FASEB J. Mp Biomedicals
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.07-101816.
(The FASEB Journal. 2008;22:2285-2296.)
© 2008 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.07-101816v1
22/7/2285    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, G.
Right arrow Articles by Abraham, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, G.
Right arrow Articles by Abraham, E.

Interleukin-1 receptor-associated kinase (IRAK) -1-mediated NF-{kappa}B activation requires cytosolic and nuclear activity

Gang Liu, Young-Jun Park and Edward Abraham1

Department of Medicine, University of Alabama at Birmingham, Birmingham, Alabama, USA

1Correspondence: Department of Medicine, University of Alabama at Birmingham School of Medicine, 420 Boshell Bldg., 1808 7th Ave., South, Birmingham, AL 35294, USA. E-mail: eabraham{at}uab.edu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
 
Interleukin-1 receptor-associated kinase (IRAK) -1 plays an essential role in Toll-like receptor/interleukin-1 receptor (TLR/IL-1R) -associated NF-{kappa}B activation through its involvement in IKK activation, which then leads to subsequent I{kappa}B degradation and NF-{kappa}B nuclear translocation. In the present studies, we demonstrate a novel pathway in which IRAK-1 present in the nucleus participates in NF-{kappa}B-dependent gene expression. Nuclear localization of IRAK-1 is increased on cellular stimulation with IL-1 and LPS, or CRM-1-dependent nuclear export blockade. Induction of IRAK-1 produces enhanced NF-{kappa}B transcriptional activity that precedes I{kappa}B-{alpha} degradation and nuclear translocation of NF-{kappa}B. IRAK-1 binds to the promoter of NF-{kappa}B-regulated gene, I{kappa}B-{alpha}, and enhances binding of the NF-{kappa}B p65 subunit to NF-{kappa}B responsive elements within the I{kappa}B-{alpha} promoter. IRAK-1 phosphorylates histone H3 in vitro and is required for IL-1-induced phosphorylation of histone H3 at serine 10 in vivo. These data indicate that both cytosolic and nuclear actions of IRAK-1 participate in the activation of NF-{kappa}B-dependent transcriptional events.—Liu, G., Park, Y.-J., Abraham, E. Interleukin-1 receptor-associated kinase (IRAK) -1-mediated NF-{kappa}B activation requires cytosolic and nuclear activity.


Key Words: transcription • histone H3 • nuclear translocation • Toll-like receptor


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
 
TOLL-LIKE RECEPTORS (TLRS) are a family of membrane proteins involved in microbial recognition and induction of inflammatory processes (1 2 3) . Products from microbial organisms, presented as pathogen-associated molecular patterns (PAMPs), as well as other mediators associated with host defense and immunoregulatory mechanisms, bind to the extracellular domain of TLRs (4 , 5) . The intracellular domain of TLRs, also known as the TIR domain due to significant homology to the intracellular domain of the IL-1 receptor, participates in a series of downstream signaling events that lead to activation of NF-{kappa}B, mitogen-activated protein kinases (MAPKs), and interferon-responsive factors (IRFs) (6 7 8 9 10) .

Engagement of TLRs with extracellular ligands leads to recruitment of Myd88, as well as Tollip associated with interleukin-1 receptor-associated kinase (IRAK) -1, to the TIR domain (11 12 13 14 15 16) . IRAK-4 is then brought into proximity of IRAK-1 via interaction with Myd88, resulting in phosphorylation of IRAK-1 both by autophosphorylation and by IRAK-4 (17 18 19) . Activated IRAK-1 is able to associate with TRAF6, an E3 ubiquitin ligase (20) . The IRAK-1 and TRAF6 complex recruits TAK1, TAB1, and TAB2 to the TIR domain (21 22 23) . The complex containing TRAF6, TAK-1, TAB1, and TAB2 then reenters the cytosol where TRAF6, together with TAB1 and TAB2, activates TAK-1 (21 22 23) . Activated TAK-1 subsequently activates IKK{alpha}/β, resulting in I{kappa}B-{alpha} phosphorylation, ubiquitination, degradation, and nuclear translocation of p65-containing NF-{kappa}B complexes (24) .

Although nuclear translocation of p65 is primarily controlled by I{kappa}B proteins, transcriptional activity of p65 requires binding to NF-{kappa}B-responsive elements within the promoters of its target genes (25 26 27) . A variety of post-translational modifications, such as phosphorylation and acetylation, modulates NF-{kappa}B DNA-binding (28 29 30 31) . In addition, the transcriptional ability of NF-{kappa}B is also regulated through interactions with nuclear coactivating proteins (32) .

Although the primary function of IRAK-1 is thought to be its participation in cytoplasmic events following TLR engagement that leads to activation of the IKK complex, degradation of I{kappa}B-{alpha}, and translocation of NF-{kappa}B to the nucleus, there are data indicating that IRAK-1 can be present in the nucleus (33 34 35 36) . We therefore hypothesized that IRAK-1 could directly participate in NF-{kappa}B-related transcriptional events, independent of its involvement in IKK activation.

In these studies, we found that transient overexpression of IRAK-1 results in enhanced transcriptional activity of NF-{kappa}B even without concurrent I{kappa}B-{alpha} degradation or increased nuclear translocation of p65. Nuclear localization of IRAK-1 was increased by IL-1R engagement with IL-1 and led to IRAK-1 binding to NF-{kappa}B-dependent promoter sites, as well as to phosphorylation of histone H3. Collectively, these findings demonstrate a novel role for IRAK-1 in which it directly participates in NF-{kappa}B-associated transcriptional events.


   EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
 
Cell culture
The human embryonic kidney cell line HEK-293, human breast cancer cell line MCF-7, and mouse macrophage cell line RAW 264.7 were purchased from American Type Culture Collection (Manassas, VA, USA). The HEK-293 cell line that overexpresses TLR4/MD2/CD14 (HEK-293-TLR4/MD2/CD14) was purchased from Invivogen (San Diego, CA, USA). HEK-293 cell line that is deficient in IRAK-1(HEK-293-I1A) was provided by Dr. Xiaoxia Li (Cleveland Clinic, Cleveland, OH, USA). Cells were cultured in DMEM medium supplemented with 10% of fetal bovine serum.

Plasmids
pcDNA3-Flag-IRAK-1 that expresses full-length human IRAK-1 with a Flag epitope at N terminus was obtained from Dr. Michael U. Martin (Hannover Medical School, Hannover, Germany). To generate a construct that expresses Flag-IRAK-1 under the control of tetracycline, the full length cDNA in pcDNA3-Flag-IRAK-1 was cut by HindIII and EcoRI and cloned into pcDNA4/TO (Invitrogen, Carlsbad, CA, USA). The resulting construct was termed pcDNA4-Flag-IRAK-1. To generate a construct that can inducibly express IRAK-1 siRNA under the control of tetracycline, two complementary DNA oligos were synthesized and annealed. The sequence for the oligos were sense 5' GATC CCC GGTTGTCCTTGAGTAATAA TTCAAGAGA TTATTACTCAAGGACAACC TTTTTGGAAA 3' and antisense 5' AGCT TTTCCAAAAA GGTTGTCCTTGAGTAATAA TCTCTTGAA TTATTACTCAAGGACAACC GGG, with the IRAK-1 siRNA sequence listed in bolded italics. The annealed double-stranded oligo was then cloned into pBabe-H1-Tet-O at HindIII and EcoRI sites. The resulting construct was termed as pBabe-H1-Tet-O-IRAK-1 siRNA. The expression of IRAK-1 siRNA was initiated by the RNA polymerase III promoter, H1.

Generation of stable cell lines
To generate a HEK-293-I1A cell line that can inducibly express exogenous IRAK-1, a tet-on system was used. First, HEK-293-I1A was transfected with pcDNA6, which can express a tet repressor. The transfected cells were selected with blasticidin for 2 wk. A single colony was isolated and checked for expression of the tet repressor. The positive clone was then transfected with pcDNA4-Flag-IRAK-1. The cells were selected with zeocin for 2 wk, and a single colony was isolated and amplified. An individual cell clone was uninduced or induced to express Flag-IRAK-1. One positive clone (HEK-293-I1A-Flag-IRAK-1#1) was used for the study. To generate a cell line that can inducibly express IRAK-1 siRNA, MCF-7-TR cells that express the tet repressor were transfected with pBabe-H1-Tet-O-IRAK-1 siRNA. Cells were selected with blasticidin and puromycin for 2 wk, and a positive clone (MCF-7-IRAK-1 siRNA#1) was used for subsequent experiments.

Real-time RT-PCR
Total RNA was purified with TRI reagent (Sigma, St. Louis, MO, USA). cDNA was synthesized using Taqman reverse transcription reagents (Roche Diagnostics, Mannheim, Germany). Real-time PCR was performed using a Lightcycler 480 SYBR Green I Master system (Roche) according to the manufacturer’s instructions. The primers used to amplify human IL-8 transcripts were forward, 5' GTG CAG TTT TGC CAA GGA GT 3' and reverse, 5' CTC TGCACC CAG TTT TCC TT 3'. The primers for human I{kappa}B-{alpha} were: forward, 5' CCC TGT AAT GGC CGG ACT G 3' and reverse, 5' CAG CAT CTG AAG GTT TTC TAG TG 3'. Human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) transcript was used as an internal control. The primers for GAPDH were forward, 5' GCG AGA TCC CTC CAA AAT CAA 3' and reverse, 5' GTT CAC ACC CAT GAC GAA CAT 3'.

Cytokine ELISA
Immunoreactive human tumor necrosis factor-{alpha} (TNF-{alpha}) was quantified using commercially available ELISA kits (R&D Systems, Minneapolis, MN, USA), according to the manufacturer’s instructions.

Immunoblotting assay
Cells were washed 2x with cold PBS. Cells were then lysed in 0.1% Triton X-100 lysis buffer (50 mM sodium phosphate, 150 mM sodium chloride, 5 mM EDTA, 0.1% Triton X-100, pH, 7.4), supplemented with 1:100 protease inhibitor cocktail (Sigma) and 1:100 phosphotase inhibitor cocktail (Pierce Biotechnology, Rockford, IL, USA). Protein concentrations were measured using a Dc protein assay kit (Bio-Rad, Hercules, CA, USA) according to the manufacturer’s instructions. Thirty micrograms of total protein was resolved by SDS-PAGE gel and transferred to nitrocellulose membrane. The membrane was blotted with specific antibodies and protein expression was detected using Supersignal ECL (Pierce). Mouse anti-IRAK-1 monoclonal antibody, rabbit antip65 polyclonal antibodies, rabbit anti-CBP polyclonal antibodies, rabbit anti-GAPDH polyclonal antibodies, rabbit anti-HDAC-1 polyclonal antibodies, rabbit anti-TLR4 polyclonal antibodies, and mouse anti-tubulin monoclonal antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Rabbit anti-actin polyclonal antibodies and mouse anti-Flag monoclonal antibody were from Sigma. Rabbit anti-I{kappa}B-{alpha} antibodies were purchased from Cell Signaling (Danvers, MA, USA). Mouse anti-phosphorylated histone H3 at serine 10 monoclonal antibody was purchased from Upstate Biotechnology (Lake Placid, NY, USA).

Immunoprecipitation assay
Cells were lysed in 0.1% Nonidet P-40 lysis buffer (50 mM Tris-Cl, pH 8.0; 137 mM sodium chloride; 2 mM EDTA; 5% glycerol; 0.1% Nonidet P-40), supplemented with 1:100 protease inhibitor cocktail (Sigma) and 1:100 phosphotase inhibitor cocktail (Pierce). The lysates were precleared by centrifugation at 14,000 rpm, supernatants were collected, and protein concentration was measured. Equal amounts of cell extracts from different experimental groups were combined with 2.0 µg/ml rabbit anti-IRAK-1 antibody and 35 µl protein G agarose beads. The extracts were then rotated at 4°C for 3 h, and the protein G beads were spun down and washed 4x with lysis buffer. The immunocomplexes were eluted with 1x SDS sample buffer,and proteins were resolved by SDS-PAGE.

Chromatin immunoprecipitation assay
After various treatments, cells were fixed with 1% of formaldehyde for 10 min. Cells were collected in cold PBS and resuspended in 1 ml of TE buffer. Genomic DNA was then sheared to lengths ranging from 200 to 1000 bp by sonication. 5% of cell extract was taken out as input,and the rest of the extract was incubated with various antibodies (rabbit anti-IRAK-1 polyclonal antibodies, rabbit anti-p65 polyclonal antibodies, or mouse anti-Flag monoclonal antibody) overnight, followed by precipitation with protein G agarose beads. Mouse IgG was used to replace specific antibodies to serve as a negative control. Genomic DNA in the immunocomplexes was purified by Qiagen miniprep column (Qiagen, Valencia, CA, USA), and the NF-{kappa}B-responsive element in the promoter of NF-{kappa}B target genes were amplified by PCR. The primer sequence for amplification of NF-{kappa}B-responsive elements in the promoter of human I{kappa}B-{alpha} gene was sense 5' AGAGGGACAGGATTACAGGGTGC 3' and antisense 5' CCAAGCCAGTCAGACCAGAAAA 3'. The primer sequence for amplification of NF-{kappa}B-responsive elements in the promoter of mouse I{kappa}B-{alpha} gene was sense 5' TGGCGAGGTCTGACTGTTGTGG 3' and antisense 5' GCTCATCAAAAAGTTCCCTGTGC 3'. The primer sequence for amplification of the human GAPDH promoter was sense 5' CAGGAAAGGCAATCCCAGAAAGG 3' and antisense 5' GGAGGGTGCTGAACACTTGTAAGG 3'.

Kinase assay
HEK-293-I1A cells were transfected with pcDNA3 and pcDNA3-Flag-IRAK-1. At 24 h after transfection, cells were washed 2x with cold PBS and lysed in 0.1% Triton X-100 lysis buffer. IRAK-1 was immunoprecipitated by anti-IRAK-1 antibody and protein G agarose. The beads were washed 3x with 0.1% Triton X-100 lysis buffer, and 2x with kinase buffer (20 mM HEPES, pH 7.6; 20 mM MgCl2). The beads were then incubated at 37°C in a final volume of 50 µl of kinase buffer in the presence of MBP (Sigma) and histone H3 (Upstate) as substrates (1 µg/sample), 100 µM ATP, and 2.5 µCi of (32P)ATP (Amersham, Piscataway, NJ, USA). After SDS sample buffer was added to the protein G beads, the samples were boiled for 10 min and then subjected to SDS-PAGE analysis. The gel was transferred to a nitrocellulose membrane and exposed to film. After obtaining a radioautograph, the membrane was blotted with total anti-IRAK-1 antibody to determine that an equal amount of precipitated IRAK-1 was present in each sample. The in vitro kinase assay was also performed using recombinant IRAK-1 (Upstate). One microgram of recombinant IRAK-1 was used with each substrate. Recombinant protein HMGB1 and BSA were used as negative controls.

Isolation of nuclei
Cells were collected in phosphate-buffered saline (PBS) and centrifuged. The cell pellet was resuspended with 500 µl of lysis buffer (10 mM Tris, pH 7.5, 10 mM NaCl, 3 mM MgCl2, 0.05% Nonidet P-40, 1 mM EGTA, 1:100 protease inhibitor cocktail, and 1:100 phosphotase inhibitor cocktail). Lysed cells were collected in microcentrifuge tubes and centrifuged at 2700 g for 10 min at 4°C. The supernatant containing the cytosol was further centrifuged at 20,800 g for 15 min at 4°C to obtain the cytosolic fraction. The nuclei in the pellet were washed 3x by gently resuspending the nuclei in 200 µl of wash buffer (10 mM PIPES, pH 6.8; 300 mM sucrose; 3 mM MgCl2; 1 mM EGTA; 25 mM NaCl; 1:100 protease inhibitor cocktail; and 1:100 phosphatase inhibitor cocktail) and centrifuging at 2700 g for 5 min at 4°C. For a final wash, the nuclei were resuspended in 100 µl of wash buffer, layered over a cushion of 1 ml of sucrose buffer (1 M sucrose), and centrifuged at 2700 g for 10 min. The sucrose buffer containing nonsedimented cellular debris was discarded, and the pellet-containing nuclei was washed in 100 µl of lysis buffer and centrifuged at 2700 g for 5 min at 4°C to remove residual sucrose buffer.

Confocal microscopy
Cells were fixed in 3% formaldehyde for 30 min. After being permeabilized with 0.5% Triton X-100 for 3 min, the cells were blocked in PBS containing 5% BSA for 1 h. Cells were then incubated with IRAK-1 antibody overnight at 4°C. Cells were washed 3x and incubated with FITC-conjugated or Texas-red-conjugated secondary antibody for 1 h. Cells were then incubated with DAPI for nucleus staining. Fluorescent images were taken with a Leica confocal microscope (Leica Microsystems, Bannockburn, IL, USA).

Densitometric and statistical analyses
Densitometry of Western blots was performed by AlphaEaseFC 4.0 software (Alpha Innotech, San Leandro, CA, USA). Student’s t test was used for comparisons between two groups. A value of P < 0.05 was considered significant.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
 
I{kappa}B-{alpha} degradation, NF-{kappa}B nuclear translocation, and NF-{kappa}B-dependent gene expression are impaired, but not absent, in IRAK-1-null cells
To explore the mechanism by which IRAK-1 mediates NF-{kappa}B activation, we took advantage of a HEK-293-derived cell line, HEK-293-I1A, which is deficient in IRAK-1 (37) . At different time points after stimulation with IL-1, levels of I{kappa}B-{alpha} in HEK-293 and HEK-293-I1A cells were determined. In HEK-293 cells, degradation of I{kappa}B-{alpha} could be detected as early as 15 min after IL-1 stimulation, with almost complete degradation present at 60 min (Fig. 1 A). IL-1 treatment also triggered I{kappa}B-{alpha} degradation in HEK-293-I1A cells (Fig. 1A ), indicating that IRAK-1 is not essential for I{kappa}B-{alpha} degradation after IL-1R engagement, and that kinases other than IRAK-1 participate in regulation of I{kappa}B-{alpha} levels. However, the extent of I{kappa}B-{alpha} degradation in HEK-293-I1A cells was less at each time point after IL-1 stimulation as compared to that in HEK-293 cells (Fig. 1A ), consistent with a role for IRAK-1 in I{kappa}B-{alpha} degradation.


Figure 1
View larger version (25K):
[in this window]
[in a new window]

 
Figure 1. Interleukin-1β (IL-1β) induced I{kappa}B-{alpha} degradation, NF-{kappa}B nuclear translocation, and NF-{kappa}B-dependent gene expression are impaired in IRAK-1-null cells. A) IL-1β-induced I{kappa}B-{alpha} degradation is attenuated in IRAK-1-deficient cells. Human embryonic kidney-293 (HEK-293) and IRAK-1-deficient HEK-293-I1A cells were treated with 10 ng/ml IL-1β for the indicated times. Cell extracts were prepared and Western blot assays were performed to detect the expression of IRAK-1 and I{kappa}B-{alpha}. Tubulin was used as a loading control. B, C) Nuclear translocation of p65 on IL-1β stimulation was decreased in IRAK-1-deficient cells. HEK-293 (B) and HEK-293 I1A (C) cells were treated with 10 ng/ml IL-1β for the indicated times. Cytoplasmic and nuclear fractions were prepared as described in Materials and Methods. p65 was detected with antip65 antibodies. CBP was used as a nuclear marker, and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was examined to demonstrate the purity of nuclei. D) Levels of p65 and CBP in the nucleus at the indicated time points after IL-1β stimulation were determined by densitometry. p65/CBP ratios at the indicated time points were obtained by dividing the densitometry value of p65 by that of CBP. E) Expression of I{kappa}B-{alpha} induced by IL-1β stimulation is diminished in IRAK-1-deficient cells. HEK-293 and HEK-293 I1A cells were treated with 10 ng/ml IL-1β for 15 or 60 min. Total RNA was isolated and real-time PCR assay performed to determine the expression of I{kappa}B-{alpha}.

Because I{kappa}B-{alpha} degradation is diminished in HEK-293-I1A cells, we examined whether nuclear translocation of the NF-{kappa}B p65 subunit is affected in the absence of IRAK-1. Increased nuclear translocation of p65 was found within 15 min after IL-1 stimulation in both HEK-293 and HEK-293-I1A cell lines (Figs. 1B, C ). However, after normalizing the level of nuclear p65 to that of CBP, p65 translocation in HEK-293 I1A cells was clearly reduced when compared with that in HEK-293 cells at each time point after IL-1 stimulation (Fig. 1D ). These data are consistent with decreased I{kappa}B-{alpha} degradation in HEK-293 I1A cells being associated with diminished nuclear translocation of NF-{kappa}B after IL-1-induced cellular stimulation.

We next determined the expression of a well-defined NF-{kappa}B-regulated gene, I{kappa}B-{alpha}, on IL-1 stimulation in HEK-293 and HEK-293-I1A cells. The expression of I{kappa}B-{alpha} was significantly higher in HEK-293 than in HEK-293 I1A cells after IL-1 exposure (Fig. 1E ). Together, these findings indicate that while IRAK-1 is not required for NF-{kappa}B-dependent gene expression, I{kappa}B-{alpha} degradation, and NF-{kappa}B nuclear translocation, IRAK-1 still plays a central regulatory role in each of these processes.

IRAK-1 knockdown does not affect I{kappa}B-{alpha} degradation or p65 nuclear translocation, but does attenuate NF-{kappa}B-dependent gene expression
The above results indicated that even though I{kappa}B-{alpha} degradation is decreased in IRAK-1-null cells after IL-1 treatment, IRAK-1 is not essential for I{kappa}B-{alpha} degradation after TLR/IL-1R engagement. This raises the question of the relative involvement of IRAK-1 in modulating the activation of NF-{kappa}B and expression of NF-{kappa}B dependent genes. To address this question, we generated a cell line that inducibly expressed IRAK-1 siRNA under the control of tetracycline. In these cells, the level of IRAK-1 is reduced on induction of IRAK-1 siRNA by adding tetracycline into the culture medium (Fig. 2 A, B, D).


Figure 2
View larger version (23K):
[in this window]
[in a new window]

 
Figure 2. IRAK-1 knockdown does not affect I{kappa}B-{alpha} degradation or p65 nuclear translocation but attenuates IL-1β-induced expression of I{kappa}B-{alpha}. A–D) I{kappa}B-{alpha} degradation after IL-1β stimulation occurs in IRAK-1 knockdown cells. MCF-7 cells that were not induced or were induced with tetracycline to knock down IRAK-1 were treated with 10 ng/ml (A) or 2.5 ng/ml (C) of IL-1β for the indicated times. The expression of IRAK-1, I{kappa}B-{alpha}, and actin was determined by Western blot. Densitometric analysis of IRAK-1 expression in A and C is shown in B and D. The ratio of densitometric value of IRAK-1 to actin in cells with no IRAK-1 siRNA induction at 0 min after IL-1 stimulation was regarded as 1. E, F) Nuclear translocation of p65 on IL-1β stimulation is unchanged in IRAK-1 knockdown cells. MCF-7 cells that were not induced (E) or induced (F) to knock down IRAK-1 were treated with 10 ng/ml of IL-1β for the indicated times. Cytoplasmic and nuclear fractions were prepared. p65 was detected with antip65 antibodies. CBP was used as a nuclear marker and GAPDH examined to demonstrate the purity of nuclei. G) Levels of p65 in the cytosol and nucleus at the indicated time points after IL-1β stimulation were determined by densitometry. Nuclear/cytoplasmic p65 ratios at the indicated time points were obtained by dividing the densitometric value of nuclear p65 by that of cytoplasmic p65. H) The expression of I{kappa}B-{alpha} after IL-1β stimulation was reduced in IRAK-1 knockdown cells. MCF-7 cells that were not induced or were induced to knock down IRAK-1 were treated with 10 ng/ml IL-1β for the indicated times. Total RNA was isolated and real-time PCR assays performed to determine the expression of I{kappa}B-{alpha}. *P < 0.05, I{kappa}B-{alpha} expression without vs. with IRAK-1 siRNA induction. I) The expression of TNF-{alpha} after IL-1β stimulation was reduced in IRAK-1 knockdown cells. MCF-7 cells that were not induced or were induced to knock down IRAK-1 were treated with 10 ng/ml IL-1β for the indicated times. Cell supernatants were collected and TNF-{alpha} level was determined by ELISA assay. *P < 0.05, TNF-{alpha} expression without vs. with IRAK-1 siRNA induction.

There was equal degradation of I{kappa}B-{alpha} after IL-1 treatment of cells that were uninduced or induced to express IRAK-1 siRNA (Fig. 2A ). This finding suggests that the residual IRAK-1 in IRAK-1 knockdown cells is sufficient for I{kappa}B-{alpha} degradation on IL-1 stimulation. To determine whether the similar degree of I{kappa}B-{alpha} degradation in cells with or without knockdown of IRAK-1 is simply caused by the overwhelming effect of high dose IL-1, we treated the cells that are uninduced or induced to express IRAK-1 siRNA with a lower concentration (2.5 ng/ml) of IL-1. Under these conditions, there was similar I{kappa}B-{alpha} degradation with or without inhibition of IRAK-1 expression (Fig. 2B ). Consistent with the findings of similar degrees of I{kappa}B-{alpha} degradation in cells with or without induction of IRAK-1 siRNA, p65 translocation was also comparable in the cells without or with IRAK-1 knockdown (Figs. 2E-G ).

Because neither I{kappa}B-{alpha} degradation nor p65 translocation was affected by IRAK-1 knockdown, we assumed that NF-{kappa}B-dependent gene expression in response to IL-1 stimulation would be similar in cells with or without expression of IRAK-1 siRNA. However, surprisingly, the expression of two NF-{kappa}B-dependent genes, I{kappa}B-{alpha} and TNF-{alpha}, was significantly decreased after inhibition of IRAK-1 expression (Fig. 2H, I ). These results suggest that in addition to its participation in IKK activation, I{kappa}B-{alpha} degradation, and nuclear translocation of NF-{kappa}B, IRAK-1 is also able to affect the transcriptional activity of NF-{kappa}B by other mechanisms.

Induction of IRAK-1 produces enhanced NF-{kappa}B transcriptional activity that precedes I{kappa}B-{alpha} degradation and nuclear translocation of NF-{kappa}B
In previous studies, NF-{kappa}B activation was demonstrated to occur in IRAK-1 null cells transiently transfected with IRAK-1-expressing plasmids or in cells stably expressing exogenous IRAK-1 (21 , 37 38 39 40) . Of note, overexpressed IRAK-1 usually undergoes autophosphorylation, which then results in IKK activation (41) . Therefore, in experiments in which IRAK-1 is expressed for prolonged periods, it is not possible to know whether the mechanism through which NF-{kappa}B-dependent transcription is enhanced solely involves activation of IKK or whether IRAK-1 has additional effects. To address this issue and to modify the expression level of exogenous IRAK-1 in a temporally controlled manner, we generated a HEK-293 I1A cell line that inducibly expressed IRAK-1. Within 60 min after tetracycline addition, IRAK-1 expression started to increase (Fig. 3 A). The level of IRAK-1 continued to rise during the 3-h period after tetracycline addition (Fig. 3A ). I{kappa}B-{alpha} levels showed no apparent changes during the first 2 h after IRAK-1 was inducibly expressed, although diminished concentrations were found starting 3 h after IRAK-1 induction (Fig. 3A ). Similarly, there were no apparent alterations in nuclear translocation of the NF-{kappa}B p65 subunit during the first 2 h after IRAK-1 induction (Fig. 3B ). In contrast to the lack of change in I{kappa}B-{alpha} levels or nuclear translocation of NF-{kappa}B, expression of I{kappa}B-{alpha} was increased 2 h after IRAK-1 induction and mRNA levels of the NF-{kappa}B-dependent gene IL-8 started to rise as early as 1 h following IRAK-1 induction (Fig. 3C, D ). These data indicate that IRAK-1 is able to promote the transcriptional activity of NF-{kappa}B in a manner distinct from its role in activating the I{kappa}B kinase, IKK, with resultant I{kappa}B-{alpha} phosphorylation and degradation.


Figure 3
View larger version (10K):
[in this window]
[in a new window]

 
Figure 3. Expression of exogenous IRAK-1 results in enhanced NF-{kappa}B-dependent gene transcription that precedes I{kappa}B-{alpha} degradation or nuclear translocation of p65. A) I{kappa}B-{alpha} is not degraded in HEK-293-I1A-Flag-IRAK-1 cells during the first 2 h after IRAK-1 induction. HEK-293-I1A-Flag-IRAK-1 cells were induced to express IRAK-1 by culture with tetracycline. At the indicated time points after induction, the cells were collected and the expression of IRAK-1, I{kappa}B-{alpha}, and actin determined by Western blot analysis. B) Nuclear translocation of p65 is unaltered in HEK-293-I1A-Flag-IRAK-1 cells during the first 2 h after IRAK-1 induction. HEK-293-I1A-Flag-IRAK-1 cells were induced to express IRAK-1. At the indicated time points after induction, the cells were collected, and cell fractionation was performed. The levels of p65, CBP, and GAPDH were determined by Western blot analysis. C, D) Transient expression of exogenous IRAK-1 results in rapid increases in the expression of the NF-{kappa}B-dependent genes, I{kappa}B-{alpha} and IL-8. HEK-293-I1A-Flag-IRAK-1 cells were not induced or were induced to express IRAK-1. At the indicated time points after induction, cells were collected and total RNA was isolated. Real-time PCR assays were performed to determine the expression of I{kappa}B-{alpha} (A) and IL-8 (B).

IRAK-1 is translocated to the nucleus after TLR/IL-1R engagement
Because our data suggest that IRAK-1 can enhance NF-{kappa}B-dependent transcription without activation of IKK, we investigated the localization of exogenous IRAK-1 in inducible IRAK-1 expressing HEK-293-I1A cells. We performed cell fractionation assays and found exogenous IRAK-1 in both the cytoplasm and nucleus (Fig. 4 A). Surprisingly, the nuclear IRAK-1 was predominantly in modified forms that were presented in slower migration bands. Previous studies found that IRAK-1 undergoes phosphorylation and ubiquitination in response to LPS or IL-1 stimulation (17 18 19 , 42) . We therefore examined the localization of endogenous IRAK-1 after treatment of RAW264.7 or MCF-7 cells with LPS or IL-1. IRAK-1 in RAW264.7 and MCF-7 cells was found in higher molecular weight forms after LPS and IL-1β, but not TNF-{alpha} treatment (Fig. 4B, C ). Interestingly, modified IRAK-1 was significantly increased in the nuclear fraction on LPS or IL-1 stimulation (Fig. 4B, C ). In contrast, TLR4, which is located both on the cell surface and in the cytoplasm, and GAPDH, which is located in the cytoplasm, were not found in the nuclear fraction, demonstrating the purity of the nuclear fraction (Fig. 4B, C ). The increased nuclear concentrations of IRAK-1 in IL-1 stimulated cells suggested that IRAK-1 may shuttle between cytoplasm and nucleus. To examine this question, we treated the cells with leptomycin B (LMB), a CRM-1-dependent nuclear export inhibitor. We found that LMB caused a significant accumulation of IRAK-1 in the nucleus (Fig. 4D ). However, the IRAK-1 in the nuclear fraction was unmodified (Fig. 4D ).


Figure 4
View larger version (50K):
[in this window]
[in a new window]

 
Figure 4. IRAK-1 is present in both the cytoplasm and nucleus and translocates to the nucleus after TLR/IL-1R stimulation. A) Higher-molecular-weight forms of IRAK-1 are present in the nucleus in cells induced to express IRAK-1. HEK-293-I1A-Flag-IRAK-1 cells were induced to express IRAK-1. At the indicated time points after induction, the cells were collected and cell fractionation was performed. The level of IRAK-1 was determined by Western blot analysis. GAPDH was used as a cytoplasm marker. B) Nuclear IRAK-1 is increased after LPS stimulation. RAW 264.7 cells were either left untreated or were treated with 100 ng/ml LPS for 20 or 40 min. Cell fractionation was performed. The levels of IRAK-1, p65, GAPDH, and HDAC-1 were determined by Western blot analysis. C) IRAK-1 accumulates in the nucleus after cellular stimulation with IL-1β but not with TNF-{alpha}. MCF-7 cells were either left untreated or were treated with 10 ng/ml IL-1β, or 10 ng/ml of TNF-{alpha} for the indicated times. Cell fractionation was then performed. The levels of IRAK-1 and TLR4 were determined by Western blot analysis. D) IRAK-1 also accumulates in the nucleus after cellular stimulation with LMB. MCF-7 cells were either left untreated or were treated with 10 ng/ml IL-1β, 10 ng/ml of TNF-{alpha}, or 10 µg/ml of LMB for 2 h. Cell fractionation was then performed. The levels of IRAK-1, CBP, GAPDH, and tubulin were determined by Western blot analysis. E–G) Nuclear IRAK-1 is ubiquitinated. HEK-293-I1A-Flag-IRAK-1 cells were induced to express IRAK-1 for 4 h (E), HEK-293-TLR4/MD2/CD14 cells were treated with 100 ng/ml LPS for 30 min (F), or RAW264.7 cells were treated with 100 ng/ml LPS for 10 min (G). Cells were collected and lysed. Immunoprecipitation was then performed with rabbit anti-IRAK-1 antibodies followed by Western blot analysis with antiubiquitin and anti-IRAK-1 monoclonal antibodies. H) Nuclear localization of IRAK-1 is increased after treatment with IL-1β and/or leptomycin B. MCF-7 cells were treated with 10 ng/ml IL-1β and/or 10 µg/ml LMB for 2 h. Cells were fixed and incubated with anti-IRAK-1 monoclonal antibodies. DAPI was used to stain the nuclei, followed by confocal microscopy.

To determine the nature of modification of nuclear IRAK-1, we performed immunoprecipitation with anti-IRAK-1 antibodies followed by Western blot analysis with specific antibodies to ubiquitin, SUMO-1, and phosphorylated-serine/threonine. We found that the nuclear IRAK-1 in IRAK-1 overexpressing HEK-293-I1A cells, in LPS-stimulated TLR4/MD2/CD14 HEK-293 cells, and in LPS-stimulated RAW264.7 cells is associated with ubiquitin (Fig. 4E-G ), suggesting that ubiquitination plays a role in IRAK-1 nuclear translocation on TLR/IL-1R stimulation. However, we were unable to demonstrate sumoylation or phosphorylation of nuclear IRAK-1 (data not shown).

To further demonstrate the nuclear translocation of IRAK-1 on TLR/IL-1R stimulation, we performed confocal microscopy analysis. In unstimulated MCF-7 cells, endogenous IRAK-1 is predominantly localized in the cytoplasm (Fig. 4H , control). However, at 2 h after IL-1 stimulation, there is an increased amount of IRAK-1 in the nucleus (Fig. 4H , IL-1 2 h). Of note, although levels of nuclear IRAK-1 are relatively small as compared to those in the cytoplasm, these findings are consistent with data from cell fractionation assays demonstrating that only a small portion of modified IRAK-1 is translocated to the nucleus (Fig. 4A, B, D ). We also examined IRAK-1 nuclear translocation after leptomycin B treatment by confocal microscopy and found that LMB caused dramatic accumulation of IRAK-1 in the nucleus (Fig. 4H ). Simultaneous treatment of cells with IL-1 and LMB resulted in amounts of IRAK-1 nuclear staining that were comparable to those found after treatment with LMB alone, suggesting that LMB-induced IRAK-1 nuclear export blockade is a dominant effect.

IRAK-1 binds to the promoter of NF-{kappa}B-dependent gene
The presence of IRAK-1 in the nucleus, coupled with our findings that overexpression of IRAK-1 results in enhanced NF-{kappa}B-dependent gene expression, suggested that IRAK-1 might be directly involved in NF-{kappa}B-dependent transcriptional events, including association with the promoter region of NF-{kappa}B-dependent genes. To examine this question, we performed chromatin immunoprecipitation (ChIP) assays and found that IRAK-1 rapidly binds to the I{kappa}B-{alpha} promoter in MCF-7 cells after stimulation with IL-1 (Fig. 5 A, C). p65 also bound to the I{kappa}B-{alpha} promoter under these conditions (Fig. 5A ). To demonstrate the specificity of the ChIP assay, we amplified the GAPDH promoter from the DNA precipitated by anti-IRAK-1 antibody. We found minimal binding of IRAK-1 to the GAPDH promoter and also that the binding remained unchanged after cellular stimulation with IL-1. Moreover, IgG did not bind to the I{kappa}B-{alpha} promoter (Fig. 5A ). We also performed ChIP assays on the mouse macrophage cell line, RAW264.7. IRAK-1 bound to the I{kappa}B-{alpha} promoter in RAW264.7 cells on LPS stimulation (Figs. 5B, D ).


Figure 5
View larger version (8K):
[in this window]
[in a new window]

 
Figure 5. IRAK-1 is able to bind to the promoter of NF-{kappa}B-dependent gene. A) MCF-7 cells were treated with 10 ng/ml IL-1β for the indicated times. Cells were collected and chromatin immunoprecipitation (ChIP) assay performed as described in Materials and Methods. The promoter of the I{kappa}B-{alpha} gene was precipitated by incubation with polyclonal antibodies to p65 or monoclonal antibody to IRAK-1, or with mouse IgG and then was amplified using specific primers. DNA purified from 5% of the cell extract was used as input and was amplified for the I{kappa}B-{alpha} and GAPDH promoters. B) Densitometric analysis of IRAK-1 binding to the I{kappa}B-{alpha} promoter in A. The ratio of densitometric value of IRAK-1 binding to the I{kappa}B-{alpha} promoter to that of input sample before IL-1 stimulation was regarded as 1. C) RAW 264.7 cells were treated with 100 ng/ml LPS for the indicated times, and ChIP assay was then performed as described as in A. D) Densitometric analysis of IRAK-1 binding to the I{kappa}B-{alpha} promoter in A.

IRAK-1 enhances NF-{kappa}B binding to the promoter of NF-{kappa}B-dependent gene
Although nuclear translocation of p65 does not change during the first 2 h after IRAK-1 induction in HEK-293-I1A cells, enhanced binding of p65 to the promoters of NF-{kappa}B dependent genes, such as I{kappa}B-{alpha}, during this period could be a potential mechanism for their increased expression. To explore this possibility, ChIP assays were performed 2 or 4 h after tetracycline treatment of HEK-293-I1A cells expressing inducible Flag-tagged IRAK-1. IRAK-1 binding to the NF-{kappa}B-responsive elements within the I{kappa}B-{alpha} promoter was increased on IRAK-1 induction (Fig. 6 A–B). p65 binding to the two promoters was also increased after IRAK-1 induction (Fig. 6A ), suggesting that expression of IRAK-1 promotes p65 binding to NF-{kappa}B-responsive promoter elements.


Figure 6
View larger version (15K):
[in this window]
[in a new window]

 
Figure 6. IRAK-1 enhances p65 binding to the promoter of NF-{kappa}B-dependent gene. A) HEK-293-I1A-Flag-IRAK-1 cells were induced to express IRAK-1. At the indicated time points after induction, cells were collected and ChIP assays were performed as described as in Fig. 5 . The I{kappa}B-{alpha} promoter was amplified using specific primers. GAPDH promoter was amplified as a negative control. B) Densitometric analysis of IRAK-1 binding to the I{kappa}B-{alpha} promoter in A. The ratio of densitometric value of IRAK-1 binding to the I{kappa}B-{alpha} promoter to that of input sample before IRAK-1 induction was regarded as 1.

IRAK-1 phosphorylates histone H3 in vitro and is required for IL-1-induced phosphorylation of histone H3 at serine 10 in vivo
Phosphorylation of histone H3 occurs with active transcription (43 44 45) . Because IRAK-1 is a serine/threonine kinase, binds to NF-{kappa}B response elements, and activates the expression of NF-{kappa}B-dependent genes, it is possible that it may also be able to phosphorylate histone H3. In initial experiments using an in vitro kinase assay, we found that recombinant IRAK-1 purified from bacteria not only phosphorylates MBP, a putative IRAK-1 substrate, as previously shown by ourselves and others (46 , 47) , but also phosphorylates histone H3 (Fig. 7 A). However, IRAK-1 was unable to phosphorylate two unrelated proteins, HMGB1 and BSA, indicating the specificity of the assay (Fig. 7A ). IRAK-1 was also found to undergo autophosphorylation (Fig. 7A ), consistent with previous reports (41) . IRAK-1 overexpressed in HEK-293-I1A cells and purified by affinity purification was also able to phosphorylate MBP and histone H3 (Fig. 7B ).


Figure 7
View larger version (8K):
[in this window]
[in a new window]

 
Figure 7. IRAK-1 phosphorylates histone H3 in vitro and is required for IL-1-induced phosphorylation of histone H3 at serine 10 in vivo. A) Recombinant IRAK-1 phosphorylates histone H3. Kinase assays were performed as described in the Materials and Methods, using 1 µg of recombinant IRAK-1 as kinase and 1 µg of MBP, histone H3, recombinant HMGB1, or BSA as substrates. B) IRAK-1 expressed in mammalian cells phosphorylates histone H3. HEK-293-I1A cells were transfected with 1 µg of pcDNA3 or pcDNA3-Flag-IRAK-1. At 24 h after transfection, cells were collected and exogenous IRAK-1 was precipitated using anti-IRAK-1 antibodies. Kinase assays were performed as described in A. C) Phosphorylation of histone H3 at serine 10 is increased after IL-1 stimulation. MCF-7 cells were cultured in serum-free medium for 3 days. The cells were then treated with 10 ng/ml IL-1β. Cells were collected at the indicated time points after stimulation, and Western blot analysis was performed to detect the levels of histone H3 phosphorylated at serine 10, IRAK-1, and actin. D) IRAK-1 is required for IL-1-induced phosphorylation of histone H3 at serine 10 in vivo. MCF-7-IRAK-1 siRNA cells were cultured in serum-free medium for 3 days and then left uninduced or were induced for 3 days to knock down IRAK-1. The cells were then treated with IL-1 for 15, 30, or 60 min. Western blot analyses were performed to detect the levels of phosphorylated histone H3 at serine 10, IRAK-1, and actin.

To test whether endogenous histone H3 is phosphorylated in vivo after IL-1 stimulation, MCF-7 cells were cultured in serum-free medium for 3 days, and then treated with IL-1β for 30 or 60 min. As shown in Fig. 7C , phosphorylation of histone H3 at serine 10 was increased after IL-1β stimulation. To determine whether IRAK-1 is required for histone H3 phosphorylation after IL-1β treatment, MCF-7 cells expressing inducible IRAK-1 siRNA were cultured in serum-free medium and then induced or not for 3 days to knock down IRAK-1. The cells were then treated with IL-1β. Phosphorylation of histone H3 at serine 10 was increased in uninduced MCF-7 cells on IL-1β stimulation (Fig. 7D ). However, the increase in phosphorylation of histone H3 at serine 10 was abolished when IRAK-1 was knocked down (Fig. 7D ).


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
 
IRAK-1 is essential for TLR/IL-1R-mediated NF-{kappa}B activation, as shown by previous findings that IRAK-1-lacking cells have attenuated expression of NF-{kappa}B-dependent genes and also that IRAK-1-deficient mice are resistant to LPS-induced septic shock (37 , 48 49 50) . In addition, polymorphisms in IRAK-1 are associated with increased NF-{kappa}B-dependent transcriptional activity and enhanced nuclear translocation of NF-{kappa}B in LPS-stimulated neutrophils (51) .

The kinase activity of IRAK-1 does not appear to be necessary for its ability to activate NF-{kappa}B, as cells with kinase-dead IRAK-1 mutants still demonstrate normal IKK activation after TLR/IL-1R engagement (37 , 38 , 40) . Such results indicate that IRAK-1 can function as an adaptor, facilitating association of TRAF6, TAK1, and other kinases required for phosphorylation of IKK. However, as shown in the present experiments, even though expression of NF-{kappa}B-dependent genes is markedly inhibited in IRAK-1-deficient cells, I{kappa}B-{alpha} degradation still occurs after TLR/IL-1R engagement, indicating that IRAK-1 is not required for this process. These findings also suggest that IRAK-1 has additional activities, other than its participation in I{kappa}B-{alpha} degradation, that are responsible for its involvement in modulating NF-{kappa}B-dependent gene expression.

In these experiments, IL-1 induced NF-{kappa}B-dependent gene expression was markedly diminished in cells in which IRAK-1 levels were decreased through transient expression of IRAK-1-specific siRNA, even though I{kappa}B-{alpha} degradation and NF-{kappa}B nuclear translocation remained intact under these conditions. Such results indicate that whereas low levels of IRAK-1 are sufficient for IKK activation, higher expression is required for the participation of IRAK-1 in NF-{kappa}B-dependent transcriptional events. These data also suggest that IRAK-1 participates in NF-{kappa}B-associated transcriptional activity through mechanisms other than facilitating nuclear translocation of NF-{kappa}B.

It has been shown previously that overexpressed IRAK-1 usually undergoes autophosphorylation and is able to activate NF-{kappa}B, even when there are no extracellular stimuli (41) . In those studies, however, exogenous IRAK-1 was either stably expressed or transiently expressed for a prolonged period, allowing the autophosphorylated exogenous IRAK-1 to activate IKK and induce subsequent I{kappa}B-{alpha} degradation (21 , 37 38 39 40) . Thus, the previous experiments were unlikely to identify mechanisms, other than the classical one of IKK phosphorylation, which might participate in IRAK-1-mediated NF-{kappa}B activation. In the present experiments, we took advantage of a tet-on system, which permitted modulation of IRAK-1 expression over short time periods. Using this methodology, we found that overexpressed IRAK-1 stimulated NF-{kappa}B-dependent gene expression before there was any degradation of I{kappa}B-{alpha} or nuclear translocation of p65, indicating that IRAK-1 could modulate the transcriptional activity of NF-{kappa}B through mechanisms other than its participation in IKK activation.

IRAK-1 is phosphorylated, ubiquitinated, and undergoes proteasome-dependent degradation after cellular stimulation with IL-1 and LPS (17 18 19) . We found that nuclear localization of IRAK-1 is increased on IL-1 and LPS stimulation. The nuclear IRAK-1 found in IL-1 and LPS-stimulated cells is predominantly in a high-molecular-weight form and is ubiquitinated, suggesting that ubiquitination plays a role in IRAK-1 nuclear translocation. Protein ubiquitination includes K48 and K63 polyubiquitination, with K48 ubiquitination primarily mediating proteasome-dependent protein degradation, whereas K63 ubiquitination modulating a variety of molecular activities, including protein-protein interactions, transcriptional factor activity, and intracellular protein localization (20 , 52) . In addition to TLR ligation inducing ubiquitination leading to proteasome-mediated protein degradation, a recent study demonstrated that the Toll signaling component, Pellino, mediates K63 polyubiquitination of IRAK-1 (53) . K63 polyubiquitination has been shown to be involved in nuclear translocation of neurotrophin receptor interacting factor (NRIF) on stimulation of neuronal cells and such ubiquitination is mediated by TRAF6 (54) . Although we have demonstrated that IRAK-1 is translocated to nucleus and nuclear IRAK-1 is ubiquitinated, there is at present no direct evidence of an involvement of K63 polyubiquitination in IRAK-1 nuclear translocation. Furthermore, identification of the ubiquitin ligase that mediates polyubiquitination of IRAK-1, as well as determination of how polyubiquitination modulates nuclear IRAK-1 activity will require further investigation.

Treatment of cells with leptomycin B dramatically increased nuclear accumulation of IRAK-1, indicating that active CRM-1-dependent events are involved in regulating nuclear concentrations of IRAK-1. However, in leptomycin B-treated cells, the form of IRAK-1 that accumulates in the nucleus is unmodified IRAK-1. These findings indicate that IRAK-1 shuttles between cytoplasm and nucleus in unstimulated cells and that IL-1 or LPS stimulation-induced ubiquitination of IRAK-1 may either lead to enhanced nuclear translocation or inhibited export from the nucleus. How ubiquitination or other modification of IRAK-1 blocks nuclear export will require further investigation.

We found that IRAK-1 binds to the promoter of NF-{kappa}B-dependent gene, I{kappa}B-{alpha}. Moreover, IRAK-1 was able to promote the ability of p65 to bind to the promoter region of I{kappa}B-{alpha}. However, we were unable to detect any direct interaction between p65 and IRAK-1 on IL-1 stimulation. Therefore, it remains to be elucidated how IRAK-1 enhances p65 binding to the promoter of its target genes. Nevertheless, since the ability of p65 to bind to specific I{kappa}B gene promoter regions is well correlated with the transcriptional activity of NF-{kappa}B, the present experiments identify a novel mechanism by which IRAK-1 can mediate NF-{kappa}B-dependent transcriptional events.

Active transcription requires loosening of chromatin, which is composed of DNA wound on core histones (55) . Histone modification is a critical step in gene transcription. Notably, covalent modification of histone tails positively or negatively regulates gene expression (56 , 57) . Phosphorylation of histone H3 on serine 10 is known to correlate with active gene expression (43 44 45) . For example, previous studies showed that IKK-{alpha} is translocated to nucleus on cellular stimulation with TNF-{alpha} and is able to phosphorylate histone H3 at serine 10, an essential event in NF-{kappa}B-dependent gene expression (58 , 59) . We found that IRAK-1 is able to phosphorylate histone H3 at serine 10 in vitro and also that IRAK-1 is required for IL-1-stimulated phosphorylation of histone H3 at serine 10. Because phosphorylation of histone H3 at serine 10 is known to be involved in positive gene transcription, these results suggest that IRAK-1 may be able to regulate gene expression, independent of NF-{kappa}B.

The present experiments demonstrate a novel role for IRAK-1 in modulating transcription. In particular, because IRAK-1 translocates to the nucleus after TLR/IL-1R engagement and is capable of directly phosphorylating histone H3, it may independently function as a transcriptional regulatory factor. In addition, through facilitating association of p65 with binding sites in the promoters of NF-{kappa}B-dependent genes, nuclear IRAK-1 is capable of modulating NF-{kappa}B-associated transcriptional events. These findings add IRAK-1 to the growing list of NF-{kappa}B-associated molecules that shuttle into the nucleus and participate in regulation of NF-{kappa}B activity in both cytoplasmic and nuclear locations.


   ACKNOWLEDGMENTS
 
We thank Dr. Xiaoxia Li for the HEK293 I1A cell line. This work is supported by U.S. National Institutes of Health grants HL-62221 and HL-068743.

Received for publication November 4, 2007. Accepted for publication January 17, 2008.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
 

  1. Gan, L., Li, L. (2006) Regulations and roles of the interleukin-1 receptor associated kinases (IRAKs) in innate and adaptive immunity. Immunol. Res. 35,295-302[CrossRef][Medline]
  2. Janssens, S., Beyaert, R. (2003) Functional diversity and regulation of different interleukin-1 receptor-associated kinase (IRAK) family members. Mol. Cell 11,293-302[CrossRef][Medline]
  3. O'Neill, L. (2000) The Toll/interleukin-1 receptor domain: a molecular switch for inflammation and host defence. Biochem. Soc. Trans. 28,557-563[Medline]
  4. O'Neill, L. A. (2006) How Toll-like receptors signal: what we know and what we don’t know. Curr. Opin. Immunol. 18,3-9[CrossRef][Medline]
  5. Yamamoto, M., Takeda, K., Akira, S. (2004) TIR domain-containing adaptors define the specificity of TLR signaling. Mol. Immunol. 40,861-868[CrossRef][Medline]
  6. Akira, S., Uematsu, S., Takeuchi, O. (2006) Pathogen recognition and innate immunity. Cell 124,783-801[CrossRef][Medline]
  7. Honda, K., Taniguchi, T. (2006) IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors. Nat. Rev. Immunol. 6,644-658[CrossRef][Medline]
  8. Medzhitov, R. (2001) Toll-like receptors and innate immunity. Nat. Rev. Immunol. 1,135-145[CrossRef][Medline]
  9. Moynagh, P. N. (2005) TLR signalling and activation of IRFs: revisiting old friends from the NF-{kappa}B pathway. Trends Immunol. 26,469-476[CrossRef][Medline]
  10. Trinchieri, G., Sher, A. (2007) Cooperation of Toll-like receptor signals in innate immune defence. Nat. Rev. Immunol. 7,179-190[CrossRef][Medline]
  11. Burns, K., Clatworthy, J., Martin, L., Martinon, F., Plumpton, C., Maschera, B., Lewis, A., Ray, K., Tschopp, J., Volpe, F. (2000) Tollip, a new component of the IL-1RI pathway, links IRAK to the IL-1 receptor. Nat. Cell Biol. 2,346-351[CrossRef][Medline]
  12. Burns, K., Martinon, F., Esslinger, C., Pahl, H., Schneider, P., Bodmer, J. L., Di Marco, F., French, L., Tschopp, J. (1998) MyD88, an adapter protein involved in interleukin-1 signaling. J. Biol. Chem. 273,12203-12209[Abstract/Free Full Text]
  13. Huang, J., Gao, X., Li, S., Cao, Z. (1997) Recruitment of IRAK to the interleukin 1 receptor complex requires interleukin 1 receptor accessory protein. Proc. Natl. Acad. Sci. U. S. A. 94,12829-12832[Abstract/Free Full Text]
  14. Medzhitov, R., Preston-Hurlburt, P., Kopp, E., Stadlen, A., Chen, C., Ghosh, S., Janeway, C. A., Jr (1998) MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways. Mol. Cell 2,253-258[CrossRef][Medline]
  15. Muzio, M., Ni, J., Feng, P., Dixit, V. M. (1997) IRAK (Pelle) family member IRAK-2 and MyD88 as proximal mediators of IL-1 signaling. Science 278,1612-1615[Abstract/Free Full Text]
  16. Wesche, H., Henzel, W. J., Shillinglaw, W., Li, S., Cao, Z. (1997) MyD88: an adapter that recruits IRAK to the IL-1 receptor complex. Immunity 7,837-847[CrossRef][Medline]
  17. Burns, K., Janssens, S., Brissoni, B., Olivos, N., Beyaert, R., Tschopp, J. (2003) Inhibition of interleukin 1 receptor/Toll-like receptor signaling through the alternatively spliced, short form of MyD88 is due to its failure to recruit IRAK-4. J. Exp. Med. 197,263-268[Abstract/Free Full Text]
  18. Li, S., Strelow, A., Fontana, E. J., Wesche, H. (2002) IRAK-4: a novel member of the IRAK family with the properties of an IRAK-kinase. Proc. Natl. Acad. Sci. U. S. A. 99,5567-5572[Abstract/Free Full Text]
  19. Suzuki, N., Suzuki, S., Yeh, W. C. (2002) IRAK-4 as the central TIR signaling mediator in innate immunity. Trends Immunol. 23,503-506[CrossRef][Medline]
  20. Chen, Z. J. (2005) Ubiquitin signalling in the NF-{kappa}B pathway. Nat. Cell Biol. 7,758-765[CrossRef][Medline]
  21. Li, X., Commane, M., Jiang, Z., Stark, G. R. (2001) IL-1-induced NF-{kappa}B and c-Jun N-terminal kinase (JNK) activation diverge at IL-1 receptor-associated kinase (IRAK). Proc. Natl. Acad. Sci. U. S. A. 98,4461-4465[Abstract/Free Full Text]
  22. Qian, Y., Commane, M., Ninomiya-Tsuji, J., Matsumoto, K., Li, X. (2001) IRAK-mediated translocation of TRAF6 and TAB2 in the interleukin-1-induced activation of NF-{kappa}B. J. Biol. Chem. 276,41661-41667[Abstract/Free Full Text]
  23. Takaesu, G., Ninomiya-Tsuji, J., Kishida, S., Li, X., Stark, G. R., Matsumoto, K. (2001) Interleukin-1 (IL-1) receptor-associated kinase leads to activation of TAK1 by inducing TAB2 translocation in the IL-1 signaling pathway. Mol. Cell. Biol. 21,2475-2484[Abstract/Free Full Text]
  24. Takaesu, G., Kishida, S., Hiyama, A., Yamaguchi, K., Shibuya, H., Irie, K., Ninomiya-Tsuji, J., Matsumoto, K. (2000) TAB2, a novel adaptor protein, mediates activation of TAK1 MAPKKK by linking TAK1 to TRAF6 in the IL-1 signal transduction pathway. Mol. Cell 5,649-658[CrossRef][Medline]
  25. Hoffmann, A., Natoli, G., Ghosh, G. (2006) Transcriptional regulation via the NF-{kappa}B signaling module. Oncogene 25,6706-6716[CrossRef][Medline]
  26. Natoli, G., Saccani, S., Bosisio, D., Marazzi, I. (2005) Interactions of NF-{kappa}B with chromatin: the art of being at the right place at the right time. Nat. Immunol. 6,439-445[CrossRef][Medline]
  27. Sanjabi, S., Williams, K. J., Saccani, S., Zhou, L., Hoffmann, A., Ghosh, G., Gerondakis, S., Natoli, G., Smale, S. T. (2005) A c-Rel subdomain responsible for enhanced DNA-binding affinity and selective gene activation. Genes Dev. 19,2138-2151[Abstract/Free Full Text]
  28. Chen, L. F., Greene, W. C. (2004) Shaping the nuclear action of NF-{kappa}B. Nat. Rev. Mol. Cell. Biol. 5,392-401[CrossRef][Medline]
  29. Quivy, V., Van Lint, C. (2004) Regulation at multiple levels of NF-{kappa}B-mediated transactivation by protein acetylation. Biochem. Pharmacol. 68,1221-1229[CrossRef][Medline]
  30. Vermeulen, L., De Wilde, G., Van Damme, P., Vanden Berghe, W., Haegeman, G. (2003) Transcriptional activation of the NF-kappaB p65 subunit by mitogen- and stress-activated protein kinase-1 (MSK1). EMBO J. 22,1313-1324[CrossRef][Medline]
  31. Viatour, P., Bentires-Alj, M., Chariot, A., Deregowski, V., de Leval, L., Merville, M. P., Bours, V. (2003) NF- {kappa}B2/p100 induces Bcl-2 expression. Leukemia 17,1349-1356[CrossRef][Medline]
  32. Perkins, N. D. (2006) Post-translational modifications regulating the activity and function of the nuclear factor-{kappa}B pathway. Oncogene 25,6717-6730[CrossRef][Medline]
  33. Bol, G., Kreuzer, O. J., Brigelius-Flohe, R. (2000) Translocation of the interleukin-1 receptor-associated kinase-1 (IRAK-1) into the nucleus. FEBS Lett. 477,73-78[CrossRef][Medline]
  34. Li, L., Cousart, S., Hu, J., McCall, C. E. (2000) Characterization of interleukin-1 receptor-associated kinase in normal and endotoxin-tolerant cells. J. Biol. Chem. 275,23340-23345[Abstract/Free Full Text]
  35. Su, J., Richter, K., Zhang, C., Gu, Q., Li, L. (2007) Differential regulation of interleukin-1 receptor associated kinase 1 (IRAK1) splice variants. Mol. Immunol. 44,900-905[CrossRef][Medline]
  36. Huang, Y., Li, T., Sane, D. C., Li, L. (2004) IRAK1 serves as a novel regulator essential for lipopolysaccharide-induced interleukin-10 gene expression. J. Biol. Chem. 279,51697-51703[Abstract/Free Full Text]
  37. Li, X., Commane, M., Burns, C., Vithalani, K., Cao, Z., Stark, G. R. (1999) Mutant cells that do not respond to interleukin-1 (IL-1) reveal a novel role for IL-1 receptor-associated kinase. Mol. Cell. Biol. 19,4643-4652[Abstract/Free Full Text]
  38. Knop, J., Martin, M. U. (1999) Effects of IL-1 receptor-associated kinase (IRAK) expression on IL-1 signaling are independent of its kinase activity. FEBS Lett. 448,81-85[CrossRef][Medline]
  39. Knop, J., Wesche, H., Lang, D., Martin, M. U. (1998) Effects of overexpression of IL-1 receptor-associated kinase on NF-{kappa}B activation, IL-2 production and stress-activated protein kinases in the murine T cell line EL4. Eur. J. Immunol. 28,3100-3109[CrossRef][Medline]
  40. Maschera, B., Ray, K., Burns, K., Volpe, F. (1999) Overexpression of an enzymically inactive interleukin-1-receptor-associated kinase activates nuclear factor-{kappa}B. Biochem. J. 339,227-231[CrossRef][Medline]
  41. Kollewe, C., Mackensen, A. C., Neumann, D., Knop, J., Cao, P., Li, S., Wesche, H., Martin, M. U. (2004) Sequential autophosphorylation steps in the interleukin-1 receptor-associated kinase-1 regulate its availability as an adapter in interleukin-1 signaling. J. Biol. Chem. 279,5227-5236[Abstract/Free Full Text]
  42. Yamin, T. T., Miller, D. K. (1997) The interleukin-1 receptor-associated kinase is degraded by proteasomes following its phosphorylation. J. Biol. Chem. 272,21540-21547[Abstract/Free Full Text]
  43. Dong, Z., Bode, A. M. (2006) The role of histone H3 phosphorylation (Ser10 and Ser28) in cell growth and cell transformation. Mol Carcinog. 45,416-421[CrossRef][Medline]
  44. Nowak, S. J., Corces, V. G. (2004) Phosphorylation of histone H3: a balancing act between chromosome condensation and transcriptional activation. Trends Genet. 20,214-220[CrossRef][Medline]
  45. Prigent, C., Dimitrov, S. (2003) Phosphorylation of serine 10 in histone H3, what for?. J. Cell Sci. 116,3677-3685[Abstract/Free Full Text]
  46. Asehnoune, K., Strassheim, D., Mitra, S., Kim, J. Y., Abraham, E. (2004) Involvement of reactive oxygen species in Toll-like receptor 4-dependent activation of NF-{kappa}B. J. Immunol. 172,2522-2529[Abstract/Free Full Text]
  47. Jacinto, R., Hartung, T., McCall, C., Li, L. (2002) Lipopolysaccharide- and lipoteichoic acid-induced tolerance and cross-tolerance: distinct alterations in IL-1 receptor-associated kinase. J. Immunol. 168,6136-6141[Abstract/Free Full Text]
  48. Kanakaraj, P., Schafer, P. H., Cavender, D. E., Wu, Y., Ngo, K., Grealish, P. F., Wadsworth, S. A., Peterson, P. A., Siekierka, J. J., Harris, C. A., Fung-Leung, W. P. (1998) Interleukin (IL)-1 receptor-associated kinase (IRAK) requirement for optimal induction of multiple IL-1 signaling pathways and IL-6 production. J. Exp. Med. 187,2073-2079[Abstract/Free Full Text]
  49. Swantek, J. L., Tsen, M. F., Cobb, M. H., Thomas, J. A. (2000) IL-1 receptor-associated kinase modulates host responsiveness to endotoxin. J. Immunol. 164,4301-4306[Abstract/Free Full Text]
  50. Thomas, J. A., Allen, J. L., Tsen, M., Dubnicoff, T., Danao, J., Liao, X. C., Cao, Z., Wasserman, S. A. (1999) Impaired cytokine signaling in mice lacking the IL-1 receptor-associated kinase. J. Immunol. 163,978-984[Abstract/Free Full Text]
  51. Arcaroli, J., Silva, E., Maloney, J. P., He, Q., Svetkauskaite, D., Murphy, J. R., Abraham, E. (2006) Variant IRAK-1 haplotype is associated with increased nuclear factor-{kappa}B activation and worse outcomes in sepsis. Am. J. Respir. Crit. Care Med. 173,1335-1341[Abstract/Free Full Text]
  52. Haglund, K., Dikic, I. (2005) Ubiquitylation and cell signaling. EMBO J. 24,3353-3359[CrossRef][Medline]
  53. Ordureau, A., Smith, H., Windheim, M., Peggie, M., Carrick, E., Morrice, N., Cohen, P. (2008) The IRAK-catalysed activation of the E3 ligase function of Pellino isoforms induces the Lys63-linked polyubiquitination of IRAK1. Biochem. J. 409,43-52[CrossRef][Medline]
  54. Geetha, T., Kenchappa, R. S., Wooten, M. W., Carter, B. D. (2005) TRAF6-mediated ubiquitination regulates nuclear translocation of NRIF, the p75 receptor interactor. EMBO J. 24,3859-3868[CrossRef][Medline]
  55. Emerson, B. M. (2002) Specificity of gene regulation. Cell 109,267-270[CrossRef][Medline]
  56. Cheung, P., Allis, C. D., Sassone-Corsi, P. (2000) Signaling to chromatin through histone modifications. Cell 103,263-271[CrossRef][Medline]
  57. Kadam, S., Emerson, B. M. (2002) Mechanisms of chromatin assembly and transcription. Curr. Opin. Cell Biol. 14,262-268[CrossRef][Medline]
  58. Anest, V., Hanson, J. L., Cogswell, P. C., Steinbrecher, K. A., Strahl, B. D., Baldwin, A. S. (2003) A nucleosomal function for I{kappa}B kinase-alpha in NF-{kappa}B-dependent gene expression. Nature 423,659-663[CrossRef][Medline]
  59. Yamamoto, Y., Verma, U. N., Prajapati, S., Kwak, Y. T., Gaynor, R. B. (2003) Histone H3 phosphorylation by IKK-alpha is critical for cytokine-induced gene expression. Nature 423,655-659[CrossRef][Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
Y. Li, T. G. VandenBoom II, Z. Wang, D. Kong, S. Ali, P. A. Philip, and F. H. Sarkar
miR-146a Suppresses Invasion of Pancreatic Cancer Cells
Cancer Res., February 15, 2010; 70(4): 1486 - 1495.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
C. Behrens, L. Feng, H. Kadara, H.-J. Kim, J. J. Lee, R. Mehran, W. K. Hong, R. Lotan, and I. I. Wistuba
Expression of Interleukin-1 Receptor-Associated Kinase-1 in Non-Small Cell Lung Carcinoma and Preneoplastic Lesions
Clin. Cancer Res., January 1, 2010; 16(1): 34 - 44.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
E. Lorne, X. Zhao, J. W. Zmijewski, G. Liu, Y.-J. Park, Y. Tsuruta, and E. Abraham
Participation of Mammalian Target of Rapamycin Complex 1 in Toll-Like Receptor 2- and 4-Induced Neutrophil Activation and Acute Lung Injury
Am. J. Respir. Cell Mol. Biol., August 1, 2009; 41(2): 237 - 245.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Liu, Y.-J. Park, Y. Tsuruta, E. Lorne, and E. Abraham
p53 Attenuates Lipopolysaccharide-Induced NF-{kappa}B Activation and Acute Lung Injury
J. Immunol., April 15, 2009; 182(8): 5063 - 5071.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Song, G. Liu, C. A. Bosworth, J. R. Walker, G. A. Megaw, A. Lazrak, E. Abraham, W. M. Sullender, and S. Matalon
Respiratory Syncytial Virus Inhibits Lung Epithelial Na+ Channels by Up-regulating Inducible Nitric-oxide Synthase
J. Biol. Chem., March 13, 2009; 284(11): 7294 - 7306.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.07-101816v1
22/7/2285    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Liu, G.
Right arrow Articles by Abraham, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Liu, G.
Right arrow Articles by Abraham, E.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS