| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,,1
* Department of Cellular Biology and Anatomy,
Department of Urology, and
Feist-Weiller Cancer Center, Louisiana State University Health Sciences Center, Shreveport, Louisiana, USA
1Correspondence: Department of Cellular Biology and Anatomy, Louisiana State University Health Sciences Center, 1501 Kings Hwy., Shreveport, LA 71130, USA. E-mail: oskall{at}lsuhsc.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
-actinin, but not of vinculin, associated with F-actin. Altogether, these results demonstrate that synemin is important for the malignant behavior of astrocytoma cells and that it contributes to the high motility of these cells by modulating the dynamics of -actinin and actin. —Pan, Y., Jing, R., Pitre, A., Williams, B. J., Skalli, O. Intermediate filament protein synemin contributes to the migratory properties of astrocytoma cells by influencing the dynamics of the actin cytoskeleton.
Key Words: glioma • invasion • -actinin
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 2)
. Knockout animal models and several human genetic diseases have demonstrated that these connections impart to those tissues the ability to withstand mechanical stress (1
2
3
4)
. Vimentin IFs also interact with cell-cell and cell-matrix adhesion proteins (5)
. This is important in regulating the transmigration of lymphocytes through endothelial cells (6)
and the size of focal contacts in endothelial cells in response to shear stress (7)
.
Vinculin is a major component of several junctions with which vimentin or desmin IFs interact, such as costameres and myotendinous connections (8)
. Another IF protein, synemin, also associates with these junctions (9
, 10)
. Synemin does not polymerize by itself but incorporates into vimentin and desmin IFs and, unlike vimentin and desmin, binds to vinculin (10
11
12
13)
. In addition, synemin incorporation into costameres and myotendinous junctions does not require a desmin IF network (9)
. These properties suggest that in myocytes, synemin docks IFs into vinculin-containing junctions.
Recently, it has been shown that synemin is present in nonjunctional plasma membrane domains, including the leading edge of astrocytoma cells (14)
and the sarcolemma of neonatal cardiomyocytes (15)
. These are unusual associations for an IF protein, and they may occur because synemin is a ligand of -actinin, which is a component of these membrane domains (11
, 14)
. The role played by synemin in nonjunctional membrane domains is unknown but, in astrocytoma cells, synemin is unlikely to connect the vimentin/glial fibrillary acidic protein (GFAP) IF network to the leading edge because this network does not extend into the leading edge (14)
. The leading edge is essential for cell motility (16)
, and thus synemin may be involved in the motility of astrocytoma cells. A role for synemin in the malignant behavior of astrocytoma cells is further suggested by the presence of synemin in human astrocytoma tumors of all grades but not in normal astrocytes (14)
.
Herein, we sought to obtain functional evidence on the role of synemin in astrocytoma cells by employing an RNA interference (RNAi) approach. Our results demonstrate that synemin down-regulation results in a dramatic reduction in cell motility and impedes cell spreading. These effects on the malignant behavior are accompanied by altered dynamic properties of -actinin and filamentous (F) -actin, indicating that the IF protein synemin is involved in a novel type of cytoskeletal crosstalk.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. PC3M and PPC-1 human prostate carcinoma cells were grown in RPMI 1640 containing 5% fetal bovine serum and 1% penicillin/streptomycin.
Lentivirus production and RNAi
For RNAi, we selected small hairpin RNAs (shRNAs) targeting the 3' untranslated region of human synemin mRNA, which is shared by the different synemin isoforms (12)
. In preliminary experiments, we identified 2 shRNAs that efficiently attenuated synemin expression and affected the motility of astrocytoma cells. The shRNA targeting the human synemin sequence CGCTTACAGTACCATTTCATT was used in all subsequent experiments. Control shRNA was represented by the sequence CAACAAGATGAAGAGCACCAA, which is not present in the human genome. These sequences were cloned in the pLKO.1-puro plasmid (Sigma, St. Louis, MO, USA), which expresses the puromycin-resistance gene.
Plasmid DNA was purified with the EndoFree Plasmid Maxi Kit (Qiagen, Valencia, CA, USA). Lentiviral particles were packaged by using lipofectamine to cotransfect 293FT cells (Invitrogen) with ViraPower plasmid mix (Invitrogen, Carlsbad, CA, USA) and the appropriate pLKO.1 plasmid.
For RNAi, cells were seeded in a 6-well plate (105 cells/well). At 
60% confluence, the cells were transduced with 105 viral particles in complete medium containing 6 µg/ml polybrene (Sigma). After 18 h, the medium was replaced with complete medium. The next day, puromycin (Sigma) was added to the medium at 2 µg/ml for U-373 MG or 1 µg/ml for all other cell lines. Puromycin selection was maintained for the duration of the experiment. Cells were processed for different assays 6 days (for A172 and U-118 MG) or 8 days (for U-373 MG, PPC-1, and PC3M) after lentiviral transduction.
Antibodies and immunofluorescence
Rabbit antibodies raised against the C terminus of human synemin were affinity purified, and their specificity was demonstrated on different human tissues and cell lines, including astrocytomas, as detailed earlier (14
, 17)
. Other antibodies included rabbit polyclonal anti-actin (Sigma), mouse monoclonal against -actinin (clone BM-75.2; Sigma), vimentin (clone V9; Sigma), vinculin (clone hVIN-1; Sigma), and goat anti-mouse or anti-rabbit IgGs conjugated to peroxidase (Kirkegaard & Perry, Gaithersburg, MD, USA) and to either Alexa Fluor 488 or 588 (Invitrogen). F-actin was stained with phalloidin conjugated to Alexa Fluor 488 (Invitrogen).
Cells plated on coverslips were processed for immunostaining and visualized with a confocal microscope as detailed earlier (14)
.
Reverse transcriptase-polymerase chain reaction (RT-PCR)
Total RNA was purified with the "high pure RNA isolation kit" (Roche Diagnostics, Indianapolis, IN, USA). One-step RT-PCR was performed with the Titanium kit (Clontech, Palo Alto, CA, USA) following the manufacturer’s instructions. The primers GCTCAACGCCCGGCTCTATGA and TCGGCCACCAGCAGTGCGTAG (annealing temperature 68°C) were used to amplify a 528 bp cDNA sequence common to the different human synemin isoforms because it codes for part of their shared rod domain. To ensure that equal amounts of RNA were used as template, a 1500-bp human vimentin cDNA fragment was amplified with the primers ATGTCCACCAGGTCCGTGTC and AAACTGCAGAAAGGCACTTGA (annealing temperature 58°C).
SDS-PAGE, Western blot analysis, and quantification of blots
Protein sample preparation, protein concentration measurements, SDS-PAGE, and electrophoretic transfer of proteins to nitrocellulose membranes were performed as described (14)
. Western blots were processed as described (14)
and incubated with antibodies at the following dilutions: 1:1000 for anti-synemin, 1:250 for anti-vinculin, 1:500 for anti-vimentin and anti--actinin, and 1:1000 for all secondary antibodies. Protein amount ratios were determined by densitometry using a ratio standard curve (18)
.
Cell motility assays
2 x 104 cells in 0.2 ml of serum-free medium were added to the upper compartment of a Boyden chamber assembly containing an insert with 8-µm pores (BD Biosciences, San Jose, CA, USA). The lower compartment contained 0.7 ml of medium plus 1% fetal calf serum. After 2 h (for U-373 MG) or 6 h (for all other cell lines) incubation at 37°C, the cells that were attached to the upper side of the membrane were removed with cotton swabs. The cells that migrated to the lower side of the insert were fixed with 10% formaldehyde and stained with 0.1% Coomassie blue. Cell counts were carried out on pictures taken with an inverted microscope. Three to five separate experiments were performed for each cell line. For each experiment, 3 inserts were plated with either control or synemin shRNA-treated cells.
Morphometric analysis of cell area
5 x 104 control or synemin-silenced cells were plated into 75 cm2 dishes and were left to attach and spread for 2 and 18 h. At the end of each incubation, the cells were fixed with 10% formaldehyde and stained with 0.1% Coomassie blue. Light microscopic observations were carried out with a light microscope (TE 2000-S; Nikon, Tokyo, Japan) and micrographs were taken with a Retica 2000R CCD camera (Retica Systems, Waltham, MA, USA). Cell surfaces were determined with the software Metamorph 6.3 (Universal Imaging, West Chester, PA, USA). One hundred fifty cells were analyzed for each condition and each experiment. The results of 3 independent experiments were analyzed with the software SigmaStat 3 (SPSS, Chicago, IL, USA).
Cell-substratum adhesion assay
Control or synemin-silenced cells were plated into a flat-bottomed 96-well plate (6x104 cells/well in 0.1 ml of complete medium). The plates were shaken for 30 s (Lab-Line model 4625; Thermo Fisher, Waltham, MA, USA; speed dial set at 5) and incubated at 37°C for 30 and 120 min. Nonadherent cells were lifted off from the bottom of the wells and discarded by gently inverting the plates. This was repeated 3 times with 0.1 ml serum-free Dulbecco modified Eagle medium (DMEM) washes. The cells remaining attached to the wells were stained with formazan (CellTiter 96 AQueous One Solution; Promega, Madison, WI, USA) following the manufacturer’s instructions. The staining intensity was proportional to cell numbers, and it was measured at 490 nm in a plate reader (Bio-Tek Instruments, Winooski, VT, USA). Three independent experiments were performed for each cell line; for each experimental condition, data were collected from 5 wells. Data analysis was performed with the software SigmaStat 3.
Cell proliferation and apoptosis
Control or synemin-silenced cells were plated into a 6-well plate (105 cells/well) in complete medium containing puromycin. Then, 2, 4, and 6 days after replating, the cells were harvested with trypsin/EDTA and resuspended in 1 ml complete medium. The number of cells present in the suspension was counted with the Vi-CELL XR Cell Viability Analyzer (Beckman Coulter, Fullerton, CA, USA).
Apoptosis was determined by the annexin V-FITC/propidium iodide method using the kit from BD Pharmingen (San Diego, CA, USA). After trypsinization, cells were resuspended in binding buffer at a concentration of 106 cell/ml and stained with annexin V and propidium iodide, following the manufacturer’s instructions. Flow cytometry analysis was performed with the FACSCalibur (Becton-Dickinson, Franklin Lakes, NJ, USA).
Quantitation of F-actin
Quantitation of F-actin was performed following the procedure of Tu et al. (19)
. Cells in a 6-well plate were washed with serum-free medium and lysed with 0.25 ml/well of F-actin stabilizing buffer (Cytoskeleton, Inc., Denver, CO, USA) comprised of 50 mM PIPES (pH 6.9), 50 mM KCl, 5 mM MgCl2, 1 mM ATP, 5 mM EGTA, 5% glycerol, 0.1% Nonidet P-40, 0.1% Triton-X-100, 0.1% Tween 20, 0.1% β-mercaptoethanol, 0.001% antifoam C, and protease inhibitors. Cells were scraped off the dish, and lysis was achieved by gentle pipetting. Lysates were centrifuged at 2000 g for 5 min to remove nuclei and intact cells. Supernatants were ultracentrifuged at 100,000 g for 1 h. F-actin and its associated proteins were recovered in the pellet, and unpolymerized actin and other cytosolic proteins were contained in the supernatant.
An equal volume of gel loading buffer was added to the supernatants. Proteins in the pellets were dissolved in the same final volume of a 1:1 mixture of F-actin stabilizing buffer and gel loading buffer. Equal volumes of pellet and supernatant were analyzed with the appropriate antibodies by Western blot analysis. Densitometric analysis was performed to determine the percentage of each protein of interest present in the pellet by using the formula ODp/(ODp+ODs), where ODp is the optical density of the band in the pellet and ODs is the optical density of the band in the supernatant.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Here, we have examined whether synemin is also present in the leading edge of tumor cells of nonglial origin, including PPC-1 and PC3M human prostate carcinoma cells. Phalloidin staining of PPC-1 and PC3M cells revealed intensely stained leading edges and ruffled membranes similar to those found in U-373 MG cells (Fig. 1
A), as well as in other astrocytoma cells lines, including U-118 MG, A172, and Hs683 (data not shown). In PPC-1 and PC3M cells, these membrane domains were synemin negative, whereas they were synemin positive in astrocytoma cells (Fig. 1A
). The remaining cytoplasm of PC3M and PPC-1 cells was synemin negative, whereas in U-373 MG cells, synemin also associated with the IF network (Fig. 1A
). Western blotting experiments further demonstrated that PC3M and PPC-1 cells did not contain synemin (Fig. 1B
).
|
Boyden chamber motility assays in which cells were allowed to migrate for 2 h revealed that PPC-1 and PC3M cells were much less migratory than synemin-positive astrocytoma cells (Table 1
). There were also differences in the migratory capacity of astrocytoma cells, with U-373 MG cells being more motile than U-118 MG and A172 cells, and U-118 MG cells being more motile than A172 cells (Table 1)
. These differences in motility correlated with synemin expression level (see ref. 14
and Fig. 2
B).
|
|
Astrocytoma cell motility is dramatically reduced by synemin down-regulation
The above results suggest that synemin contributes to the migratory properties of astrocytoma cells, and RNAi was performed to test this hypothesis. RT-PCR experiments revealed decreased synemin mRNA levels in U-373 MG, U-118 MG, and A172 astrocytoma cells treated for 6 days with synemin shRNA when compared to cells treated with control shRNA (Fig. 2A
). RT-PCR was also performed with vimentin primers to ensure that equal amounts of template were used (Fig. 2A
). cDNA amplification did not occur when the RT step was omitted (data not shown). Western blots showed a large reduction in synemin protein levels 6 days after synemin shRNA treatment (Fig. 2B
). A time course experiment was undertaken to examine the kinetics of synemin down-regulation in U-373 MG and A172 cells treated with synemin shRNA (Fig. 2C
). Cells treated with control or synemin shRNA were collected every 2 days for 8 days, and synemin levels were assessed by densitometry of Western blots. During these 8 days, synemin levels were stable in cells treated with control shRNA when compared to cells at time 0 (data not shown). In cells treated with synemin shRNA, synemin levels were decreased for all time points when compared to time-matched controls. For any given time, the decline was more pronounced for A172 cells than for U-373 MG cells (Fig. 2C
). For instance, after 6 days of treatment, A172 and U-118 MG cells (not shown for U-118 MG) retained only 10% of the synemin present in controls, while it took 8 days for U-373 MG cells to reach a similar decline in synemin level (Fig. 2C
). This is in keeping with the higher synemin content of U-373 MG cells relative to U-118 MG and A172 cells (see ref. 14
and Fig. 2B
).
The levels of proteins known to interact with synemin, including vimentin, -actinin, and vinculin, were also examined by Western blot analysis. Actin was included in these experiments because -actinin and vinculin can associate with F-actin. The levels of these four cytoskeletal proteins remained unchanged after synemin silencing (Fig. 2B
).
Boyden chamber assays were performed with cells treated for 6 days with control or synemin shRNAs to examine whether synemin down-regulation affects the migratory properties of astrocytoma cells. The number of synemin shRNA-treated cells that migrated through the Boyden chamber inserts appeared to be much lower than that of control cells (Fig. 3
A). Quantification revealed that this number was reduced by 80 and 70% for U-118 MG and for A172 cells, respectively (Fig. 3B
). For U-373 MG cells, the diminution in the migratory capacity of synemin-silenced cells was marginal (data not shown). However, when the assays were performed with U-373 MG cells that had been treated for 8 days with control or synemin shRNAs, there was an 60% decrease in the number of synemin-silenced cells migrating through the inserts when compared to control cells (Fig. 3)
. Together with the time course experiments (Fig. 2C
), these data suggest that synemin level should drop by more than 90% to affect the migration of astrocytoma cells.
|
An -synemin cDNA in which the sequence targeted by the shRNA was absent was transfected into synemin-silenced cells. This yielded -synemin levels higher than in silenced cells but lower than in control cells; no changes in the motility of the transfected cells were apparent (data not shown). This could be due to the fact that the -synemin level did not reach that of control cells. Alternatively, because all three synemin isoforms present in astrocytoma cells were silenced by the synemin shRNA, motility may not depend on this isoform or may depend on a particular isoform expression profile.
Motility assays were also conducted with PPC-1 and PC3M prostate carcinoma cells treated for 8 days with control or synemin shRNAs. The results show that the number of synemin shRNA-treated PPC-1 or PC3M cells that migrated through the Boyden chamber inserts was similar to that of control cells (Fig. 3)
. Because PPC-1 and PC3M cells are synemin-negative (Fig. 1)
, these data indicate the specificity of the effect of synemin silencing on the motility of astrocytoma cells. In addition, similar Western blot analysis and migration assay results were obtained by treating astrocytoma cells with shRNAs or siRNAs targeting different sets of synemin and control sequences (data not shown).
Astrocytoma cells with low synemin content are smaller than control cells
Microscopic observations suggested that synemin-silenced cells were smaller than control cells (Fig. 4
A). Morphometrical cell area measurements were performed on cells 2 and 18 h after plating (Table 2
and Fig. 4B
). Two hours after plating, the average surface area of synemin-silenced cells was 2.2-, 1.6-, and 1.7-fold smaller than that of control U-373 MG, U-118 MG, and A172 cells, respectively (Table 2)
. Eighteen hours after plating, the average area of control cells did not significantly change when compared to control cells 2 h after plating (Table 2)
. In contrast, the average area of synemin-silenced U-373 MG and A172 cells increased by 30% between 2 and 18 h after plating. For synemin-silenced U-118 MG cells, this increase was less pronounced (10%), but it was statistically significant. Despite this increase in surface area 18 h after plating, the average area of synemin-silenced cells was still 1.7, 1.5, and 1.3 times smaller than that of control U-373 MG, U-118 MG, and A172 cells, respectively (Table 2)
.
|
|
These data demonstrate that synemin-silenced cells are smaller than control cells. They also suggest that, after plating, synemin-silenced cells take longer to spread than control cells. This was demonstrated with histograms of the size distribution of control and silenced cells (Fig. 4B
). To plot these histograms, we counted the number of cells with areas belonging to a given size interval. Five intervals of equal width were considered for cell areas ranging from 0 to 5000 µm2, and a sixth interval was included for the largest cells (area comprised 5000–10,000 µm2).
For control cells, the shapes of the histograms were similar 2 and 18 h after plating (Fig. 4B
). This shows that for control cells, little change in spreading occurred after 2 h. In contrast, for synemin-silenced cells, the peaks of the area distribution shifted toward larger areas between 2 and 18 h (Fig. 4B
). This indicates that smaller cells were still increasing their surface during this time period. The area of control and silenced cells did not change noticeably from 18 h after plating onward (data not shown).
Synemin down-regulation affects proliferation but not apoptosis
The effect of synemin down-regulation on the proliferation of astrocytoma cells was investigated by counting cell numbers at different time points after plating. For these experiments, cells treated with control or synemin shRNAs for 6 (A172 and U-118 MG) or 8 days (U-373 MG) were trypsinized, and equal numbers of cells were plated. Cell counts were performed 2, 4, and 6 days after plating. Control cells grew robustly, doubling 2–3 times in the 6 days after plating. In contrast, during the same time period, synemin-silenced cells doubled less than once (Fig. 5
A). AnnexinV/propidium iodide assays carried out 4 days after plating demonstrated that lower cell numbers in synemin-silenced cells did not result from enhanced apoptosis because there was no difference in the proportion of apoptotic cells between control and synemin-silenced samples (Fig. 5B, C
).
|
Synemin does not affect cell-substratum adhesion
Adhesion assays were performed with cells treated with control or synemin shRNAs for 6 (U-118 MG and A172) or 8 (U-373 MG) days. Cells were then trypsinized, replated, and allowed to attach for 30 and 120 min. For each cell line and time point considered, the assays showed similar adhesion to the substratum for control and synemin-shRNA treated cells (Fig. 6
A).
|
Immunostaining with antivinculin and antisynemin revealed that in astrocytoma cells treated with control shRNA, synemin distributed over the IF network but did not localize with focal contacts (Fig. 6B
). Synemin-silenced astrocytoma cells displayed little synemin staining (Fig. 6C
). In these cells, the overall vinculin staining pattern was similar to that of control cells (Fig. 6B, C
).
Synemin silencing alters the dynamics of actin and -actinin, but not of vinculin and vimentin
Immunostaining was performed to assess the effect of synemin down-regulation on the subcellular distribution of vimentin and -actinin. F-actin was stained with fluorescent phalloidin to examine whether synemin silencing affected the formation of the leading edge.
In U-373 MG cells treated for 8 days with control lentivirus, synemin antibodies stained the vimentin IF network and the leading edge, which was clearly evidenced by fluorescent phalloidin staining (Fig. 7
A). In synemin-silenced cells, the overall organization of the vimentin IF network was similar to that of control cells, although little synemin associated with this network (data not shown). Fluorescent phalloidin labeling demonstrated that silenced cells exhibited leading edges and ruffled membranes, although the intensity of the staining appeared somewhat weaker than in controls. Synemin staining at these locations was marginal. In control cells, -actinin and synemin overlapped at the level of the leading edges but not in stress fibers, which stained only with anti--actinin (Fig. 7B
). The leading edge of synemin-silenced cells stained for -actinin but with a staining intensity that seemed lower than in controls. Similar results were obtained with U-118 MG and A172 cells (data not shown).
|
These morphological findings show that the overall distribution of F-actin and of -actinin is similar in control and silenced cells and also suggest that silenced cells may differ from controls by the amount of -actinin associated with F-actin and/or by the extent of actin polymerization. This possibility was examined quantitatively by lysing the cells under conditions maintaining F-actin intact. The lysates were ultracentrifuged and cytoskeletal polymers and their associated proteins were recovered in pellets while supernatants contained proteins that were neither in a polymerized state nor associated with filaments. These fractions were analyzed by Western blot analysis (Fig. 8
A), and densitometric analysis yielded the percentage of total actin and -actinin present in the cytoskeletal pellet (Fig. 8B
). The partitioning of vimentin and vinculin between pellet and supernatant was also examined.
|
Control astrocytoma cell lines differed in the percentage of total actin present as polymer (51, 35, and 41% for U-373 MG, U-118 MG, and A172 cells, respectively). In all of these cell lines, however, synemin silencing significantly lowered the proportion of polymerized actin (36, 23, and 28% for U-373 MG, U-118 MG, and A172 cells, respectively) (Fig. 8)
. Similarly, the percentage of total -actinin recovered in the pellet of synemin-silenced cells was significantly lower in synemin-silenced cells (18, 20, and 25% for U-373 MG, U-118 MG, and A172 cells, respectively) when compared to control cells (29, 30, and 37% for U-373 MG, U-118 MG, and A172 cells, respectively) (Fig. 8)
. It should be noted that the total amounts of actin and -actinin were similar in control and synemin-silenced cells (Fig. 2B
). For both control and synemin-silenced cells, vimentin was recovered primarily in the pellet, whereas vinculin was found primarily in the supernatant (Fig. 8A
). The trace amount of vimentin present in the cytosol could not be quantified accurately, but the percentage of total vinculin in the pellet did not differ significantly between control and synemin-silenced cells (Fig. 8B
).
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 4)
. Synemin, however, is one of the few IF proteins whose function remains unchartered. We demonstrate here that synemin affects the motility, shape, and proliferation but not the adherence to substratum of astrocytoma cells. These effects are accompanied by decreased amounts of F-actin and of -actinin associated with F-actin. Our results also show that cancer cell lines containing synemin at the leading edge are more motile than those without synemin at this location.
The presence of synemin in astrocytoma cells, but not in normal astrocytes (14)
, suggests that this protein is involved in the malignant properties of astrocytoma cells. The malignant transformation of several cell types is accompanied by the synthesis of new IF subunits, and this has been linked to enhanced invasive properties for keratin 8 and 18 in sarcoma cells, as well as for vimentin and nestin in breast and prostate carcinoma cells, respectively (20
21
22
23)
. Tumor cells may also derive enhanced invasive properties by down-regulating IF proteins contained in their cell type of origin. Astrocytoma cells, for instance, have lower GFAP levels than normal astrocytes, and there is an inverse correlation between GFAP expression and the motility of astrocytoma cells (24
, 25)
. Studies of vimentin-null cells have suggested that vimentin influences the motility of nonmalignant cells, such as fibroblasts and astrocytes and that it is instrumental during the transendothelial migration of lymphocytes (6
, 26
, 27)
.
The mechanisms by which those IF proteins contribute to cell migration are poorly understood. Local transitions in cytoplasmic viscosity are essential for cell motility and are contributed chiefly by the dynamics of actin filaments (16)
. IF networks, however, may also modulate the physical properties of the cytoplasm during migration because in pancreatic carcinoma cells, the retraction of the extended keratin IF network to the perinuclear area decreased cellular rigidity, while increasing cell motility (28)
. IFs may also affect cell motility by interacting with proteins and structures essential for this process, such as integrins and focal contacts (5)
. Vimentin IFs, for example, regulate the size of focal contacts in endothelial cells subjected to shear stress (7)
and anchor into the plasma membrane adhesion proteins required for the transendothelial migration of lymphocytes (6)
. Moreover, in migratory fibroblasts, vimentin is involved in integrin recycling mediated by protein kinase C
(29)
.
Our results delineate a third mechanism by which an IF protein may affect cell motility, and that is by modulating the dynamic properties of -actinin and F-actin. This mechanism may be particular to synemin, because it is the only IF protein known to bind to -actinin and to be present in the leading edge of some cell types. It should be noted, however, that vimentin binds to fimbrin, an actin-associated protein, but the functional significance of this interaction is unknown (30)
.
Vinculin, like -actinin, is a key player in cell motility (8)
. Several lines of evidence suggest that in astrocytoma cells the interaction of synemin with vinculin is not as critical as that of synemin with -actinin with respect to cell motility. First, in astrocytoma cells, synemin does not colocalize with vinculin in focal contacts, but it does colocalize with -actinin at the leading edge. Second, synemin silencing does not affect the overall distribution and appearance of focal contacts, the solubility properties of vinculin, and the adhesion of astrocytoma cells to the substratum. Synemin was also absent from focal contacts of newborn astrocytes (31)
and from those at the cell body of hepatic stellate cells (32)
. In these latter cells, however, synemin associated with focal contacts in cytoplasmic extensions, suggesting that synemin association with focal contacts is subject to local regulation (32)
. The same holds true for synemin/-actinin interactions, because in astrocytoma cells, these two proteins colocalize at the leading edge but not along stress fibers, possibly because different -actinin isoforms are present in these structures (33)
.
Notably, we demonstrate that synemin silencing reduced the amounts of F-actin and of -actinin associated with F-actin. How does synemin down-regulation cause these changes? -Actinin binds directly to synemin (11)
, and the two proteins form complexes in astrocytoma cells in which they colocalize at the leading edge (14)
. In this context, our finding that low synemin levels decrease the amount of -actinin associated with F-actin suggests that synemin may influence the association-dissociation rate of -actinin to F-actin. In turn, reducing the amount of -actinin associated with F-actin may shift actin dynamics toward depolymerization. -Actinin, in fact, inhibits F-actin depolymerization in leukocytes and neuroblasts (34
, 35)
. Furthermore, in vitro experiments have shown that -actinin stimulates both the rate and extent of actin polymerization (34
, 36)
.
Reduced F-actin levels may account for several of the phenotypic changes affecting synemin-silenced astrocytoma cells. There is ample evidence that actin polymerization is essential for lamellipodia extension, which is a crucial step in cell motility (16)
. Moreover, -actinin association with F-actin promotes the gelation of the actin meshwork, and this event is responsible for providing the driving force for lamellipodia extension (37)
. Synemin binding to -actinin may thus influence cell motility by affecting actin dynamics and/or the structural organization of F-actin networks. Similarly, the smaller size, delayed spreading, and reduced proliferation of synemin-silenced cells could be brought about by decreased F-actin. In several systems, cell spreading depends on actin polymerization (38
39
40)
. Decreasing the amount of F-actin either with drugs or overexpression of depolymerizing proteins not only promotes cell rounding and but also inhibits cell proliferation (41
42
43)
.
The association of synemin with the leading edge displays a cell-type specificity that suggests that synemin is not essential for leading edge extension but that it may modify its properties. This possibility is supported by our finding that synemin down-regulation decreases the motility of astrocytoma cells without compromising in a obvious fashion leading edge extension. In addition, astrocytoma cells are much more migratory than prostate carcinoma cell lines that do not express synemin, suggesting that synemin may belong to a pathway endowing astrocytoma cells with exceptional migratory properties.
Synemin has the features of a versatile protein linker with the potential to modulate the dynamics of two cytoskeletal systems, because it can copolymerize with vimentin and possesses binding sites for several actin-associated proteins (e.g., 10, 11, 13). Here, we demonstrate that synemin alters the dynamics of the actin cytoskeleton in astrocytoma cells and is instrumental in determining several of the malignant properties of these cells. Synemin is also expressed in myocytes, endothelial cells, developing and reactive astrocytes, and liver fibrotic cells (11
, 14
, 17
, 31
, 32
, 44
, 45)
. It will be interesting to investigate the roles of synemin in these varied cellular contexts.
|
ACKNOWLEDGMENTS |
|---|
Received for publication January 22, 2008. Accepted for publication April 25, 2008.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
0.001.
