FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published as doi: 10.1096/fj.08-110213.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Supplemental Data
Right arrow All Versions of this Article:
fj.08-110213v1
23/1/194    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fortin, C. F.
Right arrow Articles by McDonald, P. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fortin, C. F.
Right arrow Articles by McDonald, P. P.
(The FASEB Journal. 2009;23:194-203.)
© 2009 FASEB

Autocrine role of endogenous interleukin-18 on inflammatory cytokine generation by human neutrophils

Carl F. Fortin, Thornin Ear and Patrick P. McDonald1

Pulmonary Division, Faculty of Medicine, Université de Sherbrooke; and Centre de Recherche du Centre Hospitalier de Université de Sherbrooke (CHUS), Sherbrooke, Quebec, Canada

1 Correspondence: Pulmonary Division, Faculty of Medicine, Université de Sherbrooke, 3001, 12e Avenue Nord, pièce 4849, Sherbrooke, QC, Canada J1H 5N4. E-mail: patrick.mcdonald{at}usherbrooke.ca


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Neutrophils are key players of innate immunity and influence inflammatory and immune reactions through the production of numerous cytokines. Interleukin-18 (IL-18) is known to stimulate several neutrophil responses, and recent evidence suggests that neutrophils might represent a source of IL-18. Here, we show that neutrophils constitutively produce both IL-18 and its antagonist, IL-18BP. Cell activation does not affect IL-18BP release but leads to an increased gene expression and secretion of IL-18, a process that depends on NF-{kappa}B activation. Moreover, endogenous IL-18 feeds back on the neutrophils to augment cytokine generation in lipopolysaccharide-treated cells. Accordingly, exogenous IL-18 can induce the gene expression and release of several inflammatory cytokines in neutrophils, including its own expression. We finally report that IL-18 activates the p38 MAPK, MEK/ERK, and PI3K/Akt pathways in neutrophils. The IKK cascade is also activated by IL-18, resulting in I{kappa}B-{alpha} degradation, NF-{kappa}B activation, and RelA phosphorylation. Accordingly, these pathways contribute to the generation of inflammatory cytokines in IL-18-stimulated neutrophils. By contrast, the phosphorylation and DNA-binding activity of various STAT proteins were not induced by IL-18. Collectively, our results unveil new interactions between IL-18 and neutrophils and further support a role for these cells in influencing both innate and adaptive immunity.—Fortin, C. F., Ear, T., McDonald, P. P. Autocrine role of endogenous interleukin-18 on inflammatory cytokine generation by human neutrophils.


Key Words: signaling pathways • granulocytes


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
INTERLEUKIN-18 (IL-18) IS A PLURIPOTENT cytokine that is normally produced by macrophages, dendritic cells (DCs), and epithelial cells (1) . It is synthesized as a 24-kDa precursor, which is then cleaved to an 18-kDa mature IL-18 protein by inflammasome-activated caspase-1 (2) . Functionally, IL-18 has profound effects on the innate and adaptive immune systems. In particular, IL-18 enhances the IL-12-driven, Th1-mediated immune responses, which play a critical role in host defense against infection by intracellular microbes through the induction of IFN-{gamma} (3 , 4) . Conversely, in the absence of IL-12, IL-18 stimulates Th2 immune responses (3 , 4) . Thus, IL-18 is a rather unique cytokine, insofar as it can enhance both Th1- and Th2-driven immune responses, as well as innate immunity (4) .

The biological actions of IL-18 can be counteracted by the IL-18 binding protein (IL-18BP), which blocks the binding of mature IL-18 to its receptor, thereby inhibiting downstream processes such as NF-{kappa}B activation and the generation of IFN-{gamma} or IL-8 (5) . Thus, just as IL-18 is a member of the IL-1 family of cytokines, IL-18BP is functionally similar to the naturally occurring IL-1 receptor antagonist. The expression and release of IL-18BP are known to occur in response to IFN-{gamma} in colon carcinoma and epithelial cell lines (6) , whereas in the myeloid lineage, monocytes and NK cells produce IL-18BP in response to Th1 cytokines such as IFN{gamma}, IL-2, IL-12, IL-15, and IL-18 (7) .

Cellular targets of IL-18 include several leukocyte populations, including neutrophils. The latter are key players in innate immunity and are the first to leave the circulation to engage invading pathogens. In addition to their notorious phagocytic and microbicidal activities, neutrophils are often pivotal in launching and/or amplifying inflammatory and immune responses (8) . One foremost mechanism whereby neutrophils exert these actions is through the synthesis and release of a variety of cytokines and chemokines, such as IL-1β, tumor necrosis factor {alpha} (TNF-{alpha}), IFN{gamma}, IL-12, IL-8 (CXCL8), Mip-1{alpha}/β (CCL3 and CCL4), and a host of others (9 10 11 12 13 14 15 16 17 18 19) . Similarly, neutrophils can secrete remarkable amounts of soluble B-lymphocyte stimulator (BLyS) (20) , an important B-cell maturation and survival factor. As a result, neutrophils are increasingly seen as important intermediates in bridging innate and acquired immunity, as recently reviewed by Nathan (8) .

Several neutrophil responses can be triggered by IL-18. These include degranulation, the up-regulation of surface CD11b, priming of the respiratory burst, and the activation of the p38 MAP kinase (21 22 23) . In addition, IL-18 was reported to induce the secretion of a few cytokines (IL-1, IL-6, IL-8) and related products (IL-1ra) in neutrophils (23 24 25) . Moreover, it was recently shown that in healthy subjects, unstimulated neutrophils constitutively secrete IL-18 (26) and that in oral cavity cancer patients, constitutive IL-18 release by neutrophils could be enhanced following lipopolysaccharide (LPS) stimulation (27) . The fact that IL-18 is both a neutrophil product and an activator, prompted us to investigate under which conditions neutrophils from healthy subjects can express and release IL-18 and IL-18BP, and whether IL-18 might positively feedback on these cells. We now report that IL-18 gene expression is up-regulated by LPS, TNF-{alpha}, and IL-18 itself, and that it is under the control of NF-{kappa}B. We confirm that neutrophils constitutively secrete IL-18 and also show that of all agonists tested, only LPS transiently augments IL-18 secretion. Neutrophils were additionally found to constitutively secrete IL-18BP, but this response was not affected by the cell stimulation status. Moreover, IL-18 induces the gene expression and release of several inflammatory cytokines in neutrophils. The signaling pathways mobilized by IL-18 in these cells include the PI3 kinase, p38 MAP kinase, ERK1/2, and IKK/NF-{kappa}B cascades, and inhibitor studies showed that all of these pathways contribute to cytokine generation in neutrophils. Using recombinant IL-18BP and neutralizing antibodies against IL-18, we finally demonstrate that endogenous IL-18 enhances the production of cytokines in response to LPS, but not to several other physiological neutrophil stimuli.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Antibodies and reagents
Antibodies raised against the phosphorylated forms of p38 MAP kinase (#9211), ERK1/2 (#9101), AKT (#9275), IKK{alpha}/β (#2697), and RelA (#3031) were from Cell Signaling (Beverly, MA, USA); antibodies against p38 MAPK (sc-535) and I{kappa}B-{alpha} (sc-371) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA); anti-TNF-{alpha} antibodies used in FACS were obtained from BD Biosciences (Mississauga, ON, Canada); and anti-IL-18 antibodies used in Western blot analysis were obtained from R&D Systems (Minneapolis, MN, USA). Ficoll-Paque, T4 polynucleotide kinase and poly (dI-dC) were obtained from GE Healthcare Biosciences Inc. (Baie d’Urfé, QC, Canada); radionucleotides were obtained from NEN (Boston, MA, USA). Endotoxin-free (<2 pg/ml) RPMI 1640 and fetal calf serum (FCS) were from Sigma (St. Louis, MO, USA) and Wisent (St. Bruno, QC, Canada), respectively. Recombinant human cytokines (IL-18, IL-18BPa, TNF-{alpha}, GM-CSF) and neutralizing antibodies (anti-IL-18 and anti-TNF-{alpha}) were obtained from R&D Systems; UltraPure LPS (from E. coli 0111:B4) was obtained from InvivoGen (San Diego, CA, USA). Acetylated BSA, diisopropyl fluorophosphate (DFP), N-formyl-methionyl-phenylalanine (fMLP), and phenylmethanesulfonyl fluoride (PMSF) were from Sigma-Aldrich (St. Louis, MO, USA). Aprotinin, 4-(2-aminomethyl)benzenesulfonyl fluoride (AEBSF), leupeptin, and pepstatin A were obtained from Roche (Laval, Quebec, Canada). All other reagents were of the highest available grade, and all buffers and solutions were prepared using pyrogen-free clinical-grade water.

Cell isolation and culture
Neutrophils were isolated from the peripheral blood of healthy donors, following a protocol that was duly approved by an institutional ethics committee, as described previously (28) . Purified neutrophils were resuspended in RPMI 1640 containing 10% autologous serum, 100 U/ml penicillin and 100 µg/ml streptomycin, at a final concentration of 5 x 106 cells/ml (unless otherwise stated). As determined by Wright staining and nonspecific esterase cytochemistry, the final neutrophil suspensions consistently contained fewer than 0.5% mononuclear cells. Neutrophil viability exceeded 98% after up to 4 h in culture, as determined by Trypan blue exclusion.

Denaturing electrophoreses and immunoblots
Cells were resuspended in ice-cold PBS supplemented with protease inhibitors (10 µg/ml aprotinin, leupeptin, and pepstatin; 1 mM PMSF; 0.5 mM DFP) and phosphatase inhibitors (10 mM NaF, 1 mM Na3VO4, 10 mM Na4P2O7). A small aliquot was taken prior to centrifugation (300 g, 5 min, 4°C) for subsequent protein content determination, and an equal volume boiling sample buffer (2x) was added. Samples were briefly vortexed and immediately placed in boiling water for a further 3 min. Samples thus prepared were sonicated to disrupt chromatin, and stored at –20°C prior to analysis. All samples were electrophoresed on denaturing gels prepared according to the method of Laemmli (29) ; equal loading was ascertained by adjusting sample volumes based on their respective protein content. Following SDS-PAGE, proteins were transferred onto nitrocellulose membranes, which were stained with Ponceau Red, destained, and then processed for immunoblot analysis, as described previously (30) .

Electrophoretic mobility shift assays
Cells were resuspended in ice-cold relaxation buffer (10 mM PIPES, pH 7.30; 10 mM NaCl; 3.5 mM MgCl2; 0.5 mM EGTA; 0.5 mM EDTA; 1 mM DTT) supplemented the aforementioned protease and phosphatase inhibitors. Nuclear extracts were then prepared using a nitrogen bomb procedure, which we described previously (30 , 31) . The nuclear extracts were subsequently analyzed in electrophoretic mobility shift assays (EMSA) for NF-{kappa}B binding, as described earlier (30) .

Isolation of RNA and real-time PCR analyses
Neutrophils were incubated in the presence or absence of stimuli or inhibitors for the desired times, as indicated. Total RNA was extracted following a slightly modified Chomczynski and Sacchi procedure (32) , reverse transcribed using random decamers (Ambion, Austin, TX, USA) and SuperScript II (Invitrogen, Burlington, ON, Canada). The resulting cDNA was analyzed by semiquantitative real-time PCR assay following the procedure of Dussault and Pouliot (33) , in a Rotorgene 3000 instrument (Corbett Research, Sydney, Australia). Oligonucleotide primers were as follows: IL-8 (forward: AGGAAGCTCACTGGTGGCTG and reverse: TAGGCACAATCCAGGTGGC); IL-18 (forward: CAAGGAATTGTCTCCCAGTGC and reverse: CAGCCGCTTTAGCAGCCA); Mip-1{alpha} (forward: AGCTGACTACTTTGAGACGAGCA and reverse: CGGCTTCGCTTGGTTAGGA); Mip-1β (forward: CTGCTCTCCAGCGCTCTCA and reverse: GTAAGAAAAGCAGCAGGCGG); Mip-3{alpha} (forward: TCCTGGCTGCTTTGATGTCA and reverse: TCAAAGTTGCTTGCTGCTTCTG); Mip-3β (forward: GGCACCAATGATGCTGAAGA and reverse: GAAGTTCCTCACGATGTACCCAG); TNF-{alpha} (forward: TCTTCTCGAACCCCGAGTGA and reverse: CCTCTGATGGCACCACCAG); 18S (forward: AGGAATTGACGGAAGGGCAC and reverse: GGACATCTAAGGGCATCACA). Contaminating PBMC mRNA was undetectable in our neutrophil preparations, as no cDNA could be amplified in RT-PCR using IL-6 primers in samples from LPS-stimulated cells, in agreement with previous studies (10 , 34) .

ELISA analysis of secreted proteins
Neutrophils were cultured in 24-well plates at 37°C under a 5% CO2 atmosphere, in the presence or absence of stimuli and/or inhibitors, for the indicated times. Culture supernatants, as well as the corresponding cell pellets, were carefully collected, snap-frozen in liquid nitrogen, and stored at –70°C. Determination of IL-18 was achieved using a commercially available kit from MBL (Naka-ku, Nagoya, Japan). The concentrations of all other cytokines were determined in in-house sandwich ELISA assays, using commercially available capture and detection antibody pairs (R&D Systems, BD Biosciences). Detection limits using these assays varied between 3 and 10 pg/ml.

Data analysis
Statistical differences between groups were analyzed by one-way analysis of variance (ANOVA), followed by Bonferroni’s post hoc test, using GraphPad Prism software (GraphPad Software, San Diego, CA, USA).


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Expression and release of IL-18 and IL-18BP by human neutrophils
It has been reported that IL-18 gene expression is constitutive in human monocytes and that LPS can induce it further (35) . Constitutive IL-18 gene expression was also observed in neutrophils (26) , but whether IL-18 expression and release are affected following cell stimulation remains to be determined. As shown in Fig. 1A , IL-18 gene expression is strongly stimulated in neutrophils by LPS, TNF-{alpha}, and to a lesser extent by IFN-{gamma}, and IL-18 itself, whereas it is unaffected by other physiological agonists such as GM-CSF, fMLP, or IL-1{alpha}. Because the NF-{kappa}B transcription factor is of critical importance for the expression of many cytokine genes in human neutrophils (36) , we next verified whether it is also required for IL-18 expression in these cells, as reported in other cell types (37 , 38) . For this purpose, neutrophils were pretreated with MG-132, which impedes the 26S proteasome-dependent degradation of I{kappa}B-{alpha}, or with BAY 11–7082, which prevents I{kappa}B-{alpha} phosphorylation (39 , 40) . As shown in Fig. 1B , both inhibitors potently hindered the IL-18 mRNA accumulation occurring in response to LPS or TNF-{alpha}. These results show that the induction of the IL-18 gene is under the control of NF-{kappa}B in human neutrophils.


Figure 1
View larger version (11K):
[in this window]
[in a new window]

  		Figure 1. Expression of the IL-18 gene in human neutrophils. A) Cells (40x106/condition) were cultured for 30 min in the absence (ctrl) or presence of 100 ng/ml LPS, 100 U/ml TNF-{alpha}, 30 nM fMLP, 1 nM GM-CSF, 100 ng/ml IL-18, 10 ng/ml IL-1{alpha}/β, or 100 U/ml IFN-{gamma}. Total RNA was then isolated, reverse transcribed, and analyzed for IL-18 specific products by real-time PCR. Values were normalized over 18S ribosomal RNA and are represented as fold increase relative to unstimulated cells. Mean ± SE from 4 independent experiments, each performed in duplicate. B) Cells were pretreated for 30 min in the absence (–) or presence of either 10 µM Bay 11–7082 or 15 µM MG-132, prior to stimulation in the absence (ctrl) or presence of 100 ng/ml LPS or 100 U/ml TNF-{alpha} for another 30 min. Total RNA was then isolated and analyzed as described above. Results are means ± SE from 3 independent experiments.

Having shown that several neutrophil stimuli can induce IL-18 gene expression, we next determined whether this culminates in the release of the cytokine. In keeping with previous studies (26 , 27) , neutrophils were found to constitutively release IL-18. Between 250 and 300 pg IL-18/106 cells were usually detected in the culture medium by 2 h; this amount remained quite stable over 24 h (Fig. 2A ). This constitutive IL-18 release by 106 neutrophils far exceeds that which can be measured in plasma (124.6±16.6 pg/ml, mean ± SE, n=5), which strongly suggests that it is attributable to the neutrophils themselves. Further support for this conclusion is that constitutive IL-18 secretion is markedly diminished when neutrophils are isolated in the presence of cycloheximide (Supplemental Fig. 1A). We also determined that IL-18 localizes to a 100,000 g cytosolic fraction in human neutrophils, whereas it was undetected in plasma membrane and nuclear or granule fractions (Supplemental Fig. 2). Following LPS stimulation, neutrophils consistently released greater amounts of IL-18; this response was transient, peaking at ~6 h, and returned to constitutive levels by 12 h (Fig. 2A ). The induction of IL-18 release by LPS was also profoundly inhibited in neutrophils pretreated with cycloheximide (Supplemental Fig. 1B), unveiling the requirement for de novo protein synthesis of this response. In sharp contrast to LPS, numerous other neutrophil agonists failed to significantly induce the release of IL-18, even though all stimuli used behaved as expected in terms of IL-8 generation (Supplemental Fig. 3). Whether IL-18 induced its own release could not be measured. Because of the dramatic difference observed in the respective ability of LPS and TNF to promote the release of IL-18 while both stimuli proved potent inducers of its gene expression, and considering that human neutrophils can accumulate and store cytokines intracellularly following stimulation, we next measured the total amount of IL-18 protein made in response to TNF or LPS. As shown in Fig. 2B , resting neutrophils do contain intracellular IL-18 protein. However, neither TNF nor LPS caused an accumulation of intracellular IL-18 (Fig. 2B , light bars); the increased total IL-18 observed in response to LPS rather reflected newly synthesized protein being released in the culture medium (Fig. 2B , dark bars). In the same experiments, we also tested the influence of IFN-{gamma} on IL-18 synthesis and release, as IFN-{gamma} is known to augment the release of several proteic mediators (such as TNF-{alpha}, IL-1β, IL-8, Gro{alpha}, and IL-1ra) from activated neutrophils (41 42 43) . However, IFN-{gamma} failed to promote IL-18 synthesis or release, whether by itself or in conjugation with LPS (Fig. 2B ). On the contrary, IFN-{gamma} abrogated the induction by LPS of IL-18 synthesis and secretion (Fig. 2B ).


Figure 2
View larger version (11K):
[in this window]
[in a new window]

  		Figure 2. Generation of IL-18 and IL-18BP by human neutrophils. A) Cells were cultured for the indicated times without any stimulus (open squares), or with 100 ng/ml LPS (solid triangles). Culture supernatants were collected and their cytokine content was analyzed by ELISA. This experiment is representative of 3. B) Cells were cultured for 6 h without any stimulus (ctrl), or stimulated with 100 ng/ml LPS, 100 U/ml TNF-{alpha}, 100 U/ml IFN{gamma}, or costimulated with IFN{gamma} and LPS. Culture supernatants, as well as the corresponding cell pellets, were then processed for ELISA analysis of their IL-18 content. C) Cells were cultured for 6 h without any stimulus (ctrl) or stimulated with 100 ng/ml LPS, 100 U/ml TNF-{alpha}, 30 nM fMLP, 1 nM GM-CSF, 100 U/ml IFN-{gamma}, or 10 ng/ml IL-1{alpha}. Culture supernatants were collected, and their IL-18BPa content was analyzed by ELISA. Results are means ± SE from 4 independent experiments; **P < 0.01.

As a member of the IL-1 family of cytokines, IL-18 shares several similarities with IL-1, including the existence of a naturally occurring inhibitor. In contrast to IL-1ra, whose induction is well characterized in neutrophils, there is no evidence to date as to whether these cells can release IL-18BP. When we investigated the matter, we observed that neutrophils constitutively release ~130 pg IL-18BP/106 cells after 2 h of culture and that this amount remains unchanged for up to 24 h (Fig. 2C and data not shown). Although several neutrophil agonists had a slight tendency to further induce the release of IL-18BP, their effect did not reach statistical significance in 4 independent experiments, or when neutrophils were stimulated for up to 24 h (Fig. 2C and data not shown). Together, these results show that human neutrophils are able to produce and release both IL-18 and IL-18BP, even in their resting state.

Autocrine effect of endogenous IL-18 on cytokine generation in activated neutrophils
The above results raised the possibility that IL-18 generated by neutrophils might affect cellular responses in an autocrine manner. To address this possibility, neutrophils were stimulated for 6 h in the presence or absence of recombinant human IL-18BP, or of a neutralizing anti-IL-18 antibody, and cytokine production was measured. Concentrations of IL-18BP and of the neutralizing antibodies yielding maximal inhibitions were determined in preliminary experiments (Supplemental Fig. 4), and the 6-h time point was chosen because the release of both endogenous TNF-{alpha} and IL-18 is readily detectable by then. In LPS-stimulated neutrophils, neutralization of endogenous IL-18 by either IL-18BP or anti-IL-18 significantly reduced the release of IL-8, Mip-1{alpha}, and (to a lesser extent) Mip-1β (Fig. 3A ). For comparison, neutrophils were also incubated in the presence or absence of a neutralizing anti-TNF antibody, since endogenous TNF-{alpha} is known to amplify cytokine generation in an autocrine manner in activated neutrophils (41 , 44) . As shown in Fig. 3A , cytokine generation was inhibited by this treatment and to a greater extent than when neutralizing endogenous IL-18. By contrast, neutralization of endogenous IL-18 had no significant effect on the release of the same chemokines in neutrophils stimulated with TNF-{alpha}, GM-CSF, or fMLP (Fig. 3A and data not shown), consistent with our observation that the latter three stimuli do not promote IL-18 secretion in neutrophils (Fig. 2A ). These results prompted us to better characterize the impact of endogenous IL-18 and TNF-{alpha} in LPS-stimulated neutrophils. As shown in Fig. 3B , neutralization of each cytokine followed a similar pattern over time. Again, the effect of endogenous IL-18 unmasked under these conditions was somewhat weaker than that of endogenous TNF-{alpha}. Interestingly, the effect of endogenous TNF-{alpha} and IL-18 was more pronounced at later time points; this was particularly evident in the case of Mip-1β secretion (Fig. 3B ).


Figure 3
View larger version (18K):
[in this window]
[in a new window]

  		Figure 3. Autocrine amplification of chemokine production by endogenous IL-18 in LPS-stimulated human neutrophils. A) Cells were cultured for 6 h without any stimulus (ctrl), or with either 100 ng/ml LPS or 100 U/ml TNF-{alpha}, in the presence or absence of 1 µg/ml neutralizing anti-IL-18 antibodies, 1 µg/ml rh IL-18BPa, or 1 µg/ml neutralizing anti-TNF-{alpha} antibodies (open squares). Culture supernatants were collected, and their chemokine content was analyzed by ELISA. Results are means ± SE from 6 independent experiments. *P < 0.05; **P < 0.01. An isotype control antibody did not affect chemokine release (not shown). B) Cells were cultured for the indicated times without any stimulus (open circles) or with 100 ng/ml LPS in the presence of 1 µg/ml neutralizing anti-IL-18 antibodies (open triangles), 1 µg/ml neutralizing anti-TNF-{alpha} antibodies (open squares), or an isotype-matched antibody (closed squares). Culture supernatants were collected, and their chemokine content was analyzed by ELISA. Results are means ± SE of duplicate measurements; experiment shown is representative of 3.

Induction by IL-18 of inflammatory cytokine generation in human neutrophils
The above results collectively established the importance of endogenously generated IL-18 on a key functional response of neutrophils, i.e., cytokine generation. This prompted us to extend our knowledge of how IL-18 exerts its stimulatory action on this response. To this end, we first revisited the issue of how IL-18 affects inflammatory cytokine expression and release in neutrophils. As shown in Fig. 4A , IL-18 robustly induced the genes encoding TNF-{alpha}, Mip-1{alpha}/β, and Mip-3{alpha}, whereas a more modest induction was observed for IL-8 and Mip-3β mRNA. These levels of induction are similar to those obtained when human neutrophils are stimulated with LPS or TNF-{alpha} (15 , 36) . Similarly, exogenous IL-18 synergized with IFN-{gamma} to induce IP-10 mRNA (Fig. 4B ), an effect that is again reminiscent of how this chemokine is induced by LPS or TNF in concert with IFN-{gamma} (16) . We next investigated whether IL-18 exerted similar effects on the secretion of the corresponding proteins. Surprisingly, we found that IL-18-stimulated neutrophils only released significant amounts of IL-8, Mip-1{alpha}, Mip-1β, and Mip-3{alpha}, and to a much lower extent than LPS or TNF-stimulated cells (Fig. 4C ). Similarly, costimulation of neutrophils with IL-18 and IFN-{gamma} promoted the release of IP-10 (Fig. 4B ). By contrast, no secreted TNF-{alpha} or Mip-3β were detectable in culture supernatants from neutrophils stimulated with IL-18 for up to 18 h (data not shown). Similarly, no surface-bound TNF-{alpha} was detectable in neutrophils (Supplemental Fig. 5C). Nevertheless, cell-associated TNF-{alpha} did accumulate following IL-18 stimulation (Supplemental Fig. 5A and data not shown). This raised the possibility, that some of the newly synthesized TNF-{alpha} might be released in amounts that are below our detection threshold. To settle the issue, we investigated whether neutralizing anti-TNF Abs affects the ability of IL-18 to induce chemokine release. As shown in Supplemental Fig. 5B, the induction of IL-8, Mip-1{alpha}, and Mip-1β release by IL-18 was partially prevented by the neutralizing Abs. Thus, some of the TNF-{alpha} that is synthesized de novo in response to IL-18 feeds back on neutrophils to augment ongoing chemokine secretion. In summary, we show that while IL-18 is a potent activator of cytokine gene expression, it is a more moderate (and selective) inducer of their secretion. Our data also substantially extend the range of known inflammatory mediators released by neutrophils in response to IL-18.


Figure 4
View larger version (14K):
[in this window]
[in a new window]

  		Figure 4. Induction of inflammatory cytokine expression and release by IL-18 in human neutrophils. A) Cells (40x106/condition) were cultured for 30 min in the absence (ctrl) or presence of 100 ng/ml IL-18. Total RNA was then isolated, reverse transcribed, and analyzed for specific products by real-time PCR. Values were normalized over 18S ribosomal RNA and are represented as fold increase relative to unstimulated cells. B) Cells (40x106/condition) (light bars) were cultured for 30 min in the absence (ctrl) or presence of 100 ng/ml IL-18, 100 U/ml IFN{gamma}, or both. Total RNA was then isolated, reverse transcribed, and analyzed for IP-10 mRNA by real-time PCR. Values were normalized over 18S ribosomal RNA and are represented as fold increase relative to unstimulated cells. Release of IP-10 into culture supernatants after 24 h (dark bars) was analyzed by ELISA. C) Cells were cultured for the indicated times in the absence (open squares) or presence of 100 ng/ml IL-18 (open triangles) or 100 ng/ml LPS (closed triangles). Culture supernatants were collected, and their chemokine content was analyzed by ELISA. Experiment shown is representative of 3. Results are means ± SE from 3 independent experiments, each performed in duplicate.

Signaling pathways mobilized by IL-18 in human neutrophils and their impact on cytokine generation
Toward a better understanding of how IL-18 exerts its stimulatory (and autocrine) effects on cytokine generation, we next turned our attention to the signaling pathways activated by IL-18 in neutrophils. For this purpose, cells were stimulated for varying times with 100 ng/ml IL-18 or (as a positive control) with TNF-{alpha} or LPS. We found that both IL-18 and TNF-{alpha} induced a rapid and sustained phosphorylation of the p38 MAPK, ERK2, and Akt kinases (Fig. 5A ). These results are in keeping with the previously described effect of IL-18 on the p38 MAPK pathway in neutrophils (22) and with the known effect of TNF on these cascades (36 , 45) . Because NF-{kappa}B is crucially involved in inflammatory cytokine generation in neutrophils (36) , we also examined whether IL-18 could activate the IKK/NF-{kappa}B cascade in these cells. We found that IL-18 induces the phosphorylation of IKK{alpha}/β and RelA, as well as the degradation of I{kappa}B-{alpha} in these cells, albeit less potently than TNF-{alpha} or LPS (Fig. 5A and data not shown). These effects of IL-18 were paralleled by the activation of nuclear NF-{kappa}B, as determined in EMSA experiments (Fig. 5B ). By contrast, IL-18 failed to activate the DNA binding of other transcription factor families, namely the AP-1, PU.1, C/EBP, and STAT families (data not shown). In the latter instance, the tyrosine phosphorylation of individual STAT proteins and of the upstream kinase, JAK2, was undetectable in neutrophils stimulated with up to 100 ng/ml IL-18 for up to 60 min (data not shown). Thus, IL-18 selectively activates multiple signaling pathways in human neutrophils.


Figure 5
View larger version (28K):
[in this window]
[in a new window]

  		Figure 5. Signaling pathways mobilized by IL-18 in human neutrophils. A) Cells (8x105/condition) were incubated with 100 ng/ml IL-18 or 100 U/ml TNF-{alpha} for the indicated times, prior to lysis and subsequent immunoblot analysis using primary antibodies raised against phospho-p38 MAPK, phospho-ERK1/2, phospho-Akt (Ser 473), phospho-IKK{alpha}/β, I{kappa}B-{alpha}, phospho-RelA (Ser 536), and (as a loading control) p38 MAPK. Experiment shown is representative of 3. B) Cells (40x106/condition) were stimulated for the indicated times with 100 ng/ml IL-18. Nuclear extracts were then prepared and analyzed in EMSA using a NF-{kappa}B oligonucleotide probe. Experiment shown is representative of 6.

The above results suggest that the p38 MAPK, ERK, PI3K/Akt, and IKK/NF-{kappa}B pathways underlie the actions of IL-18 toward neutrophil functional responses. Accordingly, we investigated whether inhibition of these signaling cascades would affect inflammatory cytokine generation in these cells. As shown in Fig. 6 , neutrophil pretreatment with pharmacological inhibitors of these various pathways significantly impaired the IL-18-elicited release of IL-8, Mip-1{alpha}, and Mip-1β. By contrast, the JNK inhibitor, SP600125, failed to significantly alter IL-18-induced chemokine generation, consistent with the fact that IL-18 does not promote the phosphorylation of JNK in neutrophils (data not shown). These results establish that the signaling pathways mobilized by IL-18 in neutrophils participate in the subsequent generation of inflammatory cytokines.


Figure 6
View larger version (13K):
[in this window]
[in a new window]

  		Figure 6. Impact of individual signaling pathways elicited by IL-18 on cytokine generation by human neutrophils. Cells were pretreated for 30 min in the absence (light bars) or presence (darker bars) of various inhibitors, as follows: 5 µM SP 600125, a JNK inhibitor (SP); 3 µM SB 203580, a p38 MAPK inhibitor (SB); 20 µM PD 98059, a MEK/ERK inhibitor (PD); 20 µM LY 294002, a PI 3-kinase inhibitor (LY); 15 µM MG-132, a proteasome inhibitor that blocks the degradation of I{kappa}B-{alpha} (MG); 10 µM Bay 11–7082, an inhibitor of IKKβ phosphorylation (BAY). Cells were then cultured for 6 h in the absence (ctrl) or presence of 100 ng/ml IL-18. Culture supernatants were collected and their chemokine content was analyzed by ELISA. Results are means ± SE from 3 independent experiments; *P < 0.05; ***P < 0.001.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Neutrophils exert a profound influence on innate and adaptive immune processes through their ability to release various chemokines and cytokines. In the present work, we show that human neutrophils can be elicited to express and secrete IL-18, a cytokine that affects both innate and acquired immunity, and that IL-18 can feed back on inflammatory cytokine generation in neutrophils in an autocrine amplification mechanism. We also substantially extend our understanding of the signal transduction pathways employed by IL-18 in neutrophils and document their individual involvement in the induction of cytokine production by IL-18 in these cells.

Neutrophils were found to constitutively express the IL-18 gene, in accordance with a recent study (26) and with observations made in other cell types, including PBMC (35 , 46) and astrocytes (47) . Whether neutrophils could be further induced to express the IL-18 gene, however, had remained an open question. Among several neutrophil agonists, we show that LPS, TNF-{alpha}, and (to a lower extent) IFN-{gamma} and IL-18 itself can all induce IL-18 gene expression in neutrophils, whereas fMLP, GM-CSF, or IL-1 have little or no effect on this response. Moreover, we show that inducible IL-18 expression in human neutrophils is under the control of NF-{kappa}B. This is at first glance surprising, insofar as the IL-18 gene has two promoters (both TATA-less) that have not been shown to possess a {kappa}B binding site. There is however a growing body of evidence, that inhibition of NF-{kappa}B abrogates IL-18 gene expression in several cellular models (37 , 38 , 48 49 50) , as observed herein.

In keeping with their constitutive expression of the IL-18 gene, human neutrophils from normal volunteers were found to constitutively secrete IL-18. This is consistent with a recent report that showed that neutrophils from patients with oral cavity cancer also release the cytokine constitutively (27) . We additionally show that neutrophils contain a sizeable amount of cell-associated IL-18. Among a wide range of neutrophil agonists, however, only LPS induced IL-18 synthesis and secretion beyond constitutive levels. The failure of TNF-{alpha}, in particular, to stimulate IL-18 synthesis and secretion despite potently inducing its gene expression, points to differences in the signaling events mobilized by TNF-{alpha} and LPS. In this respect, the ability of TNF to induce IL-18 release in some cell types (50 , 51) raises the possibility that there might be a potential defect in how TNF signals in neutrophils. However, because TNF efficiently induces the release of numerous inflammatory cytokines in neutrophils, its failure to induce IL-18 production might alternatively reflect the existence of particular translational checkpoints controlling IL-18 synthesis. Consistent with this explanation is that IFN-{gamma} was shown to up-regulate IL-18 mRNA without any increase in IL-18 protein in other systems (52) , as shown herein for both IFN-{gamma} and TNF-{alpha} in neutrophils. Additional evidence is our observation that TNF also fails to induce IL-18 release in PBMC, whereas LPS proves a good stimulus in these cells (Supplemental Fig. 6). Studies are in progress to identify how LPS signaling differs from that of TNF and IFN-{gamma} with respect to translation in neutrophils and monocytes, and whether this might explain the particular induction characteristics observed for IL-18 synthesis in these cells.

We also show for the first time that neutrophils constitutively secrete IL-18BP. Compared to IL-18, however, IL-18BP secretion was not significantly modulated by neutrophil stimulation under a number of experimental conditions. Even IFN-{gamma}, which is a potent inductor in other systems (6 , 7) , failed to stimulate IL-18BP secretion beyond basal levels. The fact that cultured neutrophils always release both IL-18 and its natural inhibitor, raises the issue of whether enough IL-18 is generated to exert a biological activity. In this regard, it has been shown that a molar excess of 2:1 is required for IL-18BPa (i.e., the most active isoform, and the one measured herein) to completely neutralize IL-18, whereas an equimolar amount of IL-18BPa only inhibits the activity of IL-18 by ~50% (53) . In unstimulated neutrophils, we observed that ~150 pg IL-18BPa ({approx}4 nmol) is released per 106 cells, whereas ~250 pg IL-18 is concurrently released ({approx}14 nmol). Thus, the net effect of IL-18BP and IL-18 secretion should favor IL-18 in resting cells; this shift is even more pronounced in LPS-stimulated neutrophils, which secrete ~420 pg IL-18 per 106 cells ({approx}23 nmol).

The fact that secreted IL-18 prevails (at least theoretically) over IL-18BP in neutrophils raised the possibility that IL-18 might amplify ongoing cytokine production in an autocrine manner, as previously observed for endogenous TNF-{alpha} and IL-1β in these cells (41 , 44) . Our results showed that endogenous IL-18 does indeed feed back on the production of at least three chemokines (IL-8, Mip-1{alpha}, Mip1β) in response to neutrophil stimulation with LPS, but not with TNF. This is consistent with the fact that IL-18 is only detected in response to LPS, and that IL-18 has the ability to induce cytokine generation in neutrophils, as shown herein and in previous reports (23 , 24) . The kinetics of the autocrine effect were also consistent with those of IL-18 secretion in LPS-treated cells. These results underscore the intricate relationship between LPS and IL-18 secretion in neutrophils, and it will be interesting to investigate in future studies whether the induction of cytokine secretion by other TLR ligands similarly involves the participation of endogenous IL-18. This said, the autocrine effect of IL-18 described herein was usually less pronounced than the one exerted by endogenous TNF-{alpha}. In this regard, we showed that TNF-{alpha} does not trigger the release of IL-18 in neutrophils, and accordingly, that anti-IL-18 antibodies failed to affect TNF-elicited cytokine generation. Thus, the autocrine effect of TNF-{alpha} does not depend on endogenous IL-18. Conversely, we found that endogenous TNF-{alpha} partially contributes to cytokine generation in IL-18-stimulated neutrophils. This raises the possibility that a portion of the autocrine effect of IL-18 may represent the effect of endogenous TNF-{alpha}. This would help explain our observation that the effect of neutralizing anti-TNF and anti-IL-18 Abs is not completely additive in LPS-treated neutrophils (our unpublished data).

Our demonstration of the autocrine effect of endogenous IL-18 toward chemokine generation raised an interesting question. Indeed, while it was already known that neutrophils could secrete IL-8 in response to IL-18 stimulation (23) , our data suggested that IL-18 must also be able to elicit the generation of Mip-1{alpha} and Mip-β, and perhaps other cytokines. Direct investigation of this issue allowed us to show for the first time that CCL3/Mip-1{alpha}, CCL4/Mip-1β, and CCL20/Mip-3{alpha} are expressed and released following IL-18 stimulation of human neutrophils; we also confirmed that IL-8 is secreted under these conditions. Thus, the range of inflammatory chemokines released in response to IL-18 is much more diverse than previously appreciated. Given the known involvement of these chemokines in recruiting key effector cells to sites of inflammation (chiefly neutrophils, monocytes, and dendritic cells), the ability of IL-18 to elicit their generation from early infiltrating cells (i.e., neutrophils) further underscores its pivotal importance in the subsequent development of the host responses to injury and infection. Finally, the diverse actions of IL-18 as an inducer of inflammatory cytokine generation in neutrophils led us to investigate the signaling pathways upstream of this functional response. In this regard, we confirmed the results of a previous study, which had established that IL-18 can activate the p38 MAPK pathway in neutrophils (22) , and we additionally established that IL-18 can also activate the MEK/ERK, PI 3-kinase/Akt, and IKK/NF-{kappa}B signaling cascades in these cells. More importantly, we demonstrated the involvement of each of these pathways in inducible cytokine generation in response to IL-18. These results are reminiscent of those which we recently reported in the case of other potent inducers of cytokine generation in neutrophils, namely LPS and TNF-{alpha} (36) and significantly advance our understanding of IL-18/neutrophil interactions.

In summary, our data show that IL-18 is constitutively and inducibly secreted by human neutrophils and that it prevails over its natural inhibitor, IL-18BP, as illustrated by the ability of endogenous IL-18 to augment ongoing cytokine production in these cells. Interestingly, a considerable amount of IL-18 is synthesized in human neutrophils, but only a small amount is released on stimulation. This raises the question of whether there exist conditions in which these cells can fully secrete stored IL-18, as this could potentially have profound implications, given the role of IL-18 as a driving force in mounting a cellular immune response. In a broader perspective, our finding that LPS promotes IL-18 release in neutrophils is mirrored by the observation that IL-18 has been detected at infection sites in animal inflammatory models (54 55 56) , which typically feature high amounts of TLR ligands and large neutrophil numbers. In this context, our data suggest that neutrophils can potentially contribute IL-18 to this environment, in keeping with their known ability to generate several cytokines in vivo. Similarly, neutrophil infiltration has often been associated with the presence of IL-18 in a number of inflammatory settings, including arthritis (57 , 58) and pulmonary conditions (59 , 60) . In view of the results presented herein, IL-18/neutrophil interactions are likely to participate in the onset and evolution of many inflammatory and immune processes and may even represent a potential target for future therapeutic intervention.


   ACKNOWLEDGMENTS
 
C.F.F. performed the experiments, analyzed the results, drew the figures, and wrote the first draft of the article. T.E. performed the experiments; P.P.M. designed the research and wrote the final version of the article. This work was supported by grants to P.P.M. from the Canadian Arthritis Society, and from the Canadian Foundation for Innovation. C.F.F. is the recipient of a studentship from the Canadian Institutes of Health Research.

Received for publication March 25, 2008. Accepted for publication August 14, 2008.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Stoll, S., Jonuleit, H., Schmitt, E., Muller, G., Yamauchi, H., Kurimoto, M., Knop, J., Enk, A. H. (1998) Production of functional IL-18 by different subtypes of murine and human dendritic cells (DC): DC-derived IL-18 enhances IL-12-dependent Th1 development. Eur. J. Immunol. 28,3231-3239[CrossRef][Medline]
  2. Meylan, E., Tschopp, J., Karin, M. (2006) Intracellular pattern recognition receptors in the host response. Nature 442,39-44[CrossRef][Medline]
  3. Nakanishi, K., Yoshimoto, T., Tsutsui, H., Okamura, H. (2001) Interleukin-18 regulates both Th1 and Th2 responses. Annu. Rev. Immunol. 19,423-474[CrossRef][Medline]
  4. Nakanishi, K., Yoshimoto, T., Tsutsui, H., Okamura, H. (2001) Interleukin-18 is a unique cytokine that stimulates both Th1 and Th2 responses depending on its cytokine milieu. Cytokine Growth Factor Rev. 12,53-72[CrossRef][Medline]
  5. Novick, D., Kim, S. H., Fantuzzi, G., Reznikov, L. L., Dinarello, C. A., Rubinstein, M. (1999) Interleukin-18 binding protein: A novel modulator of the Th1 cytokine response. Immunity 10,127-136[CrossRef][Medline]
  6. Paulukat, J., Bosmann, M., Nold, M., Garkisch, S., Kampfer, H., Frank, S., Raedle, J., Zeuzem, S., Pfeilschifter, J., Muhl, H. (2001) Expression and release of IL-18 binding protein in response to IFN-gamma. J. Immunol. 167,7038-7043[Abstract/Free Full Text]
  7. Veenstra, K. G., Jonak, Z. L., Trulli, S., Gollob, J. A. (2002) IL-12 induces monocyte IL-18 binding protein expression via IFN-gamma. J. Immunol. 168,2282-2287[Abstract/Free Full Text]
  8. Nathan, C. (2006) Neutrophils and immunity: Challenges and opportunities. Nat. Rev. Immunol. 6,173-182[CrossRef][Medline]
  9. Bazzoni, F., Cassatella, M. A., Rossi, F., Ceska, M., Dewald, B., Baggiolini, M. (1991) Phagocytosing neutrophils produce and release high amounts of the neutrophil-activating peptide 1/interleukin 8. J. Exp. Med. 173,771-774[Abstract/Free Full Text]
  10. Bazzoni, F., Cassatella, M. A., Laudanna, C., Rossi, F. (1991) Phagocytosis of opsonized yeast induces tumor necrosis factor-{alpha} mRNA accumulation and protein release by human polymorphonuclear leukocytes. J. Leukoc. Biol. 50,223-228[Abstract]
  11. Tiku, K., Tiku, M. L., Skosey, J. L. (1986) Interleukin 1 production by human polymorphonuclear neutrophils. J. Immunol. 136,3677-3685[Abstract]
  12. Lord, P. C., Wilmoth, L. M., Mizel, S. B., McCall, C. E. (1991) Expression of interleukin-1{alpha} and β genes by human blood polymorphonuclear leukocytes. J. Clin. Invest. 87,1312-1321[Medline]
  13. Ethuin, F., Gérard, B., Benna, J. E., Boutten, A., Gougereot-Pocidalo, M. A., Jacob, L., Chollet-Martin, S. (2004) Human neutrophils produce interferon-{gamma} upon stimulation by interleukin-12. Lab. Invest. 84,1363-1371[CrossRef][Medline]
  14. Tecchio, C., Huber, V., Scapini, P., Calzetti, F., Margotto, D., Todeschini, G., Pilla, L., Martinelli, G., Pizzolo, G., Rivoltini, L., Cassatella, M. A. (2004) IFN-{alpha}-stimulated neutrophils and monocytes release a soluble form of TNF-related apoptosis-inducing ligand (TRAIL/Apo-2 ligand) displaying apoptotic activity on leukemic cells. Blood 103,3837-3844[Abstract/Free Full Text]
  15. Scapini, P., Laudanna, C., Pinardi, C., Allavena, P., Mantovani, A., Sozzani, S., Cassatella, M. A. (2001) Neutrophils produce biologically active macrophage inflammatory protein-3{alpha} (MIP-3{alpha})/CCL20 and MIP-3β/CCL19. Eur. J. Immunol. 31,1981-1988[CrossRef][Medline]
  16. Cassatella, M. A., Gasperini, S., Calzetti, F., Bertagnin, A., Luster, A. D., McDonald, P. P. (1997) Regulated production of the interferon-{gamma}-inducible protein-10 (IP-10) chemokine by human neutrophils. Eur. J. Immunol. 27,111-115[Medline]
  17. Kasama, T., Strieter, R. M., Lukacs, N. W., Burdick, M. D., Kunkel, S. L. (1994) Regulation of neutrophil-derived chemokine expression by IL-10. J. Immunol. 152,3559-3569[Abstract]
  18. Cassatella, M. A., Meda, L., Gasperini, S., D'Andrea, A., Ma, X., Trinchieri, G. (1995) Interleukin-12 production by human polymorphonuclear leukocytes. Eur. J. Immunol. 25,1-5[Medline]
  19. Cassatella, M. A. (1999) Neutrophil-derived proteins: Selling cytokines by the pound. Adv. Immunol. 73,369-509[Medline]
  20. Scapini, P., Nardelli, B., Nadali, G., Calzetti, F., Pizzolo, G., Montecucco, C., Cassatella, M. A. (2003) G-CSF-stimulated neutrophils are a prominent source of functional BLyS. J. Exp. Med. 197,297-302[Abstract/Free Full Text]
  21. Elbim, C., Guichard, C., Dang, P. M., Fay, M., Pedruzzi, E., Demur, H., Pouzet, C., El Benna, J., Gougerot-Pocidalo, M. A. (2005) Interleukin-18 primes the oxidative burst of neutrophils in response to formyl peptides: Role of cytochrome b558 translocation and N-formyl peptide receptor endocytosis. Clin. Diagn. Lab. Immunol. 12,436-446[CrossRef][Medline]
  22. Wyman, T. H., Dinarello, C. A., Banerjee, A., Gamboni-Robertson, F., Hiester, A. A., England, K. M., Kelher, M., Silliman, C. C. (2002) Physiological levels of interleukin-18 stimulate multiple neutrophil functions through p38 MAP kinase activation. J. Leukoc. Biol. 72,401-409[Abstract/Free Full Text]
  23. Leung, B. P., Culshaw, S., Gracie, J. A., Hunter, D., Canetti, C. A., Campbell, C., Cunha, F., Liew, F. Y., McInnes, I. B. (2001) A role for IL-18 in neutrophil activation. J. Immunol. 167,2879-2886[Abstract/Free Full Text]
  24. Jablonska, E., Izycka, A., Jablonska, J., Wawrusiewicz, N., Piecuch, J. (2001) Role of IL-18 in the secretion of Il-1β, sIL-1RII, and IL-1Ra by human neutrophils. Immunol. Invest. 30,221-229[CrossRef][Medline]
  25. Jablonska, E., Jablonski, J. (2002) Effect of IL-18 on the release of IL-6 and its soluble receptors: sIL-6R{alpha} and sgp130 by human neutrophils. Immunol. Invest. 31,159-167[CrossRef][Medline]
  26. Robertson, S. E., Young, J. D., Kitson, S., Pitt, A., Evans, J., Roes, J., Karaoglu, D., Santora, L., Ghayur, T., Liew, F. Y., Gracie, J. A., McInnes, I. B. (2006) Expression and alternative processing of IL-18 in human neutrophils. Eur. J. Immunol. 36,722-731[CrossRef][Medline]
  27. Jablonska, E., Puzewska, W., Grabowska, Z., Jablonski, J., Talarek, L. (2005) VEGF, IL-18 and NO production by neutrophils and their serum levels in patients with oral cavity cancer. Cytokine 30,93-99[CrossRef][Medline]
  28. Ear, T., Cloutier, A., McDonald, P. P. (2005) Constitutive nuclear expression of the I{kappa}B kinase complex and its activation in human neutrophils. J. Immunol. 175,1834-1842[Abstract/Free Full Text]
  29. Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227,680-685[CrossRef][Medline]
  30. McDonald, P. P., Bald, A., Cassatella, M. A. (1997) Activation of the NF-{kappa}B pathway by inflammatory stimuli in human neutrophils. Blood 89,3421-3433[Abstract/Free Full Text]
  31. McDonald, P. P., Bovolenta, C., Cassatella, M. A. (1998) Activation of distinct transcription factors in neutrophils by bacterial LPS, interferon-{gamma}, and GM-CSF and the necessity to overcome the action of endogenous proteases. Biochemistry 37,13165-13173[CrossRef][Medline]
  32. Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156-159[Medline]
  33. Dussault, A. A., Pouliot, M. (2006) Rapid and simple comparison of messenger RNA levels using real-time PCR. Biol. Proced. Online 8,1-10[CrossRef][Medline]
  34. Wang, P., Wu, P., Anthes, J. C., Siegel, M. I., Egan, R. W., Billah, M. M. (1994) Interleukin-10 inhibits interleukin-8 production in human neutrophils. Blood 83,2678-2683[Abstract/Free Full Text]
  35. Klein, S. A., Ottmann, O. G., Ballas, K., Dobmeyer, T. S., Pape, M., Weidmann, E., Hoelzer, D., Kalina, U. (1999) Quantification of human interleukin 18 mRNA expression by competitive reverse transcriptase polymerase chain reaction. Cytokine 11,451-458[CrossRef][Medline]
  36. Cloutier, A., Ear, T., Blais-Charron, E., Dubois, C. M., McDonald, P. P. (2007) Differential involvement of NF-{kappa}B and MAP kinase pathways in the generation of inflammatory cytokines by human neutrophils. J. Leukoc. Biol. 81,567-577[Abstract/Free Full Text]
  37. Chandrasekar, B., Marelli-Berg, F. M., Tone, M., Bysani, S., Prabhu, S. D., Murray, D. R. (2004) Beta-adrenergic stimulation induces interleukin-18 expression via β2-AR, PI3K, Akt, IKK, and NF-{kappa}B. Biochem. Biophys. Res. Commun. 319,304-311[CrossRef][Medline]
  38. Lee, K. S., Kim, S. R., Park, S. J., Min, K. H., Lee, K. Y., Jin, S. M., Yoo, W. H., Lee, Y. C. (2006) Antioxidant down-regulates interleukin-18 expression in asthma. Mol. Pharmacol. 70,1184-1193[Abstract/Free Full Text]
  39. Palombella, V. J., Rando, O. J., Goldberg, A. L., Maniatis, T. (1994) The ubiquitin-proteasome pathway is required for processing the NF-{kappa}B1 precursor protein and the activation of NF-{kappa}B. Cell 78,773-785[CrossRef][Medline]
  40. Pierce, J. W., Schoenleber, R., Jesmok, G., Best, J., Moore, S. A., Collins, T., Gerritsen, M. E. (1997) Novel inhibitors of cytokine-induced I{kappa}B-{alpha} phosphorylation and endothelial cell adhesion molecule expression show anti-inflammatory effects in vivo. J. Biol. Chem. 272,21096-21103[Abstract/Free Full Text]
  41. Meda, L., Gasperini, S., Ceska, M., Cassatella, M. A. (1994) Modulation of proinflammatory cytokine release from human polymorphonuclear leukocytes by gamma interferon. Cell Immunol. 157,448-461[CrossRef][Medline]
  42. Gasperini, S., Calzetti, F., Russo, M. P., De Gironcoli, M., Cassatella, M. A. (1995) Regulation of GRO alpha production in human granulocytes. J. Inflamm. 45,143-151[Medline]
  43. McDonald, P. P., Gasperini, S., Calzetti, F., Cassatella, M. A. (1998) Modulation by interferon-{gamma} of the production and gene expression of IL-1 receptor antagonist in human neutrophils. Cell Immunol. 184,45-50[CrossRef][Medline]
  44. Cassatella, M. A., Meda, L., Bonora, S., Ceska, M., Constantin, G. (1993) Interleukin-10 inhibits the release of proinflammatory cytokines from human polymorphonuclear leukocytes. Evidence for an autocrine role of TNF and IL-1β in mediating the production of IL-8 triggered by lipopolysaccharide. J. Exp. Med. 178,2207-2211[Abstract/Free Full Text]
  45. McLeish, K. R., Knall, C., Ward, R. A., Gerwins, P., Coxon, P. Y., Klein, J. B., Johnson, G. L. (1998) Activation of mitogen-activated protein kinase cascades during priming of human neutrophils by TNF-alpha and GM-CSF. J. Leukoc. Biol. 64,537-545[Abstract]
  46. Marshall, J. D., Aste-Amezaga, M., Chehimi, S. S., Murphy, M., Olsen, H., Trinchieri, G. (1999) Regulation of human IL-18 mRNA expression. Clin. Immunol. 90,15-21[CrossRef][Medline]
  47. Conti, B., Park, L. C., Calingasan, N. Y., Kim, Y., Kim, H., Bae, Y., Gibson, G. E., Joh, T. H. (1999) Cultures of astrocytes and microglia express interleukin-18. Mol. Brain. Res. 67,46-52[Medline]
  48. Grandjean-Laquerrière, A., Antonicelli, F., Gangloff, S. C., Guenounou, M., Le Naour, R. (2007) UVB-induced IL-18 production in human keratinocyte cell line NCTC 2544 through NF-{kappa}B activation. Cytokine 37,76-83[CrossRef][Medline]
  49. Wang, J., Wang, X., Hussain, S., Zheng, Y., Sanjabi, S., Ouaaz, F., Beg, A. A. (2007) Distinct roles of different NF-{kappa}B subunits in regulating inflammatory and T cell stimulatory gene expression in dendritic cells. J. Immunol. 178,6777-6688[Abstract/Free Full Text]
  50. Chandrasekar, B., Colston, J. T., de la Rosa, S. D., Rao, P. P., Freeman, G. L. (2003) TNF-{alpha} and H2O2 induce IL-18 and IL-18Rβ expression in cardiomyocytes via NF-{kappa}B activation. Biochem. Biophys. Res. Commun. 303,1152-1158[CrossRef][Medline]
  51. Kampfer, H., Muhl, H., Manderscheid, M., Kalina, U., Kauschat, D., Pfeilschifter, J., Frank, S. (2000) Regulation of interleukin-18 (IL-18) expression in keratinocytes (HaCaT): implications for early wound healing. Eur. Cytokine Netw. 11,626-633[Medline]
  52. Hong, T. P., Andersen, N. A., Nielsen, K., Karlsen, A. E., Fantuzzi, G., Eizirik, D. L., Dinarello, C. A., Mandrup-Poulsen, T. (2000) Interleukin-18 mRNA, but not interleukin-18 receptor mRNA, is constitutively expressed in islet β-cells and up-regulated by interferon-{gamma}. Eur. Cytokine Netw. 11,193-205[Medline]
  53. Kim, S. H., Eisenstein, M., Reznikov, L., Fantuzzi, G., Novick, D., Rubinstein, M., Dinarello, C. A. (2000) Structural requirements of six naturally occurring isoforms of the IL-18 binding protein to inhibit IL-18. Proc. Natl. Acad. Sci. U. S. A. 97,1190-1195[Abstract/Free Full Text]
  54. Weijer, S., Sewnath, M. E., de Vos, A. F., Florquin, S., van der Sluis, K., Gouma, D. J., Takeda, K., Akira, S., van der Poll, T. (2003) Interleukin-18 facilitates the early antimicrobial host response to Escherichia coli peritonitis. Infect. Immun. 71,5488-5497[Abstract/Free Full Text]
  55. Lauw, F. N., Branger, J., Florquin, S., Speelman, P., van Deventer, S. J., Akira, S., van der Poll, T. (2002) IL-18 improves the early antimicrobial host response to pneumococcal pneumonia. J. Immunol. 168,372-378[Abstract/Free Full Text]
  56. Li, X., Kovacs, E. J., Schwacha, M. G., Chaudry, I. H., Choudhry, M. A. (2007) Acute alcohol intoxication increases interleukin-18-mediated neutrophil infiltration and lung inflammation following burn injury in rats. Am. J. Physiol. Lung. Cell. Mol. Physiol. 292,L1193-L1201[Abstract/Free Full Text]
  57. Dai, S. M., Shan, Z. Z., Xu, H., Nishioka, K. (2007) Cellular targets of interleukin-18 in rheumatoid arthritis. Ann. Rheum. Dis. 66,1411-1418[Abstract/Free Full Text]
  58. Canetti, C. A., Leung, B. P., Culshaw, S., McInnes, I. B., Cunha, F. Q., Liew, F. Y. (2003) IL-18 enhances collagen-induced arthritis by recruiting neutrophils via TNF-{alpha} and leukotriene B4. J. Immunol. 171,1009-1015[Abstract/Free Full Text]
  59. Hoshino, T., Kato, S., Oka, N., Imaoka, H., Kinoshita, T., Takei, S., Kitasato, Y., Kawayama, T., Imaizumi, T., Yamada, K., Young, H. A., Aizawa, H. (2007) Pulmonary inflammation and emphysema: role of the cytokines IL-18 and IL-13. Am. J. Respir. Crit. Care Med. 176,49-62[Abstract/Free Full Text]
  60. Hayashi, N., Yoshimoto, T., Izuhara, K., Matsui, K., Tanaka, T., Nakanishi, K. (2007) T helper 1 cells stimulated with ovalbumin and IL-18 induce airway hyperresponsiveness and lung fibrosis by IFN-{gamma} and IL-13 production. Proc. Natl. Acad. Sci. U. S. A. 104,14765-14770[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Supplemental Data
Right arrow All Versions of this Article:
fj.08-110213v1
23/1/194    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fortin, C. F.
Right arrow Articles by McDonald, P. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fortin, C. F.
Right arrow Articles by McDonald, P. P.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS