FASEB J. Mp Biomedicals
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published as doi: 10.1096/fj.07-098830.
 (The FASEB Journal. 2008;22:2561-2568.)
© 2008 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.07-098830v1
22/7/2561    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huellner, M. W.
Right arrow Articles by Rau, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huellner, M. W.
Right arrow Articles by Rau, T.

Inhibition of aldehyde dehydrogenase type 2 attenuates vasodilatory action of nitroglycerin in human veins

Martin W. Huellner*, Sonja Schrepfer{dagger}, Michael Weyand§, Henry Weiner, Isabella Wimplinger{ddagger}, Thomas Eschenhagen* and Thomas Rau*,1

* Institute of Experimental and Clinical Pharmacology,

{dagger} Department of Cardiovascular Surgery, and

{ddagger} Institute of Human Genetics, University Medical Center Hamburg-Eppendorf, Germany;

§ Department of Cardiovascular Surgery, Friedrich-Alexander University, Erlangen-Nürnberg, Germany; and

Department of Biochemistry, Purdue University, West Lafayette, Indiana, USA

1Correspondence: Institute of Experimental and Clinical Pharmacology and Toxicology, University Medical Center Hamburg-Eppendorf, Martinistr. 52, Hamburg 20246, Germany. E-mail: t.rau{at}uke.uni-hamburg.de


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Recent studies suggest that the mitochondrial aldehyde dehydrogenase (ALDH)2 is involved in vascular bioactivation of nitroglycerin (GTN). However, neither expression of ALDH2 nor its functional role in GTN bioactivation has been reported for the main drug target in humans, namely capacitance vessels. We investigated whether ALDH2 is expressed in human veins and whether inhibition of the enzyme attenuates nitroglycerin effects in these vessels. We determined expression of ALDH2 and dehydrogenase activity in human veins by reverse transcriptase-polymerase chain reaction, Western blotting, and immunofluorescence microscopy. In vitro contraction experiments were performed in the presence or absence of the ALDH inhibitors chloral hydrate, cyanamide, and ethoxycyclopropanol. Concentration response curves were determined for the {alpha}-agonist phenylephrine, nitroglycerin, and the direct NO donor diethylamine NONOate (DEA-NONOate). ALDH2 expression was largely confined to smooth muscle cells as determined by confocal immunofluorescence microscopy. Contractile responses to phenylephrine were unaffected by all ALDH inhibitors tested. In clear contrast, the ALDH inhibitors significantly reduced the potency of nitroglycerin by approximately 1 order of magnitude (P≤0.01). Neither of the inhibitors affected the potency of the direct NO donor DEA-NONOate, which ruled out nonspecific effects on the NO signaling cascade. In human capacitance vessels, ALDH2 is a key enzyme in the biotransformation of the frequently used antianginal drug nitroglycerin.—Huellner, M. W., Schrepfer, S., Weyand, M., Weiner, H., Wimplinger, I., Eschenhagen, T., Rau, T. Inhibition of aldehyde dehydrogenase type 2 attenuates vasodilatory action of nitroglycerin in human veins.


Key Words: nitric oxide • organic nitrates • pharmacodynamics • biotransformation • capacitance vessels


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
THE VASODILATORY AND ANTIANGINAL action of nitroglycerin (GTN) at clinically used concentrations necessitates biotransformation to an active compound, which subsequently stimulates soluble guanylyl cyclase (sGC) (1) . Smooth muscle cells from medium- to large-sized capacitance and conduction vessels are able to bioactivate GTN (2) , in contrast to the endogenous endothelial NOS-catalyzed NO production that occurs largely in the endothelial cell layer (3 4 5) . The main obstacles in the clinical use of organic nitrates are development of tolerance and of endothelial dysfunction (6 , 7) .

The bioactivation of GTN is characterized by the predominant formation of 1,2-glyceryl dinitrate (1,2-GDN) (2 , 8 , 9) . Recently, the mitochondrial enzyme aldehyde dehydrogenase (ALDH)2 has been implicated in the generation of the active compound in nonhuman mammalians (10) . Identified by a combination of biochemical techniques and database search, a protein with the activity to form 1,2-GDN from GTN was purified by biochemical techniques to near homogeneity. By subsequent Edman sequencing and database search, the protein was identified as mitochondrial ALDH (ALDH2; formerly ALDH1, ALDM, or E2). Inhibition of this enzyme by pharmacological compounds attenuated the vasodilatory response to nitroglycerin in mice and other rodents, rabbits, and dogs (10 11 12 13 14 15) .

The effect considered most important for the clinical action of GTN in humans is the relaxation of capacitance vessels, resulting in a reduction of preload with a subsequent reduction of oxygen demand and improvement of myocardial perfusion. At low concentrations, GTN preferentially dilates capacitance and conductance vessels, whereas higher concentrations of GTN are necessary to cause pronounced dilatory effects in resistance vessels (16) .

The aim of this study was to investigate whether ALDH2 is expressed in human veins and whether inhibition of this enzyme by pharmacological inhibitors causes attenuation of the vasodilatory response toward GTN. To rule out nonspecific effects of the inhibitors on either contractile properties of the preparations or on the NO-mediated relaxation, response curves toward phenylephrine and the direct NO donor diethylamine NONOate (DEA-NONOate) were determined as well.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Human veins studied were remnants of vessels used in coronary artery bypass grafting. Patients gave informed consent, and the use of these remnants for scientific purposes was approved by the ethical review board.

Tissue culture
Veins were minced after removal of adherent tissue and of the endothelial cell layer. The resulting small pieces of tissue were placed in Dulbecco modified Eagle medium (DMEM; Invitrogen, Karlsruhe, Germany) supplemented with 10% fetal calf serum, glutamine, and penicillin/streptomycin. For immunofluorescence analysis, cells were grown on poly-L-lysine-coated cover slips.

RNA preparation and RT-PCR
Total RNA was prepared by a commercial RNA-isolation kit (Qiagen, Hilden, Germany). A single-step RT-PCR amplifying the entire coding region of ALDH2 was performed according to manufacturer’s instructions (Qiagen) with gene-specific primers (forward: aattgtcgaccggtccgctcgctgt; reverse: ttctcgagggaggaagcttgcatga). The products were analyzed by agarose gel electrophoresis according to standard protocols (17) and correct amplification verified by sequencing.

Microscopy
Cryosections of veins with 10 µm slice thickness were prepared on a Cryotome (Frigocut 2800; Leica, Bensheim, Germany) after embedding of the veins in OCT cryo mounting medium (Jung-Reichert, Bensheim, Germany). The sections were attached to poly-L-lysine-coated slides, air-dried, fixed in 3% buffered formaldehyde, permeabilized in 0.1% Triton X-100 in PBS, blocked in 20% fetal calf serum in PBS, and subsequently probed with a highly specific, affinity-purified ALDH2 antiserum (18) . The secondary antibody used was an anti-rabbit antibody coupled to Cy3 (Dianova, Hamburg, Germany). Smooth muscle cells were stained by a monoclonal mouse antibody against smooth muscle actin (Sigma, Taufkirchen, Germany). Detection was accomplished by an Alexa488-coupled antiserum (Molecular Probes, Karlsruhe, Germany). Washing steps were performed in PBS. Cells cultivated on cover slips from human vein tissue cultures were processed accordingly. Sections were viewed with a Zeiss LSM 505 Meta confocal microscope (Carl Zeiss, Oberkochen, Germany).

Western blot
Proteins of human veins were extracted after mincing of the tissue. Tissues were homogenized in hypotonic buffer (10 mM Tris-HCl, pH 7.4; 5 mM EDTA; 2 µg/ml aprotinin) with a TeflonTM/glass homogenizator with constant cooling at 0°C. The lysate was cleared by centrifugation at 3000 g for 30 min. Pure erythrocytes were prepared from EDTA-anticoagulated blood by centrifugation and lysed as previously described. Protein concentrations were determined according to Bradford. Proteins were separated under denaturing conditions in 10% polyacrylamide gels (19) . After electrophoresis, proteins were transferred to nitrocellulose membranes and probed for ALDH2 with the aforementioned specific antiserum. The primary antibody was detected by a goat anti-rabbit serum coupled to horseradish peroxidase (Amersham Pharmacia, Freiburg, Germany) with subsequent chemoluminescence (ECL+; Amersham Biosciences Europe GmbH, Freiburg, Germany).

Activity assay
Aldehyde dehydrogenase activity was measured by photometry at 340 nm to monitor NADH formation. Photometric readings were done in 20 s intervals over a total assay time of 20 min. The reaction was performed in sodium pyrophosphate buffer (50 mM, pH 8.8; 1 mM NAD+) with 120 µg protein at ambient temperature with propanal at a final concentration of 1 mM. To compensate for endogenous processes generating NADH, control readings were made in the absence of propanal. The specific activity was determined by subtracting background activity from the activity in the presence of propanal and expressed as activity (mol x min–1 x mg protein–1). Chemicals used in the activity assay were obtained from Sigma or Fluka (Steinheim, Germany).

Contraction experiments
Veins of 5–7 mm diameter were sliced into rings of 3 mm width in carbogen-bubbled Krebs-Henseleit’s solution. To prevent interactions with the medications applied before and during the bypass operation, rings were kept overnight in DMEM in an incubator (37°C; 5% CO2). The next day, rings were transferred onto stainless steel hooks and mounted in thermostated organ baths equipped with magnetic isometric force transducers. Measurements were performed at 37°C under continuous gassing with carbogen. Force data were transmitted to a personal computer equipped with a scientific registration program (BeMon; Jäckel, Hanau, Germany). First, the veins were left to equilibrate in the presence or absence of ALDH inhibitors for 45 min. During this period, veins were slowly stretched until a stable isometric force of ~4.5 mN was reached. Subsequently, a cumulative concentration response curve toward the {alpha}-agonist phenylephrine (3.6x10–8 to 1.1x10–4 M) was carried out. After these measurements, phenylephrine was washed out, and the ALDH inhibitors were immediately reinstituted. Veins were submaximally contracted by adjusting the phenylephrine concentration to 1 x 10–6 M. The tension was adjusted to ~5.5 mN by careful stretching. The veins were left to equilibrate until a stable plateau was reached. Next, a response curve to nitroglycerin (1.1x10–10 to 1.5x10–5 M) was carried out. After 2 changes of Krebs-Henseleit’s solution and reinstitution of the ALDH inhibitors, veins were again precontracted with phenylephrine and stretched until a stable tension of 5.5 mN was maintained. The final concentration curve was determined for the short-lived spontaneous NO liberator DEA-NONOate (3.6x10–9 to 1.1x10–5 M). Phenylephrine and DEA-NONOate were obtained from Sigma (Deisenhofen, Germany), and GTN (Aquotrinitrosan®) was obtained from Merck (Darmstadt, Germany). Chloral hydrate (CHL) was purchased from Fluka (München, Germany), and cyanamide (CYA) was from Aldrich (München, Germany). Ethoxycyclopropanol (ECP) was synthesized by methanol lysis of 1-ethoxycyclopropoxytrimethylsilan (Fluka, München, Germany) according to previously published methods (20 , 21) . Identity of the substance was confirmed by IR-spectroscopy and 1H-NMR-spectroscopy in deuterated chloroform (data not shown). ECP is an analog of aminocyclopropanol, the active principle of the mushroom poison coprine. This poison causes a well-known antabus syndrome after ingestion of the inky cap mushroom (Coprinus atramentarius) in combination with alcohol.

Statistics and calculations
Characteristics of the concentration response curves were determined by nonlinear regression with GraphPadPrism (v. 4.0; GraphPad Software, San Diego, CA, USA). Comparisons between curves were performed by F-tests. Significance was assumed at P ≤ 0.05.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Expression of ALDH2
RT-PCR with subsequent sequencing revealed the presence of full-length ALDH2 transcript in human veins (Fig. 1 A). Accordingly, the protein was detected at the expected molecular weight with an ALDH2-specific antiserum by Western blot (Fig. 1B ). The antibody did not react with the ubiquitously expressed cytosolic isoform ALDH1, as revealed by blotting of erythrocyte proteins.


Figure 1
View larger version (26K):
[in this window]
[in a new window]

  		Figure 1. Expression of ALDH2. A) RT-PCR. ALDH2-specific single-step RT-PCR of 20 ng total RNA isolated from human veins. The RT-PCR product encompasses the entire coding region of the transcript. B) Western blot. Immunoblot of human vein and erythrocyte proteins (20 µg). The antibody is specific for ALDH2 because it does not react with the ubiquitously expressed ALDH1, which is, for example, expressed in red blood cells (Rbc).

Immunofluorescence of vein sections demonstrated expression of ALDH2, which was essentially confined to cells staining strongly positive for smooth muscle actin (Fig. 2 A). The staining pattern was clearly granular to filamentous at higher magnification in accordance with the known mitochondrial expression of ALDH2. This staining pattern was maintained in tissue culture (Fig. 2B ), albeit in the cultured cells expression was detectable also in cells with a fibroblastoid appearance.


Figure 2
View larger version (62K):
[in this window]
[in a new window]

  		Figure 2. Double immunofluorescence for smooth muscle actin (SMA; green) and ALDH2 (red). A) Human vein cryosections. B) Human vein tissue culture. In human veins, expression is largely confined to smooth muscle actin-positive cells. Cultured human vein cells retain ALDH2 expression. The signal is filamentous to granular because of the mitochondrial expression of the protein. In the cultured cells, ALDH2 is expressed in cells staining strongly and weakly positive for smooth muscle actin.

A coupled optical-enzymatic test was performed at the pH optimum for ALDH2 with propanal as substrate to determine aldehyde dehydrogenase activity in human vein lysates. The reaction resulted in a linear formation of NADH over time. Control reactions in the absence of propanal exhibited no NADH formation. The total aldehyde dehdyrogenase activity in the homogenates was determined at 0.88 ± 0.04 nmol x min–1 x mg protein–1 (n=5).

Contraction experiments
In the contraction experiments, we first characterized the contractile properties of the vein preparations and assessed nonspecific effects exerted by the ALDH2 inhibitors. At maximally used concentrations, the {alpha}-agonist phenylephrine evoked tensions that were 1.5- to 2-fold that of the adjusted starting tensions (~4.5 mN). Neither of the ALDH2 inhibitors affected potency nor efficacy of the phenylephrine concentration response curves to a significant extent (CHL, Fig. 3 A, B; CYA, Fig. 4 A, B). Thus, nonspecific effects of the inhibitors on {alpha}-agonist-induced contractions were not detectable.


Figure 3
View larger version (21K):
[in this window]
[in a new window]

  		Figure 3. Isometric tension of human vein preparations in the absence (Ctr) or presence of the ALDH inhibitor CHL (0.36 and 1 mM) A, B) Concentration response curves for the {alpha}-agonist phenylephrine (A, raw data; B, normalized). The EC50 for phenylephrine was not altered in the presence of CHL (P=0.99). C, D) Concentration response curves toward GTN. In controls, the EC50 was determined at 19 nM. In CHL-treated preparations, the EC50 values were determined at 258 nM and 160 nM on incubation with 1 mM and 0.36 mM CHL, respectively (P=0.01). The EC50 values for the 0.36 and 1 mM CHL conditions did not differ significantly (P=0.85). E, F) Concentration response curves toward DEA-NONOate. CHL did not alter the potency of this direct NO donor (P=0.56). The response curves were almost superimposed. Means ± SE are shown.


Figure 4
View larger version (19K):
[in this window]
[in a new window]

  		Figure 4. Isometric tension of human vein preparations in the absence (Ctr) or presence of the ALDH inhibitor CYA (200 µM). A, B) Concentration response curves (raw and normalized) for the {alpha}-agonist phenylephrine. CYA did not alter the EC50 for phenylephrine (P=0.98). C, D) Concentration response curves toward GTN. The EC50 was determined at 29 nM in controls. Incubation with CYA significantly increased the EC50 value to 186 nM (P=0.006). E, F) CYA did not alter the dilatory response toward DEA-NONOate (P=0.81). Means ± SE are shown.

In the second step of the contraction experiments, we investigated the dilatory response to GTN after submaximal contraction of the veins by 1.0 µM phenylephrine. This phenylephrine concentration was chosen because, at higher concentrations of the {alpha}-agonist, dilatory responses of the veins to vasodilators were often transient in nature, which complicated analysis. In contrast to the lack of effects of the ALDH2 inhibitors on phenylephrine-evoked contraction, all investigated ALDH2 inhibitors (CHL, CYA, and ECP) caused a significant rightward shift of the concentration response curves to GTN (Figs. 3C, D and 4C, D ). CHL and CYA caused an increase in the EC50 by 1 order of magnitude. At the highest GTN concentration used, the maximum effect after inhibition with CYA appeared to be attenuated; however, this difference was not statistically significant (P=0.16).

In accordance with the findings on ALDH2 inhibition with CHL and CYA, ECP caused an increase in the EC50 of GTN from 22 nM in controls to 99 nM (P=0.025; n=13 in each group; data not shown). The phenylephrine response was not altered by ECP.

To investigate whether attenuation of the efficacy of GTN was caused by effects of the ALDH2-inhibitors on downstream signaling in the NO cascade, concentration response curves were determined for DEA-NONOate (Figs. 3E, F and 4E, F ). CHL and CYA did not alter potency or efficacy of DEA-NONOate to evoke dilation of the vein preparations. In accordance, ECP did not alter the potency of DEA-NONOate, which was determined at 2.9 x 10–7 M in controls and at 3.8 x 10–7 M in ECP-treated preparations, respectively (P=0.71). On ECP challenge, a slight reduction in the maximal DEA-NONOate response was observed, which reached statistical significance. On maximal relaxation by NONOate, tensions were at 4.87 ± 0.05 mN in controls and at 5.05 ± 0.04 mN in ECP-treated veins (P=0.018), suggesting a minor nonspecific effect on the efficacy of DEA-NONOate.

Taken together, all 3 ALDH2 inhibitors investigated caused a significant reduction of the potency of GTN to dilate human capacitance vessels but left the potency of DEA-NONOate unaffected.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The data obtained in the present study are in line with previous observations on the central role of ALDH2 in the dilation of conduction vessels in nonhuman mammals (10 , 12 13 14 15 , 22) . To our best knowledge, our data for the first time demonstrate the expression of ALDH2 mRNA, protein, and activity in human capacitance vessels.

Protein extracts of human veins exhibited an aldehyde dehydrogenase activity of 0.88 nmol x min–1 x mg–1 as detected by the formation of NADH with 1 mM propanal as substrate. Values obtained under similar experimental conditions for rabbit aorta (0.44 nmolxmin–1xmg–1) (10) and canine aorta (2.8 nmolxmin–1xmg–1) (12) are in the same order of magnitude as our results. Protein expression of ALDH2 was demonstrated by an antiserum highly specific for ALDH2, which does not cross-react with the ubiquitously expressed ALDH1 isoform. In intact human veins, ALDH2 was predominantly expressed in smooth muscle cells as determined by confocal immunofluorescence microscopy. This finding is in accordance with the observations that smooth muscle cells are able to form the active metabolite of GTN (2) .

We studied the functional role of ALDH2 in bioactivation of GTN by applying 3 chemically diverse inhibitors of aldehyde dehydrogenase, namely CHL, the ALDH2-preferential inhibitor CYA, and ECP (an analog of the antabus-causing mushroom poison coprine). All 3 inhibitors shifted the GTN concentration response curve significantly to the right and thus reduced the potency of GTN to evoke dilation of precontracted human veins. Notably, however, none of these compounds altered the potencies of phenylephrine or DEA-NONOate. The unaltered phenylephrine response ruled out nonspecific effects on the contractile properties of the vein preparations. Importantly, the unchanged response toward the direct NO donor DEA-NONOate excluded downstream effects on NO-mediated vasodilation (e.g., inhibition of guanylyl cyclase). These observations are in line with functional data obtained by pharmacological inhibition of ALDH2 in other mammals. Inhibition of ALDH2 with CHL or CYA diminished the potency of GTN to a similar extent in isolated rabbit (10) and rat aorta (13 , 14) . In accordance, GTN-concentration response curves are shifted to the right in ALDH2 knockout mice (11 , 23) . In a canine in vivo model, pharmacological inhibition of ALDH2 attenuated the potency of GTN to stimulate coronary blood flow (12) . Recently, 2 studies (24 , 25) were published that support a role of ALDH2 for GTN biotransformation in humans. Disulfiram diminished the GTN-induced increase in human forearm blood flow, an effect-dependent dilation of resistance vessels (24) . Moreover, the naturally occurring ALDH2 504Lys-variant, which causes an inherited dominant alcohol intolerance syndrome, appears to be associated with reduced clinical efficacy of GTN. The variant enzyme has a doubled Km value for GTN, and the maximal turnover rate is diminished by 80% (24 , 25) . These findings and our data argue for a clinically relevant interaction between antabus-causing drugs (e.g., disulfiram, CHL, and CYA) and GTN. These interactions are likely to cause a reduction of clinical efficacy of GTN. The question of whether nitroglycerin or other organic nitrates cause an antabus syndrome has been previously addressed. Organic nitrates are clearly able to inhibit aldehyde dehydrogenases with a moderately high to high potency. However, clinically overt antabus effects are rarely observed (26 , 27) . To our best knowledge, this discrepancy has not been addressed experimentally. The liver is the major organ involved in the metabolic elimination of alcohol. Thus, it is tempting to speculate that other metabolic pathways contribute significantly to the elimination of organic nitrates in this organ. By their actions, these enzymes might protect the liver ALDH2 from an inhibition by organic nitrates. This hypothesis is supported by the fact that the liver does not show a preferential production of 1,2-GDN after GTN-challenge, which suggests a mode of GTN metabolism different from that present in vessels.

Notably, there is no complete loss of activity of the vasodilatory action of GTN after, presumably, complete pharmacological inhibition of ALDH2 or in ALDH2 knockout mice. Under both conditions, there appears to be an alternative biochemical pathway (high-Km pathway) generating a bioactive principle of GTN at a higher concentration of the drug (10 , 22) . Additionally, at very high, clinically irrelevant concentrations, GTN is able to directly stimulate sGC (28) . However, this process does not involve the physiologically observed formation of ferrous heme-NO species. Thus, this mechanism is a nontypical mode of sGC activation. The high-Km pathway is characterized by a loss of the preferential generation of 1,2-GDN over 1,3-GDN (10 , 11) .

The nature of the active metabolite of GTN at low concentrations remains puzzling. It has been proposed that nitrite formed within the cell may be reduced to NO (2) . Several enzymes have been suggested as capable of catalyzing this reduction, including cytochromes, cytochrome oxidases, and xanthin oxidase (29 30 31 32 33 34 35) . Whatever enzymes may be principally capable of facilitating nitrite reduction, the Km of many enzymes suggested is too high in comparison to the low EC50 of GTN. Moreover, recent findings suggest that NO itself may not be the active principle of GTN at clinically relevant concentrations. A study by Münzel et al. (36) did not detect any NO formation at low, clinically relevant concentrations of GTN with the sensitive EPR spin-trapping methodology. In line with these findings, in cells challenged with GTN, NO was undetectable by the NO-sensitive fluorochrome diaminorhodamine-4M (37) . Thus, it remains to be shown whether the NO produced is very effectively coupled to subsequent pathways, but its amount is too small to be detected by these methods. Alternatively, other unknown compounds (e.g., nitrosothiols) might be formed that subsequently stimulate sGC and thus mediate the biological effects of GTN.

Isolated ALDH2 generates GDN (preferentially 1,2-GDN) and nitrite on incubation with GTN (10) . This reaction is stimulated by NAD. The redox chemistry of the reaction with GTN suggests that the enzyme is transiently oxidized, either by the formation of a sulfenic acid group or a disulfide group likely involving the Cys301 and Cys302 residue in the active center of the enzyme. To close the catalytic cycle and thus restore activity, a reduction of the enzyme appears mandatory to regenerate the free SH groups in the catalytic center. Under experimental conditions, this can be effectively achieved by dithiothreitol (DTT) (22) . In the physiological setting, dihydrolipoic acid is capable of maintaining and restoring the activity of ALDH2 (38) . The latter holds true even after in vivo induction of GTN tolerance in rats. In vitro treatment of vessels from tolerant animals with lipoic acid amide almost completely restored the dilatory efficacy of GTN (38) , suggesting a central role of ALDH2 not only in bioactivation but also in tolerance development toward GTN. Moreover, ALDH2 appears to be a redox-sensitive enzyme, subjected to inactivation not only due to an interaction with GTN but also due to oxidation by reactive oxygen species. The extent of the production of reactive oxygen species differs between different nitrates, and these differences in turn may be related to the extent of ALDH inhibition and tolerance development (38 39 40) .

Notably, the involvement of ALDH2 in bioactivation of organic nitrates is not uniform. Highly nitrated substrates (nitroglycerin and pentaerithrityl tetranitrate) are highly potent (low EC50), and their action is largely dependent on ALDH2. In contrast, organic nitrates with a lower density of NO2 groups (e.g., isosorbide dinitrate) have a lower potency and are independent of ALDH2 (23) . Nevertheless, these compounds are capable of inhibiting ALDH (26 , 27) and thus may contribute to cross-tolerance by inhibition of ALDH.

In conclusion, our data demonstrate that, in human capacitance vessels, ALDH2 is a key enzyme for the biotransformation of the frequently used antianginal drug nitroglycerin.


   ACKNOWLEDGMENTS
 
We are grateful to the cardiac surgeons and the staff of the operating theaters in Hamburg and Erlangen, Germany for their excellent support. We thank the colleagues of the Department of Medicinal Chemistry, Friedrich-Alexander University, Erlangen-Nürnberg, Germany for their help with the analysis of ethoxycyclopropanol. Parts of this work form the doctoral thesis of M.W.H.

Received for publication September 25, 2007. Accepted for publication January 10, 2008.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Murad, F., Mittal, C. K., Arnold, W. P., Katsuki, S., Kimura, H. (1978) Guanylate cyclase: activation by azide, nitro compounds, nitric oxide, and hydroxyl radical and inhibition by hemoglobin and myoglobin. Adv. Cyclic Nucl. Res. 9,145-158[Medline]
  2. Ignarro, L. J., Lippton, H., Edwards, J. C., Baricos, W. H., Hyman, A. L., Kadowitz, P. J., Gruetter, C. A. (1981) Mechanism of vascular smooth muscle relaxation by organic nitrates, nitrites, nitroprusside and nitric oxide: evidence for the involvement of S-nitrosothiols as active intermediates. J. Pharmacol. Exp. Therapeut. 218,739-749[Free Full Text]
  3. Ignarro, L. J., Buga, G. M., Wood, K. S., Byrns, R. E., Chaudhuri, G. (1987) Endothelium-derived relaxing factor produced and released from artery and vein is nitric oxide. Proc. Natl. Acad. Sci. U. S. A. 84,9265-9269[Abstract/Free Full Text]
  4. Palmer, R. M., Ferrige, A. G., Moncada, S. (1987) Nitric oxide release accounts for the biological activity of endothelium-derived relaxing factor. Nature 327,524-526[CrossRef][Medline]
  5. Furchgott, R. F., Zawadzki, J. V. (1980) The obligatory role of endothelial cells in the relaxation of arterial smooth muscle by acetylcholine. Nature 288,373-376[CrossRef][Medline]
  6. Schulz, E., Tsilimingas, N., Rinze, R., Reiter, B., Wendt, M., Oelze, M., Woelken-Weckmuller, S., Walter, U., Reichenspurner, H., Meinertz, T., Munzel, T. (2002) Functional and biochemical analysis of endothelial (dys)function and NO/cGMP signaling in human blood vessels with and without nitroglycerin pretreatment. Circulation 105,1170-1175[Abstract/Free Full Text]
  7. Münzel, T., Daiber, A., Mülsch, A. (2005) Explaining the phenomenon of nitrate tolerance. Circ. Res. 97,618-628[Abstract/Free Full Text]
  8. Brien, J. F., McLaughlin, B. E., Kobus, S. M., Kawamoto, J. H., Nakatsu, K., Marks, G. S. (1988) Mechanism of glyceryl trinitrate-induced vasodilation. I. Relationship between drug biotransformation, tissue cyclic GMP elevation and relaxation of rabbit aorta. J. Pharmacol. Exp. Therapeut. 244,322-327[Abstract/Free Full Text]
  9. Kawamoto, J. H., McLaughlin, B. E., Brien, J. F., Marks, G. S., Nakatsu, K. (1990) Biotransformation of glyceryl trinitrate and elevation of cyclic GMP precede glyceryl trinitrate-induced vasodilation. J. Cardiovasc. Pharmacol. 15,714-719[Medline]
  10. Chen, Z., Zhang, J., Stamler, J. S. (2002) Identification of the enzymatic mechanism of nitroglycerin bioactivation. Proc. Natl. Acad. Sci. U. S. A. 99,8306-8311[Abstract/Free Full Text]
  11. Chen, Z., Foster, M. W., Zhang, J., Mao, L., Rockman, H. A., Kawamoto, T., Kitagawa, K., Nakayama, K. I., Hess, D. T., Stamler, J. S. (2005) An essential role for mitochondrial aldehyde dehydrogenase in nitroglycerin bioactivation. Proc. Natl. Acad. Sci. U. S. A. 102,12159-12164[Abstract/Free Full Text]
  12. Zhang, J., Chen, Z., Cobb, F. R., Stamler, J. S. (2004) Role of mitochondrial aldehyde dehydrogenase in nitroglycerin-induced vasodilation of coronary and systemic vessels: an intact canine model. Circulation 110,750-755[Abstract/Free Full Text]
  13. Sydow, K., Daiber, A., Oelze, M., Chen, Z., August, M., Wendt, M., Ullrich, V., Mülsch, A., Schulz, E., Keaney, J. F., Jr, Stamler, J. S., Münzel, T. (2004) Central role of mitochondrial aldehyde dehydrogenase and reactive oxygen species in nitroglycerin tolerance and cross-tolerance. J. Clin. Invest. 113,482-489[CrossRef][Medline]
  14. Kollau, A., Hofer, A., Russwurm, M., Koesling, D., Keung, W. M., Schmidt, K., Brunner, F., Mayer, B. (2005) Contribution of aldehyde dehydrogenase to mitochondrial bioactivation of nitroglycerin: evidence for the activation of purified soluble guanylate cyclase through direct formation of nitric oxide. Biochem. J. 385,769-777[CrossRef][Medline]
  15. De la Lande, I. S., Stepien, J. M., Philpott, A. C., Hughes, P. A., Stafford, I., Horowitz, J. D. (2004) Aldehyde dehydrogenase, nitric oxide synthase and superoxide in ex vivo nitrate tolerance in rat aorta. Eur. J. Pharmacol. 496,141-149[CrossRef][Medline]
  16. Abrams, J. (1985) Hemodynamic effects of nitroglycerin and long-acting nitrates. Am. Heart J. 110,216-224[Medline]
  17. Sambrook, J., Fritsch, E. F., Maniatis, T. (1989) Extraction, purification and analysis of messenger RNA from eukaryotic cells. Nolan, C. eds. Molecular Cloning—A Laboratory Manual ,7.1-7.87 Cold Spring Harbor Laboratory Press Cold Spring Harbor, New York, USA.
  18. Zheng, C. F., Wang, T. T., Weiner, H. (1993) Cloning and expression of the full-length cDNAS encoding human liver class 1 and class 2 aldehyde dehydrogenase. Alcohol. Clin. Exp. Res. 17,828-831[CrossRef][Medline]
  19. Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227,680-685[CrossRef][Medline]
  20. Breslow, R., Ryan, G. (1967) Cyclopropenone. J. Am. Chem. Soc. 89,3073[Medline]
  21. Thiemann, T., Ohira, D., Li, Y., Sawada, T., Mataka, S., Rauch, K., Noltemeyer, M., de Meijere, A. (2000) [4 + 2] Cycloaddition of thiophene S-monoxides to activated methylenecyclopropanes. J. Chem. Soc. [Perkin 1] 17,2968-2976
  22. Chen, Z., Stamler, J. S. (2006) Bioactivation of nitroglycerin by the mitochondrial aldehyde dehydrogenase. Trends Cardiovasc. Med. 16,259-265[CrossRef][Medline]
  23. Wenzel, P., Hink, U., Oelze, M., Seeling, A., Isse, T., Bruns, K., Steinhoff, L., Brandt, M., Kleschyov, A. L., Schulz, E., Lange, K., Weiner, H., Lehmann, J., Lackner, K. J., Kawamoto, T., Munzel, T., Daiber, A. (2007) Number of nitrate groups determines reactivity and potency of organic nitrates: a proof of concept study in ALDH-2(–/–) mice. Br. J. Pharmacol. 150,526-533[CrossRef][Medline]
  24. Mackenzie, I. S., Maki-Petaja, K. M., McEniery, C. M., Bao, Y. P., Wallace, S. M., Cheriyan, J., Monteith, S., Brown, M. J., Wilkinson, I. B. (2005) Aldehyde dehydrogenase 2 plays a role in the bioactivation of nitroglycerin in humans. Arterioscler. Thromb. Vasc. Biol. 25,1891-1895[Abstract/Free Full Text]
  25. Li, Y., Zhang, D., Jin, W., Shao, C., Yan, P., Xu, C., Sheng, H., Liu, Y., Yu, J., Xie, Y., Zhao, Y., Lu, D., Nebert, D. W., Harrison, D. C., Huang, W., Jin, L. (2006) Mitochondrial aldehyde dehydrogenase-2 (ALDH2) Glu504Lys polymorphism contributes to the variation in efficacy of sublingual nitroglycerin. J. Clin. Invest. 116,506-511[CrossRef][Medline]
  26. Mukerjee, N., Pietruszko, R. (1994) Inactivation of human aldehyde dehydrogenase by isosorbide dinitrate. J. Biol. Chem. 269,21664-21669[Abstract/Free Full Text]
  27. Pietruszko, R., Mukerjee, N., Blatter, E. E., Lehmann, T. (1995) Nitrate esters as inhibitors and substrates of aldehyde dehydrogenase. Adv. Exp. Med. Biol. 372,25-34[Medline]
  28. Artz, J. D., Schmidt, B., McCracken, J. L., Marletta, M. A. (2002) Effects of nitroglycerin on soluble guanylate cyclase: implications for nitrate tolerance. J. Biol. Chem. 277,18253-18256[Abstract/Free Full Text]
  29. Tsuchida, S., Maki, T., Sato, K. (1990) Purification and characterization of glutathione transferases with an activity toward nitroglycerin from human aorta and heart. Multiplicity of the human class Mu forms. J. Biol. Chem. 265,7150-7157[Abstract/Free Full Text]
  30. Yeates, R. A., Schmid, M., Leitold, M. (1989) Antagonism of glycerol trinitrate activity by an inhibitor of glutathione S-transferase. Biochem. Pharmacol. 38,1749-1753[CrossRef][Medline]
  31. Millar, T. M., Stevens, C. R., Benjamin, N., Eisenthal, R., Harrison, R., Blake, D. R. (1998) Xanthine oxidoreductase catalyses the reduction of nitrates and nitrite to nitric oxide under hypoxic conditions. FEBS Lett. 427,225-528[CrossRef][Medline]
  32. McDonald, B. J., Bennett, B. M. (1993) Biotransformation of glyceryl trinitrate by rat aortic cytochrome P450. Biochem. Pharmacol. 45,268-270[CrossRef][Medline]
  33. McGuire, J. J., Anderson, D. J., McDonald, B. J., Narayanasami, R., Bennett, B. M. (1998) Inhibition of NADPH-cytochrome P450 reductase and glyceryl trinitrate biotransformation by diphenyleneiodonium sulfate. Biochem. Pharmacol. 56,881-893[CrossRef][Medline]
  34. Seth, P., Fung, H. L. (1993) Biochemical characterization of a membrane-bound enzyme responsible for generating nitric oxide from nitroglycerin in vascular smooth muscle cells. Biochem. Pharmacol. 46,1481-1486[CrossRef][Medline]
  35. McDonald, B. J., Bennett, B. M. (1990) Cytochrome P-450 mediated biotransformation of organic nitrates. Can. J. Physiol. Pharmacol. 68,1552-7155[Medline]
  36. Kleschyov, A. L., Oelze, M., Daiber, A., Huang, Y., Mollnau, H., Schulz, E., Sydow, K., Fichtlscherer, B., Mulsch, A., Munzel, T. (2003) Does nitric oxide mediate the vasodilator activity of nitroglycerin?. Circ. Res. 93,104-112[CrossRef]
  37. Nunez, C., Victor, V. M., Tur, R., Alvarez-Barrientos, A., Moncada, S., Esplugues, J. V., D'Ocon, P. (2005) Discrepancies between nitroglycerin and NO-releasing drugs on mitochondrial oxygen consumption, vasoactivity, and the release of NO. Circ. Res. 97,1063-1069[Abstract/Free Full Text]
  38. Wenzel, P., Hink, U., Oelze, M., Schuppan, S., Schaeuble, K., Schildknecht, S., Ho, K. K., Weiner, H., Bachschmid, M., Munzel, T., Daiber, A. (2007) Role of reduced lipoic acid in the redox regulation of mitochondrial aldehyde dehydrogenase (ALDH-2) activity: implications for mitochondrial oxidative stress and nitrate tolerance. J. Biol. Chem. 282,792-799[Abstract/Free Full Text]
  39. Daiber, A., Oelze, M., Coldewey, M., Bachschmid, M., Wenzel, P., Sydow, K., Wendt, M., Kleschyov, A. L., Stalleicken, D., Ullrich, V., Mulsch, A., Munzel, T. (2004) Oxidative stress and mitochondrial aldehyde dehydrogenase activity: a comparison of pentaerythritol tetranitrate with other organic nitrates. Mol. Pharmacol. 66,1372-1382[Abstract/Free Full Text]
  40. Daiber, A., Oelze, M., Sulyok, S., Coldewey, M., Schulz, E., Treiber, N., Hink, U., Mulsch, A., Scharffetter-Kochanek, K., Munzel, T. (2005) Heterozygous deficiency of manganese superoxide dismutase in mice (Mn-SOD+/–): a novel approach to assess the role of oxidative stress for the development of nitrate tolerance. Mol. Pharmacol. 68,579-588[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Circ. Res.Home page
J. S. Stamler
Nitroglycerin-Mediated S-Nitrosylation of Proteins: A Field Comes Full Cycle
Circ. Res., September 12, 2008; 103(6): 557 - 559.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.07-098830v1
22/7/2561    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huellner, M. W.
Right arrow Articles by Rau, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huellner, M. W.
Right arrow Articles by Rau, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS