. B) Expression of the 19-kDa N-terminal Shh protein was analyzed by Western blot analysis, {alpha}-tubulin expression served as a loading control. Shh and {alpha}-tubulin protein expression was determined by densitometry, and the ratio of Shh to {alpha}-tubulin was calculated. Data represent the fold increase in Shh protein expression of TNF-{alpha}-treated samples compared to the untreated sample. Data are representative of 3 independent experiments. C) HEK 293 cells were transiently transfected with a construct encoding the 19-kDa N-terminal fragment of Shh or empty control vector (co). Expression of Shh and {alpha}-tubulin protein were analyzed by Western blotting. Data are representative of 3 independent experiments. *P < 0.05; Student’s t test.

To exclude that the TNF-{alpha}-triggered up-regulation of Shh expression was restricted to a particular cell line, we extended our studies to additional pancreatic carcinoma cell lines and also to rhabdomyosarcoma, another prototypic cancer, in which the hedgehog pathway has been implicated (6 , 7) . Similarly, NF-{kappa}B activation by TNF-{alpha} resulted in elevated Shh mRNA and protein expression in PaTuII and PancTu1 pancreatic carcinoma and RD rhabdomyosarcoma cells (Fig. 6 ). Together, this set of experiments shows that TNF-{alpha}-stimulated NF-{kappa}B activation induces Shh expression in different cancer types.


Figure 6
View larger version (15K):
[in this window]
[in a new window]

 
Figure 6. Induction of Shh expression by NF-{kappa}B activation in human cancers. PaTuII pancreatic carcinoma (A), PancTu1 pancreatic carcinoma (B), and RD rhabdomyosarcoma (C) cells were treated for indicated times with 10 ng/ml TNF-{alpha}. Top panels: Shh mRNA expression was analyzed by real-time PCR analysis; data represent relative Shh mRNA expression of TNF-{alpha}-treated samples compared to the untreated sample. Values are means ± SE of 3 or 5 triplicate experiments. Statistical significance was determined by Student’s t test comparing TNF-{alpha}-treated vs. untreated samples (*P<0.05). Bottom panels: expression of Shh protein was analyzed by Western blotting; {alpha}-tubulin expression served as loading control. *P < 0.05; Student’s t test.

To directly test whether NF-{kappa}B is required for TNF-{alpha}-stimulated up-regulation of Shh, we generated ASPC1 pancreatic carcinoma and RD rhabdomyosarcoma cells in which NF-{kappa}B was specifically blocked by stable overexpression of mutant I{kappa}B{alpha}-sr. Control experiments confirmed expression of mutant I{kappa}B{alpha}-sr protein (Fig. 7A ; Supplemental Fig. 1A) and its functionality, since I{kappa}B{alpha}-sr inhibited constitutive and TNF-{alpha}-triggered NF-{kappa}B DNA-binding (Fig. 7B ; Supplemental Fig. 1B). In parallel with NF-{kappa}B inhibition, I{kappa}B{alpha}-sr significantly reduced basal and TNF-{alpha}-stimulated Shh expression (Fig. 7C ; Supplemental Fig. 1C). To further investigate whether NF-{kappa}B is involved in the control of Shh expression, we also inhibited NF-{kappa}B by a RNA interference (RNAi) approach. Similarly, knockdown of p65 by RNAi resulted in a significant decrease in basal and TNF-{alpha}-triggered Shh expression (Fig. 7D ; Supplemental Fig. 2A). This demonstrates that NF-{kappa}B activity is required for basal and TNF-{alpha}-induced Shh expression.


Figure 7
View larger version (12K):
[in this window]
[in a new window]

 
Figure 7. NF-{kappa}B is required for TNF-{alpha}-induced Shh expression. A) Ectopic expression of I{kappa}B{alpha}-sr. ASPC1 pancreatic carcinoma cells were transduced with control vector (co) or a vector containing I{kappa}B{alpha}-sr. Protein expression of wild-type I{kappa}B{alpha} (I{kappa}B{alpha}-wt) and mutant I{kappa}B{alpha}-sr was determined by Western blot analysis; {alpha}-tubulin served as loading control. B) Inhibition of NF-{kappa}B activation by I{kappa}B{alpha}-sr. ASPC1 pancreatic carcinoma cells, which were transduced with control vector (co) or a vector containing I{kappa}B{alpha}-sr, were left untreated (–) or were treated with 10 ng/ml TNF-{alpha} for 1 h (+). NF-{kappa}B DNA-binding activity was assessed in nuclear extracts by EMSA. Data are representative of 3 independent experiments. C, D) Inhibition of TNF-{alpha}-induced Shh expression by NF-{kappa}B inhibition. ASPC1 pancreatic carcinoma cells transduced with control vector or a vector containing I{kappa}B{alpha}-sr (C) or transfected with p65 or control siRNA (D) were treated with 10 ng/ml TNF-{alpha} for indicated times (C) or for 24 h (D). Shh mRNA expression was analyzed by real-time PCR analysis; data represent the fold increase in Shh mRNA expression of TNF-{alpha}-treated samples compared to the untreated sample. Values are means ± SE of 3 or 4 triplicate experiments. *P < 0.05; Student’s t test.

NF-{kappa}B regulates Shh expression in vivo
Next, we investigated in a genetic mouse model whether NF-{kappa}B activity correlates with Shh expression in vivo. We used a mouse model of conditional induction of NF-{kappa}B by doxycycline-inducible expression of constitutive active IKK2 in pancreatic acinar cells (21) . Interestingly, activation of the IKK2/NF-{kappa}B pathway by expression of constitutive active IKK2 resulted in increased Shh protein expression in vivo (Fig. 8 ). Up-regulation of NF-{kappa}B target gene RelB confirmed that active IKK2 triggered activation of the NF-{kappa}B pathway in vivo (Fig. 8) . These whole animal genetic studies support the biochemical and cell biological data that NF-{kappa}B regulates Shh expression.


Figure 8
View larger version (16K):
[in this window]
[in a new window]

 
Figure 8. Regulation of Shh expression by NF-{kappa}B in vivo. Pancreatic extracts of two single-transgenic IKK2-CA control mice (CA 1xTg) and two double-transgenic Ela.rtTAxIKK2-CA mice (Ela.CA 2xTg) were analyzed 48 h after doxycycline injection for Shh, IKK2, and RelB expression by Western blot analysis; {alpha}-tubulin served as a loading control.

NF-{kappa}B/Shh axis promotes cancer cell proliferation and apoptosis resistance
We then investigated the functional relevance of NF-{kappa}B-regulated Shh expression for cancer cell proliferation. Notably, inhibition of NF-{kappa}B by I{kappa}B{alpha}-sr or by p65 silencing significantly reduced basal and TNF-{alpha}-stimulated proliferation (Fig. 9A, B ). To further explore the functional relevance of the NF-{kappa}B/Shh axis, we knocked down Shh expression by RNAi (Supplemental Fig. 2B). Also, Shh knockdown significantly reduced basal and TNF-{alpha}-induced proliferation (Fig. 9C ). Moreover, we asked whether exogenous supply of Shh rescues the decrease in proliferation in cells in which the NF-{kappa}B pathway is inhibited. Intriguingly, the addition of Shh rescued the decrease in proliferation in cells in which NF-{kappa}B is inhibited by I{kappa}B{alpha}-sr (Fig. 9D ). These findings indicate that NF-{kappa}B stimulates cancer cell proliferation, at least in part, via Shh.


Figure 9
View larger version (13K):
[in this window]
[in a new window]

 
Figure 9. NF-{kappa}B/Shh axis promotes cancer cell proliferation. A–C) Cell counts were determined in ASPC1 cells transduced with control vector or a vector containing I{kappa}B{alpha}-sr (A) or transfected with siRNA against p65 (B) or Shh (C) in the absence or presence of 10 pg/ml TNF-{alpha} for 3 days. D) Cell counts were determined in ASPC1 cells transduced with control vector or a vector containing I{kappa}B{alpha}-sr in the absence or presence of 1 µg/ml Shh for 3 days. Values are means ± SE of 3 triplicate experiments. *P < 0.05; Student’s t test.

Furthermore, we asked whether Shh contributes to NF-{kappa}B-mediated resistance to apoptosis. To address this question, we engineered cells with a constitutive active form of IKK2 to trigger NF-{kappa}B activation and simultaneously silenced Shh by RNAi (Fig. 10A ). IKK2 overexpression increased Shh expression and significantly decreased apoptosis induced by the death receptor ligand TRAIL (Fig. 10A, B ). Notably, knockdown of Shh reversed the IKK2-conferred protection against apoptosis (Fig. 10B ). Analysis of caspase-3 activity as another characteristic marker of apoptosis confirmed that Shh contributes to the NF-{kappa}B-mediated protection against TRAIL-induced caspase-3 activation (Fig. 10C ). These findings indicate that NF-{kappa}B-induced Shh expression promotes apoptosis resistance.


Figure 10
View larger version (12K):
[in this window]
[in a new window]

 
Figure 10. NF-{kappa}B/Shh axis promotes apoptosis resistance. ASPC1 cells transduced with control vector or a vector containing constitutive active IKK2 IKK2 were transfected with siRNA against Shh or control siRNA. A) Protein levels of IKK2 and Shh were analyzed by Western blot analysis; β-actin served as a loading control. B) Apoptosis was determined after treatment with 50 ng/ml TRAIL and 6 µg/ml cycloheximide for 24 h by FACS analysis of DNA fragmentation of propidium iodide stained nuclei. C) Caspase-3 activity was determined by FACS analysis and is expressed as fold increase of untreated control cells. Values are means ± SE of 3 triplicate experiments. *P < 0.05; Student’s t test.

NF-{kappa}B promotes tumor growth via Shh in vivo
Finally, we investigated the relevance of the NF-{kappa}B/Shh axis for the stimulation of tumor growth by NF-{kappa}B in vivo using the CAM model, an established in vivo tumor model (19 , 20) . While ectopic expression of IKK2 significantly enhanced pancreatic cancer growth in vivo, silencing of Shh significantly reduced this IKK2-mediated increase in tumor growth (Fig. 11 ). This demonstrates in an in vivo model of pancreatic cancer that NF-{kappa}B-induced Shh expression contributes to the NF-{kappa}B-mediated stimulation of tumor growth.


Figure 11
View larger version (31K):
[in this window]
[in a new window]

 
Figure 11. NF-{kappa}B promotes tumor growth via Shh in vivo. ASPC1 cells that were transduced with control vector or a vector containing constitutive active IKK2 and transfected with siRNA against Shh or control siRNA were seeded on the CAM of chicken embryos. The CAM was excised after 4 days, fixed, and stained with hematoxylin and eosin. A) Representative images. Scale bar = 800 µm. B) Relative tumor area compared to control cells. Values are means ± SE; 8 samples/group. *P < 0.05.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Recent studies demonstrate that aberrant activation of the hedgehog cascade in human cancers can be caused by elevated levels of hedgehog ligands, for example, Shh (8 9 10 11 12) . Thus, ligand-dependent hedgehog pathway stimulation may be a key mechanism that promotes tumor growth. However, little is yet known about the factors that regulate Shh expression in human cancers.

Here, we demonstrate that NF-{kappa}B directly regulates Shh in vitro and in vivo and promotes cancer cell proliferation and apoptosis resistance via Shh. This conclusion is supported by several independent pieces of evidence. First, NF-{kappa}B complexes bind in electrophoretic mobility shift assays to putative NF-{kappa}B binding sites within the human Shh promoter region that were identified by computer-assisted analysis. Second, NF-{kappa}B triggers Shh promoter activation via a minimal NF-{kappa}B consensus site at position +139 of the Shh promoter, as shown by deletion and mutation promoter analysis, and NF-{kappa}B subunit p65 binds to the Shh promoter in vivo. Third, TNF-{alpha} enhances Shh mRNA and protein expression in an NF-{kappa}B-dependent manner in two prototypic cancers, in which the hedgehog pathway has been implicated, i.e., pancreatic carcinoma and rhabdomyosarcoma. Fourth, whole animal studies in a genetic mouse model of inducible IKK2 activity support the biochemical and cell biological data by showing that NF-{kappa}B activation results in increased Shh expression in vivo. Fifth, the functional relevance of the NF-{kappa}B/Shh axis for cancer growth and survival is shown by specific genetic modulation of NF-{kappa}B or Shh function. Accordingly, NF-{kappa}B-stimulated proliferation is reduced by inhibition of NF-{kappa}B or Shh, while supply of Shh rescues the decrease in proliferation imposed by NF-{kappa}B inhibition. Further, Shh is required for the NF-{kappa}B-mediated protection against TRAIL-induced apoptosis. Sixth, the NF-{kappa}B-mediated stimulation of tumor growth is significantly impaired by simultaneous knockdown of Shh in an in vivo model of pancreatic cancer. Together, these findings demonstrate that NF-{kappa}B regulates Shh expression, which contributes to NF-{kappa}B-mediated proliferation and apoptosis resistance.

Biochemical and promoter studies identify NF-{kappa}B binding sites at positions +139, –1610, –2157, and –2882 in the Shh promoter region as functional sites that contribute to constitutive and NF-{kappa}B-induced Shh promoter activity, while NF-{kappa}B sites at position –3201 and in intron 1 turned out to be dispensable. Since TNF-{alpha} stimulates Shh promoter activity through NF-{kappa}B both directly via the minimal NF-{kappa}B binding site and also in an indirect manner, additional factors may cooperate with TNF-{alpha} to transactivate the Shh promoter. Cooperative interaction of transcription factors has been reported, e.g., for NF-{kappa}B and Elk-1 or c-Myb (26 , 27) . Although the Shh promoter contains putative binding sites for Elk-1 or c-Myb (Fig. 1A ), we found no up-regulation of Elk-1 or c-Myb expression and no DNA-binding of Elk-1 or c-Myb to the Shh promoter on TNF-{alpha} stimulation (data not shown), making it unlikely that these transcription factors cooperate with NF-{kappa}B to transactivate the Shh promoter in the pancreatic carcinoma cell lines investigated. It will, therefore, be subject to our future investigations to identify factors that act in concert with TNF-{alpha}-stimulated NF-{kappa}B activation to induce Shh expression.

A possible link between NF-{kappa}B and Shh has previously been suggested. For example, during avian embryonic limb formation, inhibition of NF-{kappa}B activity in limb mesenchyme led to reduced Shh expression (28) . During hair development, NF-{kappa}B was reported to be essential for Shh induction in a genetic mouse model with suppressed NF-{kappa}B activity (29) . In addition, NF-{kappa}B has recently been reported to contribute to hedgehog pathway activation through Shh induction in pancreatic carcinoma (30) . Compared to these reports, the novelty of our study particularly resides in the following points: First, we demonstrate that the human Shh promoter is under the direct control of NF-{kappa}B and identify the minimal NF-{kappa}B consensus site in the human Shh promoter. Second, we show that NF-{kappa}B regulates Shh expression in vivo in a mouse model of inducible NF-{kappa}B activation. Third, our results highlight the role of the NF-{kappa}B-mediated up-regulation of Shh not only for the stimulation of cancer cell proliferation, as described previously (30) , but also for conferring apoptosis resistance, and thus extend the functional relevance of the NF-{kappa}B/Shh axis to another hallmark of cancer. Given the multitude of NF-{kappa}B target genes (3) , it is important to characterize their individual contribution to the different aspects of cancer cell biology that are controlled by NF-{kappa}B. Fourth, we provide evidence for the in vivo relevance of the NF-{kappa}B/Shh axis by showing in an in vivo model of pancreatic cancer that NF-{kappa}B promotes tumor growth, at least in part, via induction of Shh expression. Together, these findings substantially advance the understanding of the regulation of the NF-{kappa}B/Shh axis and its impact on tumor cell proliferation and survival. The elucidation of the NF-{kappa}B/Shh-regulated signaling network has important implications, e.g., for the development of new strategies to target aberrant Shh activation in human cancers, which warrants further investigation.


   ACKNOWLEDGMENTS
 
We thank R. Toftgard (Karolinska Institute, Sweden) for providing the vector encoding the N-terminal fragment of human Shh (PShhHN1-CMV5), M. Jovanovic and A. Dittrich for expert technical assistance, and H. Hahn (University of Goettingen, Germany) for helpful discussions and critical reading of the manuscript. This work has been partially supported by a grant from the Deutsche Forschungsgemeinschaft and by IAP6/18 (to S.F.).

Received for publication April 9, 2008. Accepted for publication August 7, 2008.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Karin, M., Cao, Y., Greten, F. R., Li, Z. W. (2002) NF-{kappa}B in cancer: from innocent bystander to major culprit. Nat. Rev. Cancer 2,301-310[CrossRef][Medline]
  2. Hayden, M. S., Ghosh, S. (2004) Signaling to NF-{kappa}B. Genes Dev. 18,2195-2224[Abstract/Free Full Text]
  3. Perkins, N. D. (2007) Integrating cell-signalling pathways with NF-{kappa}B and IKK function. Nat. Rev. Mol. Cell. Biol. 8,49-62[CrossRef][Medline]
  4. Algul, H., Adler, G., Schmid, R. M. (2002) NF-{kappa}B/Rel transcriptional pathway: implications in pancreatic cancer. Int. J. Gastrointest. Cancer 31,71-78[CrossRef][Medline]
  5. Ingham, P. W., Placzek, M. (2006) Orchestrating ontogenesis: variations on a theme by sonic hedgehog. Nat. Rev. Genet. 7,841-850[CrossRef][Medline]
  6. Ruizi Altaba, A., Sanchez, P., Dahmane, N. (2002) Gli and hedgehog in cancer: tumours, embryos and stem cells. Nat. Rev. Cancer 2,361-372[CrossRef][Medline]
  7. Pasca di Magliano, M., Hebrok, M. (2003) Hedgehog signalling in cancer formation and maintenance. Nat. Rev. Cancer 3,903-911[CrossRef][Medline]
  8. Berman, D. M., Karhadkar, S. S., Hallahan, A. R., Pritchard, J. I., Eberhart, C. G., Watkins, D. N., Chen, J. K., Cooper, M. K., Taipale, J., Olson, J. M., Beachy, P. A. (2002) Medulloblastoma growth inhibition by hedgehog pathway blockade. Science 297,1559-1561[Abstract/Free Full Text]
  9. Berman, D. M., Karhadkar, S. S., Maitra, A., Montes De Oca, R., Gerstenblith, M. R., Briggs, K., Parker, A. R., Shimada, Y., Eshleman, J. R., Watkins, D. N., Beachy, P. A. (2003) Widespread requirement for Hedgehog ligand stimulation in growth of digestive tract tumours. Nature 425,846-851[CrossRef][Medline]
  10. Karhadkar, S. S., Bova, G. S., Abdallah, N., Dhara, S., Gardner, D., Maitra, A., Isaacs, J. T., Berman, D. M., Beachy, P. A. (2004) Hedgehog signalling in prostate regeneration, neoplasia and metastasis. Nature 431,707-712[CrossRef][Medline]
  11. Thayer, S. P., di Magliano, M. P., Heiser, P. W., Nielsen, C. M., Roberts, D. J., Lauwers, G. Y., Qi, Y. P., Gysin, S., Fernandez-del Castillo, C., Yajnik, V., Antoniu, B., McMahon, M., Warshaw, A. L., Hebrok, M. (2003) Hedgehog is an early and late mediator of pancreatic cancer tumorigenesis. Nature 425,851-856[CrossRef][Medline]
  12. Watkins, D. N., Berman, D. M., Burkholder, S. G., Wang, B., Beachy, P. A., Baylin, S. B. (2003) Hedgehog signalling within airway epithelial progenitors and in small-cell lung cancer. Nature 422,313-317[CrossRef][Medline]
  13. Karin, M., Greten, F. R. (2005) NF-{kappa}B: linking inflammation and immunity to cancer development and progression. Nat. Rev. Immunol. 5,749-759[CrossRef][Medline]
  14. Beachy, P. A., Karhadkar, S. S., Berman, D. M. (2004) Tissue repair and stem cell renewal in carcinogenesis. Nature 432,324-331[CrossRef][Medline]
  15. Denk, A., Goebeler, M., Schmid, S., Berberich, I., Ritz, O., Lindemann, D., Ludwig, S., Wirth, T. (2001) Activation of NF-{kappa}B via the I{kappa} B kinase complex is both essential and sufficient for proinflammatory gene expression in primary endothelial cells. J. Biol. Chem. 276,28451-28458[Abstract/Free Full Text]
  16. Kasperczyk, H., La Ferla-Bruhl, K., Westhoff, M. A., Behrend, L., Zwacka, R. M., Debatin, K. M., Fulda, S. (2005) Betulinic acid as new activator of NF-{kappa}B: molecular mechanisms and implications for cancer therapy. Oncogene 24,6945-6956[CrossRef][Medline]
  17. Vogler, M., Durr, K., Jovanovic, M., Debatin, K. M., Fulda, S. (2007) Regulation of TRAIL-induced apoptosis by XIAP in pancreatic carcinoma cells. Oncogene 26,248-257[CrossRef][Medline]
  18. Giagkousiklidis, S., Vellanki, S. H., Debatin, K. M., Fulda, S. (2007) Sensitization of pancreatic carcinoma cells for gamma-irradiation-induced apoptosis by XIAP inhibition. Oncogene 26,7006-7016[CrossRef][Medline]
  19. Kuefer, R., Hofer, M. D., Altug, V., Zorn, C., Genze, F., Kunzi-Rapp, K., Hautmann, R. E., Gschwend, J. E. (2004) Sodium butyrate and tributyrin induce in vivo growth inhibition and apoptosis in human prostate cancer. Br. J. Cancer 90,535-541[CrossRef][Medline]
  20. Kunzi-Rapp, K., Genze, F., Kufer, R., Reich, E., Hautmann, R. E., Gschwend, J. E. (2001) Chorioallantoic membrane assay: vascularized 3-dimensional cell culture system for human prostate cancer cells as an animal substitute model. J. Urol. 166,1502-1507[CrossRef][Medline]
  21. Baumann, B., Wagner, M., Aleksic, T., von Wichert, G., Weber, C. K., Adler, G., Wirth, T. (2007) Constitutive IKK2 activation in acinar cells is sufficient to induce pancreatitis in vivo. J. Clin. Invest. 117,1502-1513[CrossRef][Medline]
  22. Kitazawa, S., Kitazawa, R., Tamada, H., Maeda, S. (1998) Promoter structure of human sonic hedgehog gene. Biochim. Biophys. Acta 1443,358-363[Medline]
  23. Kel, A. E., Gossling, E., Reuter, I., Cheremushkin, E., Kel-Margoulis, O. V., Wingender, E. (2003) MATCH: A tool for searching transcription factor binding sites in DNA sequences. Nucleic Acids Res. 31,3576-3579[Abstract/Free Full Text]
  24. Prasad, N. B., Biankin, A. V., Fukushima, N., Maitra, A., Dhara, S., Elkahloun, A. G., Hruban, R. H., Goggins, M., Leach, S. D. (2005) Gene expression profiles in pancreatic intraepithelial neoplasia reflect the effects of Hedgehog signaling on pancreatic ductal epithelial cells. Cancer Res. 65,1619-1626[Abstract/Free Full Text]
  25. Guy, R. K. (2000) Inhibition of sonic hedgehog autoprocessing in cultured mammalian cells by sterol deprivation. Proc. Natl. Acad. Sci. U. S. A. 97,7307-7312[Abstract/Free Full Text]
  26. Fujioka, S., Niu, J., Schmidt, C., Sclabas, G. M., Peng, B., Uwagawa, T., Li, Z., Evans, D. B., Abbruzzese, J. L., Chiao, P. J. (2004) NF-{kappa}B and AP-1 connection: mechanism of NF-{kappa}B-dependent regulation of AP-1 activity. Mol. Cell. Biol. 24,7806-7819[Abstract/Free Full Text]
  27. Suhasini, M., Pilz, R. B. (1999) Transcriptional elongation of c-myb is regulated by NF-{kappa}B (p50/RelB). Oncogene 18,7360-7369[CrossRef][Medline]
  28. Bushdid, P. B., Brantley, D. M., Yull, F. E., Blaeuer, G. L., Hoffman, L. H., Niswander, L., Kerr, L. D. (1998) Inhibition of NF-{kappa}B activity results in disruption of the apical ectodermal ridge and aberrant limb morphogenesis. Nature 392,615-618[CrossRef][Medline]
  29. Schmidt-Ullrich, R., Tobin, D. J., Lenhard, D., Schneider, P., Paus, R., Scheidereit, C. (2006) NF-{kappa}B transmits Eda A1/EdaR signalling to activate Shh and cyclin D1 expression, and controls post-initiation hair placode down growth. Development 133,1045-1057[Abstract/Free Full Text]
  30. Nakashima, H., Nakamura, M., Yamaguchi, H., Yamanaka, N., Akiyoshi, T., Koga, K., Yamaguchi, K., Tsuneyoshi, M., Tanaka, M., Katano, M. (2006) Nuclear factor-{kappa}B contributes to hedgehog signaling pathway activation through sonic hedgehog induction in pancreatic cancer. Cancer Res. 66,7041-7049[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J Mol Cell BiolHome page
B. Stecca and A. Ruiz i Altaba
Context-dependent Regulation of the GLI Code in Cancer by HEDGEHOG and Non-HEDGEHOG Signals
J Mol Cell Biol, January 17, 2010; (2010) mjp052v1.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
N. M. Amankulor, D. Hambardzumyan, S. M. Pyonteck, O. J. Becher, J. A. Joyce, and E. C. Holland
Sonic Hedgehog Pathway Activation Is Induced by Acute Brain Injury and Regulated by Injury-Related Inflammation
J. Neurosci., August 19, 2009; 29(33): 10299 - 10308.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Supplemental Data
Right arrow Erratum (v23,p3637)
Right arrow All Versions of this Article:
fj.08-111096v1
23/1/21    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kasperczyk, H.
Right arrow Articles by Fulda, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kasperczyk, H.
Right arrow Articles by Fulda, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS