FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published as doi: 10.1096/fj.08-107417.
 (The FASEB Journal. 2008;22:2809-2820.)
© 2008 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.08-107417v1
22/8/2809    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yuan, S.
Right arrow Articles by Luo, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yuan, S.
Right arrow Articles by Luo, Y.

Voltage-dependent anion channel 1 is involved in endostatin-induced endothelial cell apoptosis

Shaopeng Yuan, Yan Fu, Xiaofeng Wang, Hubing Shi, Yujie Huang, Xiaomin Song, Ling Li, Nan Song and Yongzhang Luo1

Laboratory of Protein Chemistry, Beijing Key Laboratory for Protein Therapeutics, Department of Biological Sciences and Biotechnology, Tsinghua University, Beijing, China

1Correspondence: Laboratory of Protein Chemistry, Beijing Key Laboratory for Protein Therapeutics, Department of Biological Sciences and Biotechnology, Tsinghua University, Beijing 100084, China. E-mail: protein{at}tsinghua.edu.cn


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Endostatin (ES) was reported to stimulate apoptosis in endothelial cells, but the exact mechanism remains controversial. In the present study, we elucidate the mechanism of ES-induced endothelial cell apoptosis. Our results indicate that ES induces cytochrome c release and caspase-9 activation in human microvascular endothelial cells (HMECs) at the concentration of 1 µM for 24 h, which initiates the apoptosis process. Further, ATP production, mitochondrial membrane potential, and tubule formation assays showed that ES promotes the mitochondrial permeability transition pore (mPTP) opening via voltage-dependent anion channel 1 (VDAC1), a major component of mitochondrial outer membrane. Knocking down VDAC1 by small interfering RNA attenuates ES-induced apoptosis, while overexpression of VDAC1 enhances the sensitivity of endothelial cells to ES. Moreover, we reveal that ES induces the reduction of hexokinase 2 (HK2), which, in turn, promotes VDAC1 phosphorylation and accumulation. Data from two-dimensional electrophoresis, immunoprecipitation, mPTP opening, and caspase-3 activation assays indicate that two serine residues of VDAC1, Ser-12 and Ser-103, can modulate VDAC1 protein level and thus the sensitivity to apoptosis stimuli. On the basis of these findings, we conclude that VDAC1 plays a vital role in modulating ES-induced endothelial cell apoptosis.—Yuan, S., Fu, Y., Wang, X., Shi, H., Huang, Y., Song, X., Li, L., Song, N., Luo, Y. Voltage-dependent anion channel 1 is involved in endostatin-induced endothelial cell apoptosis.


Key Words: angiogenesis • endothelium • hexokinase • mitochondria • metabolism


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
ANGIOGENESIS, THE FORMATION OF NEW blood vessels from preexisting vascular beds, is essential for tumor growth and survival (1) . The angiogenesis process can be regulated by a switch between concentrations of inducers and inhibitors in vivo (2) , and many angiogenesis regulators have been developed as potential antitumor targets in clinical studies (3) .

Endostatin (ES), the C-terminal globular domain of collagen XVIII, is one of the most powerful angiogenesis inhibitors identified so far (4) . ES specifically targets angiogenic endothelial cells in the tumor region, and its function has been related to several signaling events. Besides the inhibitory effect on endothelial cell migration and proliferation (5 , 6) , ES has been proposed to induce endothelial cell apoptosis. Sukhatme and colleagues (7) reported that in cow pulmonary artery endothelial cells (C-PAECs), ES down-regulates two major antiapoptotic proteins, bcl-2 and bcl-xL, indicating that ES may induce apoptosis via the intrinsic apoptotic pathway. In addition, other groups reported that ES promotes the activation of caspase-8 in human dermal microvascular endothelial cells (HDMECs) and human umbilical vein endothelial cells (HUVECs), respectively, indicating that ES may also induce apoptosis via the extrinsic pathway (8 , 9) . Moreover, some other intracellular proteins are related to ES-induced apoptosis, such as Shb adaptor protein, AP-1, c-myc, mcl-1, and cyclin D1 (6 , 10 , 11) . However, Skovseth and colleagues (12) reported that ES cannot induce endothelial cell apoptosis at a low concentration of 30–35 ng/ml in vivo. Conversely, ES was even reported to enhance migration and proliferation in endothelial progenitor cells (13) . Clearly, these studies demonstrate that the mechanism of ES-induced endothelial cell apoptosis remains controversial.

Mitochondria are major organelles involved in cell energy conversion and apoptosis regulation (14) . In mitochondria-mediated cell apoptosis, opening of the mitochondrial permeability transition pore (mPTP) plays a pivotal role (15) . Decrease in mitochondrial membrane potential, depletion of ATP, increase in free Ca2+, acidic and oxidative stresses are all signals that potentially enhance the probability of mPTP opening in cells (16) . In addition, inhibitors targeting the mPTP opening, such as bongkrekic acid (BA) and cyclosporine A (CsA), appear to protect cells from the consequences of apoptosis stimuli (17 , 18) .

The mPTP is proposed to be a relatively nonspecific channel spanning the inner and outer mitochondrial membranes, which is composed of voltage-dependent anion channel (VDAC), adenine nucleotide translocator (ANT), and cyclophilin D (CypD) (19 20 21) . The VDAC family proteins, including homologous isomers VDAC1, VDAC2, and VDAC3, locate on the mitochondrial outer membrane. Under the regulation of Bcl-2 family members, VDAC participates in the release of cytochrome c and subsequent activation of caspase-9 (22) . In addition, caspase-independent apoptosis is also related to VDAC (23) . Among the isomers, VDAC1 is the well recognized member involved in modulating cell apoptosis (24) . Up-regulation of VDAC1 promotes apoptosis in several cell lines (25 26 27) .

Hexokinase 2 (HK2) is an important glycolytic protein that prevents apoptosis through interacting with VDAC1 on the mitochondria (28) . HK2 is up-regulated in several tumor cells, which promotes endothelial cell angiogenesis (29) . Recently, HK2 was determined to be regulated by hypoxia-inducible factor-1{alpha} (HIF-1{alpha}) in an angiogenesis modulating process (30) . Since ES has been reported to down-regulate HIF-1{alpha} in endothelial cells (11) , it is plausible that ES regulates other glycolytic proteins, such as HK2, during the angiogenesis inhibition process.

In the present study, we show that ES induces up-regulation of VDAC1 and promotes the mPTP opening. We subsequently reveal that up-regulation of VDAC1 results from ES-induced HK2 reduction. Our findings elucidate a novel mechanism of ES-induced endothelial cell apoptosis through mitochondria, providing insight into the antiangiogenic mechanism of ES.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Cell culture
HMECs, Hela, and HEK 293T cells are maintained at 37°C, 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM) (Hyclone, Logan, UT, USA) supplemented with 10% fetal calf serum (FCS) (Hyclone), 100 µg/ml streptomycin, and 100 U/ml penicillin. Endothelial cells were treated with 1 µM ES for 24 h in the presence of 10 ng/ml basic fibroblast growth factor (bFGF) and 1% FCS unless indicated otherwise.

Chemicals, proteins, and antibodies
All chemicals were from Sigma-Aldrich (St. Louis, MO, USA) and all antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA, USA) if not mentioned specifically. ES and bFGF were from Protgen Inc. (Beijing, China).

Monoclonal anti-VDAC1 antibody was from Calbiochem (Gibbstown, NJ, USA). MitoTracker-Red, Rhodamine 123 (Rh123), and monoclonal anti-Cox IV antibody were from Molecular Probes (Eugene, OR, USA).

TUNEL assay
The cultured cells were starved overnight, and then 1% FCS and 10 ng/ml bFGF were incubated with 1 µM ES. After 48 h treatment, the samples were prepared following the TACS TdT In Situ Apoptosis Detection Kit user’s manual (R&D Systems, Minneapolis, MN, USA) and were examined by fluorescence microscopy.

Annexin V/propidium iodide assay
Apoptosis was measured using the annexin V/propidium iodide (PI) detection kit, according to the manufacturer’s instruction (R&D Systems). Briefly, ES-treated cells were trypsinized and resuspended in PBS supplemented with 0.1% BSA and labeled with annexin V-FITC and PI. Flow cytometric analysis was then performed to monitor the green fluorescence of annexin V and the red fluorescence of DNA-bound PI with excitation at 488 nm. All data were collected using a FACScan (Becton Dickinson, San Jose, CA, USA).

In vitro caspase activity assay
Caspase-3, -8, -9 activity was measured by the cleavage of their respective substrates, including DEVD-pNA, IETD-pNA, and LHED-pNA (BioVision, Mountain View, CA, USA). Briefly, 1 x 106 cultured cells were lysed according to the user’s manual. Equal amounts of protein samples were transferred into a 96-well microtiter plate with substrates. Then, the absorbance was measured in a microplate reader at 405 nm (Bio-Rad Laboratories, Hercules, CA, USA). The activity of caspases was indicated by comparing the absorbance of ES-treated samples with an untreated control.

Cell fractionation assay
ES-treated cells were fractionated by differential centrifugation. Briefly, cells were homogenized with a Dounce homogenizer in a buffer containing 0.25 M sucrose and 10 mM HEPES (pH 7.4) supplemented with protease inhibitor cocktail (Roche, Basel, Switzerland). The homogenate was then centrifuged at 800 g for 10 min to remove nuclei and unbroken cells, and then the supernatant was centrifuged at 12,000 g for 20 min to get the mitochondria. The cytosolic cytochrome c was thereby detected by immunoblotting assay with cytochrome c monoclonal antibody.

For immunoblotting, proteins were separated by SDS-PAGE, transferred onto nitrocellulose membranes, and then probed with respective antibodies as indicated. Immunoreactive bands were visualized using enhanced chemiluminescence (Pierce, Rockford, IL, USA).

Immunofluorescent and confocal microscopy
For detecting the localization of cytochrome c, ES-treated cells were fixed by 4% paraformaldehyde and permeabilized with 0.2% Triton X-100. After washing twice with PBS, the cells were blocked with PBS containing 10% normal goat serum for 60 min and then incubated with monoclonal antibody against cytochrome c (1:200 dilution) and FITC-labeled goat anti-mouse secondary antibody (1:50 dilution) at room temperature for 2 h. The mitochondria were directly stained with MitoTracker-Red, and the nuclei were stained by DAPI. Confocal fluorescence imaging was performed on an Olympus Fluoview laser scanning confocal imaging system (Olympus Inc., Tokyo, Japan).

Measurement of the cellular ATP levels
The ATP levels were determined by the luciferin-luciferase reaction. Briefly, 0.5 x 106 cultured cells were collected after ES treatment and then treated according to the manufacturer’s instruction (BioVision, Mountain View, CA, USA). The luminescence of 100 µl of lysate was measured immediately using a luminometer.

Measurement of mitochondrial membrane potential
ES-treated cells were trypsinized and resuspended in PBS supplemented with 0.1% BSA and then incubated with Rh123 for 30 min at 4°C. Flow cytometric analysis was then performed to monitor the green fluorescence of Rh123 with excitation at 488 nm using FACScan.

mPTP opening assay
The mPTP opening was detected with the MitoProbe Transition Pore Assay Kit according to the manufacturer’s instructions (Molecular Probes). Briefly, cells were collected and stained with 2 µM calcein AM containing CoCl2 and ionomycin if required at 37°C for 15 min. Samples were then assessed for fluorescence with excitation at 488 nm. Different intensities of subgroup cells were respectively indicated in black (calcein AM only), green (calcein AM and CoCl2), and pink (calcein AM, CoCl2, and ionomycin). The mPTP opening was indicated by the reduction of mitochondrial calcein signal (green subgroups).

Tubule formation assay
The tubule formation assay was carried out as described previously. In brief, 24-well plates were coated with 100 µl/well matrigel (Becton Dickinson Labware, Bedford, MA, USA). Endothelial cells were seeded on this matrix at 1 x 104 cells/well and incubated with 10 ng/ml bFGF. After 6 h, the wells were fixed and visualized. The tubule formation was assessed in 3 randomly selected fields per well using a CoolSNAP charge-coupled device (CCD) digital camera (Roper Scientific, Tucson, AZ, USA).

Reactive oxygen species (ROS) release assay
The cell samples were prepared following the ROS assay kit manufacturer’s instructions (Applygen Technologies Inc., Beijing, China), and then detected by fluorescent microscopy.

Phosphorylation of VDAC1 assay
ES-treated cells were lysed with 1% Chaps lysis buffer [10 mM HEPES (pH 7.4), 150 mM NaCl, 1 mM DTT, 20 mM NaF, 1 mM Na3VO4, and 1% Chaps] containing protease inhibitors (Roche). The whole-cell lysates were immunoprecipitated with a rabbit polyclonal antibody against VDAC1 (Calbiochem), electroblotted onto nitrocellulose membranes, and then probed with an anti-phosphoserine monoclonal antibody (Abcam plc, Cambridge, UK).

RNA interference
The sense sequences of double-strand siRNA were as follows:

siVDAC1 (siVC1): 5' AGUGACGGGCAGUCUGGAATT 3'

siHK2a: 5' GGAUAAGCUACAAAUCAAATT 3'

siHK2b: 5' CGGGAAAGCAACUGUUUGATT 3'

Scrambled siRNA, which serves as negative control, was purchased from GenePharma (Shanghai, China). Transfection of synthetic siRNA (25 nM) was performed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.

For RT-PCR assay, the primer sequences of HK2 and GAPDH were as follows:

HK2: Sense sequence: 5' TCAACCCCGGCAAGCAGAGG 3'

Reverse sequence: 5' CCGCCGGGCCACCACAGT 3'

GAPDH: Sense sequence: 5' GAAGGTGAAGGTCGGAGTC 3'

Reverse sequence: 5' GAAGATGGTGATGGGATTTC 3'

Statistical analysis
Data are expressed as means ± SD. Multiple comparisons were assessed by Student’s t test, and differences with P < 0.05 were considered significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
ES induces endothelial cell apoptosis via mitochondrial pathway
The mechanism of ES-induced endothelial cell apoptosis has remained controversial. To clarify whether ES can indeed induce endothelial cell apoptosis, we first performed a series of apoptotic assays on HMECs to elucidate the proapoptotic function of ES. The TdT-mediated dUTP nick end labeling (TUNEL) assay showed that in treated endothelial cells, ES promoted nuclear DNA fragmentation, which is a hallmark of apoptosis (Fig. 1 A). Moreover, the results of the annexin V assay, which examined the exposed phosphatidylserine (PS) on apoptotic endothelial cell membrane, showed that ES could induce HMEC apoptosis in a dose-dependent manner (data not shown).


Figure 1
View larger version (25K):
[in this window]
[in a new window]

  		Figure 1. ES induces endothelial cell apoptosis via mitochondrial pathway. HMECs were treated with 1 µM ES for 24 h in the presence of 10 ng/ml bFGF and 1% FCS unless indicated otherwise. A) HMECs were treated with ES for 48 h in the presence of bFGF and FCS, and detected by TUNEL assay kit with fluorescent microscopy, as described in Materials and Methods. The nuclei were stained with DAPI (blue), and the apoptotic cells were stained with FITC-labeled TdT (green), which indicates the fragmented DNA. Scale bar = 10 µm. B) Caspase-3, -8, -9 cleavage activity assay. HMECs were treated with ES for 24 h as previously described, and the caspases were separately detected by the caspase activity assay kit. Data are means of 3 independent experiments. C) The reduction of caspase precursors was separately detected by immunoblotting to indicate ES-induced caspase activation. D) Top panel: the release of cytochrome c was detected by fluorescent microscopy (green). The nuclei were stained with DAPI (blue), and the mitochondria were stained with MitoTracker-Red (red). Scale bar = 10 µm. Bottom panel: cytochrome c released to the cytosol was subfractioned and examined by immunoblotting after ES treatment, and β-actin was loaded as a control. E) HMECs were treated with different concentrations of ES (0, 0.5, 1, and 5 µM) before evaluation by caspase-9 cleavage activity assay kit. Data are means of 3 independent experiments.

To further characterize the ES-induced apoptosis process, we measured the activation of caspases, another hallmark of apoptosis. The DEVD-pNA cleavage activity assay showed that caspase-3 was activated on ES treatment (Fig. 1B ). Because different caspases participate in different apoptotic pathways, we then set out to investigate which of the caspase-3 upstream modulators, caspase-8 and caspase-9, could be activated. Separate examination of the IETD-pNA and LHED-pNA cleavage activities indicated that only caspase-9 could be activated on ES treatment (Fig. 1B ). ES-induced activation of caspase-3 and caspase-9 was further confirmed by immunoblotting assay, which showed that the precursors of these two caspases declined on ES treatment (Fig. 1C ). Since activation of caspase-9 is normally triggered by cytochrome c released to the cytoplasm (14) , we thus examined released cytochrome c in the cytoplasm. Immunofluorescence and immunoblotting assays showed that ES significantly promoted the release of cytochrome c to the cytoplasm (Fig. 1D ). In addition, the release of cytochrome c was determined to occur in an ES dose-dependent manner, which was consistent with the subsequent caspase-9 activation (Fig. 1E ). Since cytochrome c release and caspase-9 activation are both hallmarks of the mitochondria-mediated apoptosis process, these results therefore indicate that the mitochondrial pathway is involved in the ES-induced apoptotic process.

ES promotes endothelial cell mPTP opening
It is known that the efficiency of ATP synthesis on mitochondria is critical for the maintenance of functional complexity in living cells. In our investigation, ES promoted ATP depletion in endothelial cells (Fig. 2 A), which suggested that the mitochondrial respiration level was associated with endothelial cell apoptosis. Furthermore, the dispersed fluorescence of immunostained Cox IV seen by microscopy analysis indicated that the integrity of the mitochondria was disrupted on ES treatment (Fig. 2B ). Flow cytometric analysis further showed the decrease of mitochondria-labeled Rh123 fluorescence, which implied that ES significantly disturbed the mitochondrial membrane potential of endothelial cells (Fig. 2C ). Since depletion of ATP, disruption of mitochondrial integrity, and mitochondrial potential reduction are related to the mitochondrial membrane permeabilization, we then examined the effects of ES on the mPTP opening. We labeled endothelial cell mitochondria with calcein AM, a highly negatively charged green fluorescent molecule, to detect the effect in ES-treated living cells. As expected, ES treatment reduced the fluorescent signal of calcein on mitochondria, suggesting that ES promoted the mPTP opening (Fig. 2D ). Furthermore, mPTP inhibitors could attenuate ES-induced endothelial cell apoptosis. In our experiment, activation of caspase-9 was impaired by pretreatment with 5 µM BA and 4 µM CsA, respectively (Fig. 2E, F ).


Figure 2
View larger version (32K):
[in this window]
[in a new window]

  		Figure 2. ES promotes endothelial cell mPTP opening. A) The relative ATP levels of endothelial cells were detected by luciferin-luciferase reaction after treatment with different concentrations of ES (0.5 to 5 µM). Data are means of 3 independent experiments. B) The disruption of mitochondrial structure was indicated by fluorescent microscopy to detect the morphological changes in Cox IV after ES treatment (green). Nuclei were stained with DAPI (blue). Scale bar = 10 µm. C) ES-treated HMECs were stained with Rh123 and examined by flow cytometry to detect the mitochondrial membrane potentials. Green subpopulation: ES-treated cells; black subpopulation: untreated cells. The assays were performed 3 independent times. D) ES-treated endothelial cells were examined by flow cytometry with the MitoProbe Transition Pore Assay Kit to detect the mPTP opening. The mPTP opening was indicated by reduction of the mitochondrial calcein fluorescence (green). The assays were performed 3 independent times. E) Inhibitors of mPTP opening attenuate ES-induced caspase-9 activation. ES-induced activation of caspase-9 was detected after the indicated time in the presence of CsA and BA. F) ES-induced activation of caspase-9 under the same conditions as in E was detected by immunoblotting to probe the precursors of caspase-9, and β-actin was loaded as a control. G) The tubule formation assay was performed on the endothelial cells under the same conditions as in E, and visualized by Olympus microscopy and CoolSNAP CCD digital camera. H) Statistical analysis of the tubule formation assay. Data are means of 3 independent experiments.

To investigate whether the opening of mPTP is involved in the antiangiogenic function of ES, we investigated the effects of BA and CsA on endothelial cell tubule formation. In the absence of BA and CsA, ES exhibited strong inhibition on the tubule formation. However, this effect was attenuated in the presence of BA and CsA (Fig. 2G, H ). This result demonstrates that the inhibitory effect of ES on angiogenesis is dependent on the mPTP opening. Furthermore, it also implies that attenuation of endothelial cell apoptosis can facilitate the angiogenesis process.

ES induces VDAC1 up-regulation in endothelial cells and modulates the apoptotic process
To further investigate the mechanism of ES-induced mPTP opening, we focused on the component proteins of mPTP and their roles in modulating apoptosis. Enhanced protein level of VDAC1, one of the essential mPTP components, was observed in a dose-dependent manner on ES treatment (Fig. 3 A). Up-regulation of VDAC1 was exclusively observed in endothelial cells, but not in nonendothelial cells such as Hela or HEK 293T cells (data not shown). We therefore hypothesized that VDAC1 is a potential candidate in modulating the ES-induced apoptotic process.


Figure 3
View larger version (27K):
[in this window]
[in a new window]

  		Figure 3. ES induces VDAC1 up-regulation in endothelial cells and modulates the apoptotic process. A) VDAC1 was probed with monoclonal antibody after treatment with different concentrations of ES for 24 h, and β-actin was loaded as a control. B) The attenuation of ES-induced apoptosis was detected by annexin V/PI assay in the VDAC1-silenced endothelial cells. Synthetic VDAC1 siRNA (siVC1) was transfected in HMECs for 24 h before ES treatment; cells were collected and analyzed by flow cytometry. N.C. denotes negative control, which indicates scrambled siRNA. The assays were performed 3 independent times. C) The attenuation of caspase-9 activation was detected in ES-treated VDAC1-silenced endothelial cells under the same conditions as in B. Data are means of 3 independent experiments. D) Immunoblotting to detect the attenuation of caspase-9 activation in ES-treated VDAC1-silenced endothelial cells. E) pVC1 and GFP-VC1 indicate the vectors constructed with human VDAC1 gene in the plasmid pcDNA3.1 and pEGFP-N1, respectively. HMECs were transiently transfected with pVC1 and empty vectors and were incubated with or without 1 µM ES for 6 h before measuring the tubule formation. In another experiment, GFP-VC1 and pEGFP-N1 were transfected in HMECs, and the tubule formation was then measured by fluorescence microscopy (green). F) Statistical analysis of the tubule formation assay in E. Data are means of 3 independent experiments. G) The activation of caspase-9 was detected in pVC1 transfected HMECs incubated with or without ES. Data are means of 3 independent experiments. H) pVC1 and empty vectors were transfected in HMECs, and then the ROS release was examined by fluorescence microscopy with probing dichlorofluorescin diacetate (DCFH-DA) fluorescence (green). Scale bar = 50 µm.

To specify the function of VDAC1 in regulating ES-induced apoptosis, we knocked down VDAC1 in endothelial cells, using synthetic siRNA targeting VDAC1. As expected, the annexin V assay showed that ES-induced apoptosis was attenuated in VDAC1-silenced cells (Fig. 3B ). In addition, the results of LHED-pNA cleavage activity and immunoblotting assay both showed that ES-induced caspase-9 activation was impaired in VDAC1-silenced cells (Fig. 3C, D ). These results confirmed the important role of VDAC1 in modulating ES-induced apoptosis.

To further examine the effect of VDAC1 up-regulation, we overexpressed VDAC1 and subsequently examined the function on tubule formation. By fluorescent microscopy analysis, overexpression of VDAC1 was determined to directly inhibit endothelial cell tubule formation (Fig. 3E , bottom panel), which enhanced the sensitivity of endothelial cells to ES (Fig. 3E , top panel; F). This inhibitory phenomenon might be the result of overexpression of VDAC1 promoting the death rate of endothelial cells. Actually, overexpression of VDAC1 in endothelial cells did indeed enhance the activation of caspase-9 (Fig. 3G ). Moreover, the production of ROS, another hallmark of mitochondria-mediated apoptosis, was elevated after overexpression of VDAC1 in endothelial cells (Fig. 3H ). These results demonstrate that overexpression of VDAC1 promotes the mitochondria dysfunction, which further confirms that ES induces apoptosis via VDAC1 up-regulation and eventually leads to angiogenesis inhibition.

ES-induced reduction of HK2 results in VDAC1 up-regulation
To further delineate the mechanism of how ES induces apoptosis through VDAC1 up-regulation, we investigated VDAC1 binding proteins to screen the potential modulators. Among the VDAC1 binding proteins, HK2 was reported to inhibit apoptosis (31) . ES was observed to significantly reduce the protein level of HK2 after 4 h of treatment in endothelial cells (Fig. 4 A). Considering the function of HK2 in apoptosis inhibition, the reduction of HK2 predictably decreases its association with VDAC1. As expected, our results showed that ES disturbed the interaction between HK2 and VDAC1, and overexpression of VDAC1 facilitated its dissociation from HK2 (Fig. 4B ).


Figure 4
View larger version (21K):
[in this window]
[in a new window]

  		Figure 4. ES-induced reduction of HK2 results in VDAC1 up-regulation. A) The protein levels of HK2 and VDAC1 were detected after ES treatment for different times (1, 4, and 12 h). B) pVC1 and the empty vectors were transfected in HMECs and then were treated with ES if required. After 24 h treatment, cells were collected and immunoprecipitation assay was performed. Different bands were separately detected with antibodies against HK2, VDAC1, and Bax. C) Two kinds of synthetic siRNA targeting HK2 (siHK2a, siHK2b) were transfected in HMECs, and the protein and mRNA levels of HK2 were separately measured by Western blot analysis and RT-PCR after 24 h. β-actin and GAPDH were loaded as controls, respectively. D) Elevation of ES-induced caspase-9 activation was detected in HK2 silenced cells. Data are means of 3 independent experiments. E) After transfection of siRNA targeting HK2, released ROS (green) was examined in HK2-silenced HMECs in the presence of 10% FCS. Vehicle, nontransfected endothelial cells. Scale bar = 50 µm. F) The protein levels of HK2 and VDAC1 were analyzed in the HK2-silenced HMECs after ES treatment. β-actin was loaded as a control.

HK2 catalyzes the first committed step in glycolysis (28) . Considering that endothelial cells are surrounded by a hypoxic microenvironment in vivo, we wondered whether HK2 was an important molecule in regulating endothelial cell survival. To investigate the role of HK2, we examined the apoptotic effect of HK2 knockdown on endothelial cells. The HK2-specific siRNA efficiently silenced its expression (Fig. 4C ) and quenched the endothelial cell proliferation (see Supplemental Data). In addition, ES-induced apoptosis was elevated in HK2 knockdown endothelial cells, concomitant with a significantly enhanced activation of caspase-9 (Fig. 4D ). These observations were further corroborated by increased ROS production in HK2-silenced endothelial cells (Fig. 4E ). ROS elevation is an important signal to promote the mPTP opening. Because we have observed that ROS elevated in VDAC1 overexpressed endothelial cells (Fig. 3G ), we were curious whether VDAC1 was affected by HK2 reduction. Interestingly, we observed that the protein level of VDAC1 increased after knocking down HK2 in endothelial cells (Fig. 4F ).

Up-regulation of VDAC1 is due to its phosphorylation
HK2 inhibits the translocation of Bax to the mitochondria (31) . In our investigation, Bax was identified to be associated with VDAC1 on ES treatment, and this kind of association was promoted in VDAC1-overexpressed endothelial cells (Fig. 4B ). These results suggest that HK2 and Bax probably compete to bind VDAC1 on the outer membrane of mitochondria. HK2 was reported to modulate phosphorylation of VDAC, potentially through glycogen synthase kinase 3β (GSK3β) or protein kinase C (PKC) (32 , 33) . In addition, the E72Q mutant of VDAC1, which lost the HK2 binding activity, was reported to impair the increased total protein level of VDAC1 on exposure to RuR in 293T cells (24) . We thus wondered whether reduction of HK2 could lead to the phosphorylation of VDAC1, which eventually results in VDAC1 up-regulation. To answer this question, we performed two-dimensional electrophoresis to separate VDAC1 in ES-treated endothelial cells and detected it with specific VDAC1 monoclonal antibody. It was clearly shown that VDAC1 was enriched in the acidic side of two-dimensional electrophoresis, suggesting the potential increase in VDAC1 phosphorylation (Fig. 5 A). Since several serine residues were reported to be the potential phosphorylation sites on VDAC1, we thus performed an immunoprecipitation assay to directly detect ES-induced VDAC1 phosphorylation with monoclonal antibody against phosphorylated serine residues. It was observed that phosphorylation of VDAC1 was enhanced after ES treatment (Fig. 5B ). These results supported our hypothesis that ES could promote VDAC1 phosphorylation.


Figure 5
View larger version (23K):
[in this window]
[in a new window]

  		Figure 5. Up-regulation of VDAC1 is due to its phosphorylation. A) ES-treated endothelial cell samples were first run on two-dimensional electrophoresis, electroblotted onto nitrocellulose membranes, and subsequently probed with VDAC1 monoclonal antibody. Arrows indicate the postmodification of VDAC1. B) Detection of VDAC1 phosphorylation. The whole-cell lysate samples were immunoprecipitated with rabbit polyclonal antibody against VDAC1, electroblotted onto nitrocellulose membranes, and then probed with an anti-phosphoserine monoclonal antibody. bFGF-treated sample was input as a negative control. C) The inhibitory degradation of VDAC1 mutant protein levels was indicated by probing VDAC1 protein levels in the presence of MG132. Two VDAC1 mutants, S12A and S103A, were constructed in pcDNA3.1 vector and transfected in 293T cells. After 24 h, cells were treated with MG132 before immunoblotting assay. D) S12A and S103A were transfected in HMECs for 24 h before ES treatment. The protein levels of VDAC1 were detected with anti-VDAC1 monoclonal antibody. WT, wild-type VDAC1 (pVC1). E) ES-induced mPTP opening was detected in HMECs, which were transfected with the empty, pVC1, S12A, and S103A vectors. Inhibition of ES-induced mPTP opening was indicated by the elevation of mitochondrial calcein fluorescent signal (green). F) Inhibition of ES-induced endothelial cell apoptosis was shown by the impaired caspase-3 activation. HMECs were transfected with empty, pVC1, S12A, and S103A vectors, and then treated with ES for 24 h before detection with the caspase-3 cleavage activity assay kit.

To further investigate the phosphorylated sites of VDAC1, we constructed a series of VDAC1 mutants, which disturbed the potential serine phosphorylation on VDAC1. These mutants, including S12A, S103A, and S136A, were transfected into 293T cells, and their protein levels were detected by immunoblotting assay. Two VDAC1 mutants, S12A and S103A, could effectively reduce the protein level of VDAC1 (Fig. 5C ). These results indicate that dephosphorylation of VDAC1 may impair its protein level elevation. In agreement with the findings of Zaid and his colleagues (24) , there might be some degradation-related mechanisms to VDAC1 overexpression. Our results here showed that reduction of S12A and S103A protein level was inhibited by MG132, a well-known proteasome inhibitor (Fig. 5C ). Because phosphorylation of a specific protein could prevent the protease-mediated degradation, our results indicate that phosphorylation of VDAC1 probably impairs its degradation, which leads to VDAC1 accumulation on ES treatment.

We then measured the function of S12A and S103A in endothelial cells. The S12A and S103A mutants could attenuate ES-induced up-regulation of VDAC1 protein level in endothelial cells (Fig. 5D ), which implied that ES-induced VDAC1 up-regulation might result from its phosphorylation. We further examined the effects of S12A and S103A on ES-induced apoptosis process. S12A and S103A were both observed to abolish ES-induced mPTP opening (Fig. 5E ) and caspase-3 activation in endothelial cells (Fig. 5F ), which further confirmed our hypothesis that ES could affect VDAC1 phosphorylation and accumulation.

Though the detailed mechanism of VDAC1 in modulating ES-induced apoptosis needs further investigation, our results here reveal a novel mechanism of ES-induced endothelial cell apoptosis through VDAC1 up-regulation, and provide insight for further understanding of the mechanisms of angiogenesis inhibitors such as ES.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
As one of the most powerful endogenous angiogenesis inhibitors, ES has potent therapeutic effects on several types of tumors in clinical studies (34) . However, the detailed molecular mechanism of ES-induced endothelial cell apoptosis is still controversial and needs further investigation. In the present study, we have elucidated the mechanism of ES-induced endothelial cell apoptosis. First, we observed that certain mitochondria-related apoptotic signaling events occurred after ES treatment, which confirmed the previous reports that ES triggers apoptosis in endothelial cells. Second, we demonstrated that ES promoted the opening of mPTP and up-regulation of VDAC1. More specifically, ES-induced VDAC1 up-regulation enhanced endothelial cell apoptosis, leading to tumor angiogenesis inhibition. This is the first time that the antiangiogenesis function of ES links to the mitochondrial permeability in the apoptotic process. Third, ES was determined to affect an essential glycolytic enzyme, HK2, in endothelial cells, and up-regulation of VDAC1 was validated to be the result of HK2 reduction, which promoted the phosphorylation of VDAC1. These results elucidate the role of glycolytic proteins in regulating angiogenesis, may also have implications in the treatment of antiangiogenic cancer therapies in the future. Finally, we found that amino acid residues Ser-12 and Ser-103 in VDAC1 were the phosphorylation sites on ES treatment, which shed light on further understanding of the mechanism of VDAC1 on regulating apoptosis.

Apoptosis occurs mainly through two different pathways: the death receptor-mediated extrinsic and the mitochondria-mediated intrinsic pathways. Our investigation has confirmed that ES-induced apoptosis is via the mitochondria-mediated intrinsic pathway with the mPTP opening on the mitochondrial membrane and the release of cytochrome c to the cytoplasm. Consistent with the previous finding that the mPTP opening in proliferating endothelial cells shows higher sensitivity to angiogenesis inhibitor than in quiescent endothelial cells (35) , our results show that pretreatment with bFGF enhances the sensitivity of endothelial cells to ES (data not shown). Moreover, pretreatment with two mPTP opening inhibitors, BA and CsA, can significantly impair the apoptotic effect of ES. Though we cannot exclude the possibility that BA or CsA interferes with other intracellular proteins, inhibition of caspase-9 activation by these two mPTP inhibitors here confirms that ES-induced apoptosis is related to endothelial cell mPTP opening.

Although VDAC proteins were reported to be dispensable for Ca2+- and oxidative stress-induced mPTP opening (36) , a variety of apoptosis stimuli can trigger apoptosis by modulation of VDAC. For example, Chen and colleagues (26) reported that arsenic trioxide (As2O3) directly induced cytochrome c release from isolated mouse liver mitochondria via mPTP opening and VDAC is the target. In addition, oxidative stress-induced apoptosis can be related to VDAC in smooth muscle and endothelial cells (37) . In the present study, we elucidate that VDAC1 is an indispensable protein, which modulates ES-induced apoptosis in endothelial cells. We determined that knocking down VDAC1 in endothelial cells impairs ES-induced apoptosis, whereas overexpression of extraneous VDAC1 results in enhanced sensitivity of endothelial cells to ES. To further investigate the mPTP opening in modulating ES-induced apoptosis, more studies may be performed on other mPTP component-deficient endothelial cells, such as CypD and ANT.

Bcl-2 family proteins, such as Bax and Bcl-xL, have been reported to form complexes with VDAC1 in the formation of mPTP (22) . In our experiments, we observed that ES promoted the translocation of Bax to the mitochondria and enhanced the interaction with VDAC1, which possibly resulted in mPTP opening. Our group recently reported that ES can be translocated to endothelial cell nuclei via nucleolin, inhibiting the proliferation of endothelial cells (38) ; it is thus reasonable that ES might regulate transcription factors in nuclei to modulate the expression level of Bax, resulting in its accumulation in the mitochondria and the association with VDAC1.

HK2 is another important VDAC1 binding protein that can inhibit apoptosis. Experiments with reconstituted mPTPs in vitro indicate that the association of HK2 with VDAC1 may mediate mPTP opening. Our results show that ES-induced HK2 reduction is correlated with endothelial cell apoptosis, because increased apoptosis rate, caspase-9 activation, and ROS release were observed in HK2-silenced endothelial cells. Reduction of HK2 could also explain how ES regulates the apoptotic process in endothelial cells, because silencing of HK2 elevates the expression level of VDAC1 and sensitizes endothelial cells to ES treatment.

It was reported that HIF-1{alpha} can promote tumor angiogenesis under the hypoxic microenvironment (39) . HIF-1{alpha}, up-regulated by hypoxic stress, plays an important role in regulating the transcription of the glycolytic enzymes in tumor and endothelial cells. Since HK2 can be regulated by HIF-1{alpha} (30) , and ES can suppress the expression of HIF-1{alpha}, it is reasonable that ES possibly reduces the expression of HK2 through HIF-1{alpha} by some unknown mechanism. Cobalt chloride (CoCl2) is known to stabilize HIF-1{alpha} by preventing the effects of VHL protein (40) . We observed that CoCl2 could abolish ES-induced VDAC1 up-regulation (data not shown). These results indicate that the reduction of HK2 can regulate the protein level of VDAC1.

Phosphorylation is believed to play an important role in modulating VDAC1 function. In our study, the two-dimensional gel electrophoresis and immunoprecipitation studies indicate that ES enhances the phosphorylation of VDAC1. There were other reports that phosphorylation of VDAC could modulate its function. For example, Sun et al. (33) , reported that HK2 promotes the phosphorylation of VDAC although it was on a threonine instead of serine residue, consistent with our hypothesis that ES-induced HK2 reduction is related to the phosphorylation of VDAC. VDAC can also be modulated by several other protein kinases with different functions. Banerjee et al. (41) reported that interactions between VDAC with Bax and tBid are attenuated because of phosphorylation of VDAC by cyclic AMP-dependent protein kinase A (PKA). A similar result was reported for the inhibition of cytochrome c release from mitochondria by another kinase, c-Raf (42) . Moreover, PKC{epsilon} can phosphorylate VDAC in vitro to inhibit the mPTP in cardiac mitochondria (43) . On the contrary, Pastorin et al. (32) demonstrated that the phosphorylation of VDAC by GSK3β in vitro promoted apoptosis by triggering HK2 disassociation from mitochondria.

Nevertheless, there have been few reports about the phosphorylation sites of VDAC until now. Hoppel and colleagues (44) reported that two serine residues, Ser-12 and Ser-136, are phosphorylated in VDAC-1 isolated from rat liver. Moreover, Ser-103 is another potential phosphorylation site of VDAC1 (45) . The phosphorylated serine residues involved in our investigation were identified to be Ser-12 and Ser-103. Since the structure of VDAC1 is not resolved yet, these phosphorylated amino acid residues are predicted to be located on the cytosolic side of the mitochondrial outer membrane, accessible to protein kinases in the cytoplasm. For example, Ser-12 is a potential GSK3β modulating site.

Because binding of HK2 to VDAC1 impairs VDAC1’s proapoptotic function, the interaction between HK2 and VDAC1 might therefore bury the phosphorylation sites of VDAC1. We hypothesize that reduction of HK2 probably promotes the exposure of the buried phosphorylated sites to protein kinases, such as GSK3β or others, which leads to VDAC1 phosphorylation. Phosphorylation of VDAC1 may trigger the conformational changes of VDAC1 and inhibit its degradation, resulting in VDAC1 accumulation. Phosphorylation of VDAC1 might also facilitate Bax, tBid, or other mPTP component proteins to interact with VDAC1, which, in turn, promotes mPTP opening and eventually induces cell death. In the present study, results that S12A and S103A can attenuate ES-induced VDAC1 up-regulation, endothelial cell mPTP opening, and apoptosis elicitation confirm our hypothesis.

Besides regulation of cell apoptosis, up-regulation of VDAC1 can have other effects on endothelial cells. VDAC1 is a key determinant of Ca2+ permeability at the ER-mitochondria contact sites. VDAC1 up-regulation can affect the Ca2+ permeability at the ER-mitochondria contact sites, and facilitate the binding between ER and mitochondria and subsequently promote Ca2+ release from the ER (46) . Unlike in other cell types, only less than 4% of mitochondria are close to the ER membrane surface in endothelial cells (16) . VDAC1 up-regulation in endothelial cells therefore might take effect on Ca2+-related proteins and signaling pathways in endothelial cells, such as calmodulin or calcium-dependent kinases. Actually, ES was reported to modulate the cellular Ca2+ concentration (47) , which implies that ES possibly triggers the calcium-related events through VDAC1 up-regulation.

Taken together, results in the present study reveal a novel mechanism of ES-induced endothelial cell apoptosis through mitochondria dysfunction via VDAC1. These observations provide insight for further understanding of the molecular mechanism of antiangiogenic function of ES. Moreover, elucidating the role of VDAC1 in modulating ES-induced endothelial cell apoptosis may also have implications in the future cancer therapies.


   ACKNOWLEDGMENTS
 
We gratefully acknowledge Quan Chen for his critical reading of this manuscript and valuable suggestions. This study was supported by grants from the General Programs of the National Natural Science Foundation of China (30670419 and 30771083), and the State Key Development Program for Basic Research of China (2006CB910305).

Received for publication February 1, 2008. Accepted for publication March 6, 2008.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Folkman, J. (1995) Angiogenesis in cancer, vascular, rheumatoid and other disease. Nat. Med. 1,27-31[CrossRef][Medline]
  2. Hanahan, D., Folkman, J. (1996) Patterns and emerging mechanisms of the angiogenic switch during tumorigenesis. Cell 86,353-364[CrossRef][Medline]
  3. Ferrara, N., Kerbel, R. S. (2005) Angiogenesis as a therapeutic target. Nature 438,967-974[CrossRef][Medline]
  4. O'Reilly, M. S., Boehm, T., Shing, Y., Fukai, N., Vasios, G., Lane, W. S., Flynn, E., Birkhead, J. R., Olsen, B. R., Folkman, J. (1997) Endostatin: an endogenous inhibitor of angiogenesis and tumor growth. Cell 88,277-285[CrossRef][Medline]
  5. Yamaguchi, N., Anand-Apte, B., Lee, M., Sasaki, T., Fukai, N., Shapiro, R., Que, I., Lowik, C., Timpl, R., Olsen, B. R. (1999) Endostatin inhibits VEGF-induced endothelial cell migration and tumor growth independently of zinc binding. EMBO J. 18,4414-4423[CrossRef][Medline]
  6. Shichiri, M., Hirata, Y. (2001) Antiangiogenesis signals by endostatin. FASEB J. 15,1044-1053[Abstract/Free Full Text]
  7. Dhanabal, M., Ramchandran, R., Waterman, M. J., Lu, H., Knebelmann, B., Segal, M., Sukhatme, V. P. (1999) Endostatin induces endothelial cell apoptosis. J. Biol. Chem. 274,11721-11726[Abstract/Free Full Text]
  8. Addison, C. L., Nor, J. E., Zhao, H., Linn, S. A., Polverini, P. J., Delaney, C. E. (2005) The response of VEGF-stimulated endothelial cells to angiostatic molecules is substrate-dependent [Online]. BMC Cell Biol. 6,38[CrossRef][Medline]
  9. Kang, H. Y., Shim, D., Kang, S. S., Chang, S. I., Kim, H. Y. (2006) Protein kinase B inhibits endostatin-induced apoptosis in HUVECs. J. Biochem. Mol. Biol. 39,97-104[Medline]
  10. Dixelius, J., Larsson, H., Sasaki, T., Holmqvist, K., Lu, L., Engstrom, A., Timpl, R., Welsh, M., Claesson-Welsh, L. (2000) Endostatin-induced tyrosine kinase signaling through the Shb adaptor protein regulates endothelial cell apoptosis. Blood 95,3403-3411[Abstract/Free Full Text]
  11. Abdollahi, A., Hahnfeldt, P., Maercker, C., Grone, H. J., Debus, J., Ansorge, W., Folkman, J., Hlatky, L., Huber, P. E. (2004) Endostatin’s antiangiogenic signaling network. Mol. Cell 13,649-663[CrossRef][Medline]
  12. Skovseth, D. K., Veuger, M. J., Sorensen, D. R., De Angelis, P. M., Haraldsen, G. (2005) Endostatin dramatically inhibits endothelial cell migration, vascular morphogenesis, and perivascular cell recruitment in vivo. Blood 105,1044-1051[Abstract/Free Full Text]
  13. Khan, Z. A., Melero-Martin, J. M., Wu, X., Paruchuri, S., Boscolo, E., Mulliken, J. B., Bischoff, J. (2006) Endothelial progenitor cells from infantile hemangioma and umbilical cord blood display unique cellular responses to endostatin. Blood 108,915-921[Abstract/Free Full Text]
  14. Kroemer, G., Reed, J. C. (2000) Mitochondrial control of cell death. Nat. Med. 6,513-519[CrossRef][Medline]
  15. Jacotot, E., Costantini, P., Laboureau, E., Zamzami, N., Susin, S. A., Kroemer, G. (1999) Mitochondrial membrane permeabilization during the apoptotic process. Ann. N. Y. Acad. Sci. 887,18-30[CrossRef][Medline]
  16. Davidson, S. M., Duchen, M. R. (2007) Endothelial mitochondria: contributing to vascular function and disease. Circ. Res. 100,1128-1141[Abstract/Free Full Text]
  17. Marchetti, P., Castedo, M., Susin, S. A., Zamzami, N., Hirsch, T., Macho, A., Haeffner, A., Hirsch, F., Geuskens, M., Kroemer, G. (1996) Mitochondrial permeability transition is a central coordinating event of apoptosis. J. Exp. Med. 184,1155-1160[Abstract/Free Full Text]
  18. Walter, D. H., Haendeler, J., Galle, J., Zeiher, A. M., Dimmeler, S. (1998) Cyclosporin A inhibits apoptosis of human endothelial cells by preventing release of cytochrome C from mitochondria. Circulation 98,1153-1157[Abstract/Free Full Text]
  19. Vander Heiden, M. G., Chandel, N. S., Li, X. X., Schumacker, P. T., Colombini, M., Thompson, C. B. (2000) Outer mitochondrial membrane permeability can regulate coupled respiration and cell survival. Proc. Natl. Acad. Sci. U. S. A. 97,4666-4671[Abstract/Free Full Text]
  20. Crompton, M., Virji, S., Ward, J. M. (1998) Cyclophilin D binds strongly to complexes of the voltage-dependent anion channel and the adenine nucleotide translocase to form the permeability transition pore. Eur. J. Biochem. 258,729-735[Medline]
  21. Vieira, H. L., Haouzi, D., El Hamel, C., Jacotot, E., Belzacq, A. S., Brenner, C., Kroemer, G. (2000) Permeabilization of the mitochondrial inner membrane during apoptosis: impact of the adenine nucleotide translocator. Cell Death Differ. 7,1146-1154[CrossRef][Medline]
  22. Tsujimoto, Y., Shimizu, S. (2000) VDAC regulation by the Bcl-2 family of proteins. Cell Death Differ. 7,1174-1181[CrossRef][Medline]
  23. Adachi, M., Higuchi, H., Miura, S., Azuma, T., Inokuchi, S., Saito, H., Kato, S., Ishii, H. (2004) Bax interacts with the voltage-dependent anion channel and mediates ethanol-induced apoptosis in rat hepatocytes. Am. J. Physiol. Gastrointest. Liver Physiol. 287,G695-G705[Abstract/Free Full Text]
  24. Zaid, H., Abu-Hamad, S., Israelson, A., Nathan, I., Shoshan-Barmatz, V. (2005) The voltage-dependent anion channel-1 modulates apoptotic cell death. Cell Death Differ. 12,751-760[CrossRef][Medline]
  25. Shimizu, S., Matsuoka, Y., Shinohara, Y., Yoneda, Y., Tsujimoto, Y. (2001) Essential role of voltage-dependent anion channel in various forms of apoptosis in mammalian cells. J. Cell Biol. 152,237-250[Abstract/Free Full Text]
  26. Zheng, Y., Shi, Y., Tian, C., Jiang, C., Jin, H., Chen, J., Almasan, A., Tang, H., Chen, Q. (2004) Essential role of the voltage-dependent anion channel (VDAC) in mitochondrial permeability transition pore opening and cytochrome c release induced by arsenic trioxide. Oncogene 23,1239-1247[CrossRef][Medline]
  27. Abu-Hamad, S., Sivan, S., Shoshan-Barmatz, V. (2006) The expression level of the voltage-dependent anion channel controls life and death of the cell. Proc. Natl. Acad. Sci. U. S. A. 103,5787-5792[Abstract/Free Full Text]
  28. Pastorino, J. G., Hoek, J. B. (2003) Hexokinase II: the integration of energy metabolism and control of apoptosis. Curr. Med. Chem. 10,1535-1551[CrossRef][Medline]
  29. Yasuda, S., Arii, S., Mori, A., Isobe, N., Yang, W., Oe, H., Fujimoto, A., Yonenaga, Y., Sakashita, H., Imamura, M. (2004) Hexokinase II and VEGF expression in liver tumors: correlation with hypoxia-inducible factor 1 alpha and its significance. J. Hepatol. 40,117-123[Medline]
  30. Kim, J. W., Gao, P., Liu, Y. C., Semenza, G. L., Dang, C. V. (2007) Hypoxia-inducible factor 1 and dysregulated c-Myc cooperatively induce vascular endothelial growth factor and metabolic switches hexokinase 2 and pyruvate dehydrogenase kinase 1. Mol. Cell. Biol. 27,7381-7393[Abstract/Free Full Text]
  31. Pastorino, J. G., Shulga, N., Hoek, J. B. (2002) Mitochondrial binding of hexokinase II inhibits Bax-induced cytochrome c release and apoptosis. J. Biol. Chem. 277,7610-7618[Abstract/Free Full Text]
  32. Pastorino, J. G., Hoek, J. B., Shulga, N. (2005) Activation of glycogen synthase kinase 3beta disrupts the binding of hexokinase II to mitochondria by phosphorylating voltage-dependent anion channel and potentiates chemotherapy-induced cytotoxicity. Cancer Res. 65,10545-10554[Abstract/Free Full Text]
  33. Sun, L., Shukair, S., Naik, T. J., Moazed, F., Ardehali, H. (2008) Glucose phosphorylation and mitochondrial binding are required for the protective effects of hexokinase I and II. Mol. Cell. Biol. 28,1007-1017[Abstract/Free Full Text]
  34. Folkman, J. (2006) Antiangiogenesis in cancer therapy-endostatin and its mechanisms of action. Exp. Cell Res. 312,594-607[CrossRef][Medline]
  35. Don, A. S., Kisker, O., Dilda, P., Donoghue, N., Zhao, X., Decollogne, S., Creighton, B., Flynn, E., Folkman, J., Hogg, P. J. (2003) A peptide trivalent arsenical inhibits tumor angiogenesis by perturbing mitochondrial function in angiogenic endothelial cells. Cancer Cell 3,497-509[CrossRef][Medline]
  36. Baines, C. P., Kaiser, R. A., Sheiko, T., Craigen, W. J., Molkentin, J. D. (2007) Voltage-dependent anion channels are dispensable for mitochondrial-dependent cell death. Nat. Cell Biol. 9,487-489[CrossRef][Medline]
  37. Irani, K. (2000) Oxidant signaling in vascular cell growth, death, and survival: a review of the roles of reactive oxygen species in smooth muscle and endothelial cell mitogenic and apoptotic signaling. Circ. Res. 87,179-183[Abstract/Free Full Text]
  38. Shi, H., Huang, Y., Zhou, H., Song, X., Yuan, S., Fu, Y., Luo, Y. (2007) Nucleolin is a receptor that mediates antiangiogenic and antitumor activity of endostatin. Blood 110,2899-2906[Abstract/Free Full Text]
  39. Carmeliet, P., Dor, Y., Herbert, J. M., Fukumura, D., Brusselmans, K., Dewerchin, M., Neeman, M., Bono, F., Abramovitch, R., Maxwell, P., Koch, C. J., Ratcliffe, P., Moons, L., Jain, R. K., Collen, D., Keshert, E. (1998) Role of HIF-1alpha in hypoxia-mediated apoptosis, cell proliferation and tumour angiogenesis. Nature 394,485-490[CrossRef][Medline]
  40. Chan, D. A., Sutphin, P. D., Denko, N. C., Giaccia, A. J. (2002) Role of prolyl hydroxylation in oncogenically stabilized hypoxia-inducible factor-1alpha. J. Biol. Chem. 277,40112-40117[Abstract/Free Full Text]
  41. Banerjee, J., Ghosh, S. (2006) Phosphorylation of rat brain mitochondrial voltage-dependent anion as a potential tool to control leakage of cytochrome c. J. Neurochem. 98,670-676[CrossRef][Medline]
  42. Le Mellay, V., Troppmair, J., Benz, R., Rapp, U. R. (2002) Negative regulation of mitochondrial VDAC channels by C-Raf kinase (Online). BMC Cell Biol. 3,14[CrossRef][Medline]
  43. Baines, C. P., Song, C. X., Zheng, Y. T., Wang, G. W., Zhang, J., Wang, O. L., Guo, Y., Bolli, R., Cardwell, E. M., Ping, P. (2003) Protein kinase C epsilon interacts with and inhibits the permeability transition pore in cardiac mitochondria. Circ. Res. 92,873-880[Abstract/Free Full Text]
  44. Distler, A. M., Kerner, J., Hoppel, C. L. (2007) Post-translational modifications of rat liver mitochondrial outer membrane proteins identified by mass spectrometry. Biochim. Biophys. Acta 1774,628-636[Medline]
  45. Olsen, J. V., Blagoev, B., Gnad, F., Macek, B., Kumar, C., Mortensen, P., Mann, M. (2006) Global, in vivo, and site-specific phosphorylation dynamics in signaling networks. Cell 127,635-648[CrossRef][Medline]
  46. Rapizzi, E., Pinton, P., Szabadkai, G., Wieckowski, M. R., Vandecasteele, G., Baird, G., Tuft, R. A., Fogarty, K. E., Rizzuto, R. (2002) Recombinant expression of the voltage-dependent anion channel enhances the transfer of Ca2+ microdomains to mitochondria. J. Cell Biol. 159,613-624[Abstract/Free Full Text]
  47. Jiang, L., Jha, V., Dhanabal, M., Sukhatme, V. P., Alper, S. L. (2001) Intracellular Ca(2+) signaling in endothelial cells by the angiogenesis inhibitors endostatin and angiostatin. Am. J. Physiol. Cell. Physiol. 280,C1140-C1150[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
Y. Ding, Y. Huang, N. Song, X. Gao, S. Yuan, X. Wang, H. Cai, Y. Fu, and Y. Luo
NFAT1 Mediates Placental Growth Factor-Induced Myelomonocytic Cell Recruitment via the Induction of TNF-{alpha}
J. Immunol., March 1, 2010; 184(5): 2593 - 2601.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
S. Abu-Hamad, N. Arbel, D. Calo, L. Arzoine, A. Israelson, N. Keinan, R. Ben-Romano, O. Friedman, and V. Shoshan-Barmatz
The VDAC1 N-terminus is essential both for apoptosis and the protective effect of anti-apoptotic proteins
J. Cell Sci., June 1, 2009; 122(11): 1906 - 1916.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.08-107417v1
22/8/2809    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Yuan, S.
Right arrow Articles by Luo, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Yuan, S.
Right arrow Articles by Luo, Y.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS