|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
B activation requires cytosolic and nuclear activityDepartment of Medicine, University of Alabama at Birmingham, Birmingham, Alabama, USA
1Correspondence: Department of Medicine, University of Alabama at Birmingham School of Medicine, 420 Boshell Bldg., 1808 7th Ave., South, Birmingham, AL 35294, USA. E-mail: eabraham{at}uab.edu
| ABSTRACT |
|---|
|
|
|---|
B activation through its involvement in IKK activation, which then leads to subsequent I
B degradation and NF-
B nuclear translocation. In the present studies, we demonstrate a novel pathway in which IRAK-1 present in the nucleus participates in NF-
B-dependent gene expression. Nuclear localization of IRAK-1 is increased on cellular stimulation with IL-1 and LPS, or CRM-1-dependent nuclear export blockade. Induction of IRAK-1 produces enhanced NF-
B transcriptional activity that precedes I
B-
degradation and nuclear translocation of NF-
B. IRAK-1 binds to the promoter of NF-
B-regulated gene, I
B-
, and enhances binding of the NF-
B p65 subunit to NF-
B responsive elements within the I
B-
promoter. IRAK-1 phosphorylates histone H3 in vitro and is required for IL-1-induced phosphorylation of histone H3 at serine 10 in vivo. These data indicate that both cytosolic and nuclear actions of IRAK-1 participate in the activation of NF-
B-dependent transcriptional events.—Liu, G., Park, Y.-J., Abraham, E. Interleukin-1 receptor-associated kinase (IRAK) -1-mediated NF-
B activation requires cytosolic and nuclear activity.
Key Words: transcription histone H3 nuclear translocation Toll-like receptor
| INTRODUCTION |
|---|
|
|
|---|
B, mitogen-activated protein kinases (MAPKs), and interferon-responsive factors (IRFs) (6
Engagement of TLRs with extracellular ligands leads to recruitment of Myd88, as well as Tollip associated with interleukin-1 receptor-associated kinase (IRAK) -1, to the TIR domain (11
12
13
14
15
16)
. IRAK-4 is then brought into proximity of IRAK-1 via interaction with Myd88, resulting in phosphorylation of IRAK-1 both by autophosphorylation and by IRAK-4 (17
18
19)
. Activated IRAK-1 is able to associate with TRAF6, an E3 ubiquitin ligase (20)
. The IRAK-1 and TRAF6 complex recruits TAK1, TAB1, and TAB2 to the TIR domain (21
22
23)
. The complex containing TRAF6, TAK-1, TAB1, and TAB2 then reenters the cytosol where TRAF6, together with TAB1 and TAB2, activates TAK-1 (21
22
23)
. Activated TAK-1 subsequently activates IKK
/β, resulting in I
B-
phosphorylation, ubiquitination, degradation, and nuclear translocation of p65-containing NF-
B complexes (24)
.
Although nuclear translocation of p65 is primarily controlled by I
B proteins, transcriptional activity of p65 requires binding to NF-
B-responsive elements within the promoters of its target genes (25
26
27)
. A variety of post-translational modifications, such as phosphorylation and acetylation, modulates NF-
B DNA-binding (28
29
30
31)
. In addition, the transcriptional ability of NF-
B is also regulated through interactions with nuclear coactivating proteins (32)
.
Although the primary function of IRAK-1 is thought to be its participation in cytoplasmic events following TLR engagement that leads to activation of the IKK complex, degradation of I
B-
, and translocation of NF-
B to the nucleus, there are data indicating that IRAK-1 can be present in the nucleus (33
34
35
36)
. We therefore hypothesized that IRAK-1 could directly participate in NF-
B-related transcriptional events, independent of its involvement in IKK activation.
In these studies, we found that transient overexpression of IRAK-1 results in enhanced transcriptional activity of NF-
B even without concurrent I
B-
degradation or increased nuclear translocation of p65. Nuclear localization of IRAK-1 was increased by IL-1R engagement with IL-1 and led to IRAK-1 binding to NF-
B-dependent promoter sites, as well as to phosphorylation of histone H3. Collectively, these findings demonstrate a novel role for IRAK-1 in which it directly participates in NF-
B-associated transcriptional events.
| EXPERIMENTAL PROCEDURES |
|---|
|
|
|---|
Plasmids
pcDNA3-Flag-IRAK-1 that expresses full-length human IRAK-1 with a Flag epitope at N terminus was obtained from Dr. Michael U. Martin (Hannover Medical School, Hannover, Germany). To generate a construct that expresses Flag-IRAK-1 under the control of tetracycline, the full length cDNA in pcDNA3-Flag-IRAK-1 was cut by HindIII and EcoRI and cloned into pcDNA4/TO (Invitrogen, Carlsbad, CA, USA). The resulting construct was termed pcDNA4-Flag-IRAK-1. To generate a construct that can inducibly express IRAK-1 siRNA under the control of tetracycline, two complementary DNA oligos were synthesized and annealed. The sequence for the oligos were sense 5' GATC CCC GGTTGTCCTTGAGTAATAA TTCAAGAGA TTATTACTCAAGGACAACC TTTTTGGAAA 3' and antisense 5' AGCT TTTCCAAAAA GGTTGTCCTTGAGTAATAA TCTCTTGAA TTATTACTCAAGGACAACC GGG, with the IRAK-1 siRNA sequence listed in bolded italics. The annealed double-stranded oligo was then cloned into pBabe-H1-Tet-O at HindIII and EcoRI sites. The resulting construct was termed as pBabe-H1-Tet-O-IRAK-1 siRNA. The expression of IRAK-1 siRNA was initiated by the RNA polymerase III promoter, H1.
Generation of stable cell lines
To generate a HEK-293-I1A cell line that can inducibly express exogenous IRAK-1, a tet-on system was used. First, HEK-293-I1A was transfected with pcDNA6, which can express a tet repressor. The transfected cells were selected with blasticidin for 2 wk. A single colony was isolated and checked for expression of the tet repressor. The positive clone was then transfected with pcDNA4-Flag-IRAK-1. The cells were selected with zeocin for 2 wk, and a single colony was isolated and amplified. An individual cell clone was uninduced or induced to express Flag-IRAK-1. One positive clone (HEK-293-I1A-Flag-IRAK-1#1) was used for the study. To generate a cell line that can inducibly express IRAK-1 siRNA, MCF-7-TR cells that express the tet repressor were transfected with pBabe-H1-Tet-O-IRAK-1 siRNA. Cells were selected with blasticidin and puromycin for 2 wk, and a positive clone (MCF-7-IRAK-1 siRNA#1) was used for subsequent experiments.
Real-time RT-PCR
Total RNA was purified with TRI reagent (Sigma, St. Louis, MO, USA). cDNA was synthesized using Taqman reverse transcription reagents (Roche Diagnostics, Mannheim, Germany). Real-time PCR was performed using a Lightcycler 480 SYBR Green I Master system (Roche) according to the manufacturers instructions. The primers used to amplify human IL-8 transcripts were forward, 5' GTG CAG TTT TGC CAA GGA GT 3' and reverse, 5' CTC TGCACC CAG TTT TCC TT 3'. The primers for human I
B-
were: forward, 5' CCC TGT AAT GGC CGG ACT G 3' and reverse, 5' CAG CAT CTG AAG GTT TTC TAG TG 3'. Human glyceraldehyde 3-phosphate dehydrogenase (GAPDH) transcript was used as an internal control. The primers for GAPDH were forward, 5' GCG AGA TCC CTC CAA AAT CAA 3' and reverse, 5' GTT CAC ACC CAT GAC GAA CAT 3'.
Cytokine ELISA
Immunoreactive human tumor necrosis factor-
(TNF-
) was quantified using commercially available ELISA kits (R&D Systems, Minneapolis, MN, USA), according to the manufacturers instructions.
Immunoblotting assay
Cells were washed 2x with cold PBS. Cells were then lysed in 0.1% Triton X-100 lysis buffer (50 mM sodium phosphate, 150 mM sodium chloride, 5 mM EDTA, 0.1% Triton X-100, pH, 7.4), supplemented with 1:100 protease inhibitor cocktail (Sigma) and 1:100 phosphotase inhibitor cocktail (Pierce Biotechnology, Rockford, IL, USA). Protein concentrations were measured using a Dc protein assay kit (Bio-Rad, Hercules, CA, USA) according to the manufacturers instructions. Thirty micrograms of total protein was resolved by SDS-PAGE gel and transferred to nitrocellulose membrane. The membrane was blotted with specific antibodies and protein expression was detected using Supersignal ECL (Pierce). Mouse anti-IRAK-1 monoclonal antibody, rabbit antip65 polyclonal antibodies, rabbit anti-CBP polyclonal antibodies, rabbit anti-GAPDH polyclonal antibodies, rabbit anti-HDAC-1 polyclonal antibodies, rabbit anti-TLR4 polyclonal antibodies, and mouse anti-tubulin monoclonal antibody were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Rabbit anti-actin polyclonal antibodies and mouse anti-Flag monoclonal antibody were from Sigma. Rabbit anti-I
B-
antibodies were purchased from Cell Signaling (Danvers, MA, USA). Mouse anti-phosphorylated histone H3 at serine 10 monoclonal antibody was purchased from Upstate Biotechnology (Lake Placid, NY, USA).
Immunoprecipitation assay
Cells were lysed in 0.1% Nonidet P-40 lysis buffer (50 mM Tris-Cl, pH 8.0; 137 mM sodium chloride; 2 mM EDTA; 5% glycerol; 0.1% Nonidet P-40), supplemented with 1:100 protease inhibitor cocktail (Sigma) and 1:100 phosphotase inhibitor cocktail (Pierce). The lysates were precleared by centrifugation at 14,000 rpm, supernatants were collected, and protein concentration was measured. Equal amounts of cell extracts from different experimental groups were combined with 2.0 µg/ml rabbit anti-IRAK-1 antibody and 35 µl protein G agarose beads. The extracts were then rotated at 4°C for 3 h, and the protein G beads were spun down and washed 4x with lysis buffer. The immunocomplexes were eluted with 1x SDS sample buffer,and proteins were resolved by SDS-PAGE.
Chromatin immunoprecipitation assay
After various treatments, cells were fixed with 1% of formaldehyde for 10 min. Cells were collected in cold PBS and resuspended in 1 ml of TE buffer. Genomic DNA was then sheared to lengths ranging from 200 to 1000 bp by sonication. 5% of cell extract was taken out as input,and the rest of the extract was incubated with various antibodies (rabbit anti-IRAK-1 polyclonal antibodies, rabbit anti-p65 polyclonal antibodies, or mouse anti-Flag monoclonal antibody) overnight, followed by precipitation with protein G agarose beads. Mouse IgG was used to replace specific antibodies to serve as a negative control. Genomic DNA in the immunocomplexes was purified by Qiagen miniprep column (Qiagen, Valencia, CA, USA), and the NF-
B-responsive element in the promoter of NF-
B target genes were amplified by PCR. The primer sequence for amplification of NF-
B-responsive elements in the promoter of human I
B-
gene was sense 5' AGAGGGACAGGATTACAGGGTGC 3' and antisense 5' CCAAGCCAGTCAGACCAGAAAA 3'. The primer sequence for amplification of NF-
B-responsive elements in the promoter of mouse I
B-
gene was sense 5' TGGCGAGGTCTGACTGTTGTGG 3' and antisense 5' GCTCATCAAAAAGTTCCCTGTGC 3'. The primer sequence for amplification of the human GAPDH promoter was sense 5' CAGGAAAGGCAATCCCAGAAAGG 3' and antisense 5' GGAGGGTGCTGAACACTTGTAAGG 3'.
Kinase assay
HEK-293-I1A cells were transfected with pcDNA3 and pcDNA3-Flag-IRAK-1. At 24 h after transfection, cells were washed 2x with cold PBS and lysed in 0.1% Triton X-100 lysis buffer. IRAK-1 was immunoprecipitated by anti-IRAK-1 antibody and protein G agarose. The beads were washed 3x with 0.1% Triton X-100 lysis buffer, and 2x with kinase buffer (20 mM HEPES, pH 7.6; 20 mM MgCl2). The beads were then incubated at 37°C in a final volume of 50 µl of kinase buffer in the presence of MBP (Sigma) and histone H3 (Upstate) as substrates (1 µg/sample), 100 µM ATP, and 2.5 µCi of (32P)ATP (Amersham, Piscataway, NJ, USA). After SDS sample buffer was added to the protein G beads, the samples were boiled for 10 min and then subjected to SDS-PAGE analysis. The gel was transferred to a nitrocellulose membrane and exposed to film. After obtaining a radioautograph, the membrane was blotted with total anti-IRAK-1 antibody to determine that an equal amount of precipitated IRAK-1 was present in each sample. The in vitro kinase assay was also performed using recombinant IRAK-1 (Upstate). One microgram of recombinant IRAK-1 was used with each substrate. Recombinant protein HMGB1 and BSA were used as negative controls.
Isolation of nuclei
Cells were collected in phosphate-buffered saline (PBS) and centrifuged. The cell pellet was resuspended with 500 µl of lysis buffer (10 mM Tris, pH 7.5, 10 mM NaCl, 3 mM MgCl2, 0.05% Nonidet P-40, 1 mM EGTA, 1:100 protease inhibitor cocktail, and 1:100 phosphotase inhibitor cocktail). Lysed cells were collected in microcentrifuge tubes and centrifuged at 2700 g for 10 min at 4°C. The supernatant containing the cytosol was further centrifuged at 20,800 g for 15 min at 4°C to obtain the cytosolic fraction. The nuclei in the pellet were washed 3x by gently resuspending the nuclei in 200 µl of wash buffer (10 mM PIPES, pH 6.8; 300 mM sucrose; 3 mM MgCl2; 1 mM EGTA; 25 mM NaCl; 1:100 protease inhibitor cocktail; and 1:100 phosphatase inhibitor cocktail) and centrifuging at 2700 g for 5 min at 4°C. For a final wash, the nuclei were resuspended in 100 µl of wash buffer, layered over a cushion of 1 ml of sucrose buffer (1 M sucrose), and centrifuged at 2700 g for 10 min. The sucrose buffer containing nonsedimented cellular debris was discarded, and the pellet-containing nuclei was washed in 100 µl of lysis buffer and centrifuged at 2700 g for 5 min at 4°C to remove residual sucrose buffer.
Confocal microscopy
Cells were fixed in 3% formaldehyde for 30 min. After being permeabilized with 0.5% Triton X-100 for 3 min, the cells were blocked in PBS containing 5% BSA for 1 h. Cells were then incubated with IRAK-1 antibody overnight at 4°C. Cells were washed 3x and incubated with FITC-conjugated or Texas-red-conjugated secondary antibody for 1 h. Cells were then incubated with DAPI for nucleus staining. Fluorescent images were taken with a Leica confocal microscope (Leica Microsystems, Bannockburn, IL, USA).
Densitometric and statistical analyses
Densitometry of Western blots was performed by AlphaEaseFC 4.0 software (Alpha Innotech, San Leandro, CA, USA). Students t test was used for comparisons between two groups. A value of P < 0.05 was considered significant.
| RESULTS |
|---|
|
|
|---|
B-
degradation, NF-
B nuclear translocation, and NF-
B-dependent gene expression are impaired, but not absent, in IRAK-1-null cells
B activation, we took advantage of a HEK-293-derived cell line, HEK-293-I1A, which is deficient in IRAK-1 (37)
B-
in HEK-293 and HEK-293-I1A cells were determined. In HEK-293 cells, degradation of I
B-
could be detected as early as 15 min after IL-1 stimulation, with almost complete degradation present at 60 min (Fig. 1
B-
degradation in HEK-293-I1A cells (Fig. 1A
B-
degradation after IL-1R engagement, and that kinases other than IRAK-1 participate in regulation of I
B-
levels. However, the extent of I
B-
degradation in HEK-293-I1A cells was less at each time point after IL-1 stimulation as compared to that in HEK-293 cells (Fig. 1A
B-
degradation.
|
Because I
B-
degradation is diminished in HEK-293-I1A cells, we examined whether nuclear translocation of the NF-
B p65 subunit is affected in the absence of IRAK-1. Increased nuclear translocation of p65 was found within 15 min after IL-1 stimulation in both HEK-293 and HEK-293-I1A cell lines (Figs. 1B, C
). However, after normalizing the level of nuclear p65 to that of CBP, p65 translocation in HEK-293 I1A cells was clearly reduced when compared with that in HEK-293 cells at each time point after IL-1 stimulation (Fig. 1D
). These data are consistent with decreased I
B-
degradation in HEK-293 I1A cells being associated with diminished nuclear translocation of NF-
B after IL-1-induced cellular stimulation.
We next determined the expression of a well-defined NF-
B-regulated gene, I
B-
, on IL-1 stimulation in HEK-293 and HEK-293-I1A cells. The expression of I
B-
was significantly higher in HEK-293 than in HEK-293 I1A cells after IL-1 exposure (Fig. 1E
). Together, these findings indicate that while IRAK-1 is not required for NF-
B-dependent gene expression, I
B-
degradation, and NF-
B nuclear translocation, IRAK-1 still plays a central regulatory role in each of these processes.
IRAK-1 knockdown does not affect I
B-
degradation or p65 nuclear translocation, but does attenuate NF-
B-dependent gene expression
The above results indicated that even though I
B-
degradation is decreased in IRAK-1-null cells after IL-1 treatment, IRAK-1 is not essential for I
B-
degradation after TLR/IL-1R engagement. This raises the question of the relative involvement of IRAK-1 in modulating the activation of NF-
B and expression of NF-
B dependent genes. To address this question, we generated a cell line that inducibly expressed IRAK-1 siRNA under the control of tetracycline. In these cells, the level of IRAK-1 is reduced on induction of IRAK-1 siRNA by adding tetracycline into the culture medium (Fig. 2
A, B, D).
|
There was equal degradation of I
B-
after IL-1 treatment of cells that were uninduced or induced to express IRAK-1 siRNA (Fig. 2A
). This finding suggests that the residual IRAK-1 in IRAK-1 knockdown cells is sufficient for I
B-
degradation on IL-1 stimulation. To determine whether the similar degree of I
B-
degradation in cells with or without knockdown of IRAK-1 is simply caused by the overwhelming effect of high dose IL-1, we treated the cells that are uninduced or induced to express IRAK-1 siRNA with a lower concentration (2.5 ng/ml) of IL-1. Under these conditions, there was similar I
B-
degradation with or without inhibition of IRAK-1 expression (Fig. 2B
). Consistent with the findings of similar degrees of I
B-
degradation in cells with or without induction of IRAK-1 siRNA, p65 translocation was also comparable in the cells without or with IRAK-1 knockdown (Figs. 2E-G
).
Because neither I
B-
degradation nor p65 translocation was affected by IRAK-1 knockdown, we assumed that NF-
B-dependent gene expression in response to IL-1 stimulation would be similar in cells with or without expression of IRAK-1 siRNA. However, surprisingly, the expression of two NF-
B-dependent genes, I
B-
and TNF-
, was significantly decreased after inhibition of IRAK-1 expression (Fig. 2H, I
). These results suggest that in addition to its participation in IKK activation, I
B-
degradation, and nuclear translocation of NF-
B, IRAK-1 is also able to affect the transcriptional activity of NF-
B by other mechanisms.
Induction of IRAK-1 produces enhanced NF-
B transcriptional activity that precedes I
B-
degradation and nuclear translocation of NF-
B
In previous studies, NF-
B activation was demonstrated to occur in IRAK-1 null cells transiently transfected with IRAK-1-expressing plasmids or in cells stably expressing exogenous IRAK-1 (21
, 37
38
39
40)
. Of note, overexpressed IRAK-1 usually undergoes autophosphorylation, which then results in IKK activation (41)
. Therefore, in experiments in which IRAK-1 is expressed for prolonged periods, it is not possible to know whether the mechanism through which NF-
B-dependent transcription is enhanced solely involves activation of IKK or whether IRAK-1 has additional effects. To address this issue and to modify the expression level of exogenous IRAK-1 in a temporally controlled manner, we generated a HEK-293 I1A cell line that inducibly expressed IRAK-1. Within 60 min after tetracycline addition, IRAK-1 expression started to increase (Fig. 3
A). The level of IRAK-1 continued to rise during the 3-h period after tetracycline addition (Fig. 3A
). I
B-
levels showed no apparent changes during the first 2 h after IRAK-1 was inducibly expressed, although diminished concentrations were found starting 3 h after IRAK-1 induction (Fig. 3A
). Similarly, there were no apparent alterations in nuclear translocation of the NF-
B p65 subunit during the first 2 h after IRAK-1 induction (Fig. 3B
). In contrast to the lack of change in I
B-
levels or nuclear translocation of NF-
B, expression of I
B-
was increased 2 h after IRAK-1 induction and mRNA levels of the NF-
B-dependent gene IL-8 started to rise as early as 1 h following IRAK-1 induction (Fig. 3C, D
). These data indicate that IRAK-1 is able to promote the transcriptional activity of NF-
B in a manner distinct from its role in activating the I
B kinase, IKK, with resultant I
B-
phosphorylation and degradation.
|
IRAK-1 is translocated to the nucleus after TLR/IL-1R engagement
Because our data suggest that IRAK-1 can enhance NF-
B-dependent transcription without activation of IKK, we investigated the localization of exogenous IRAK-1 in inducible IRAK-1 expressing HEK-293-I1A cells. We performed cell fractionation assays and found exogenous IRAK-1 in both the cytoplasm and nucleus (Fig. 4
A). Surprisingly, the nuclear IRAK-1 was predominantly in modified forms that were presented in slower migration bands. Previous studies found that IRAK-1 undergoes phosphorylation and ubiquitination in response to LPS or IL-1 stimulation (17
18
19
, 42)
. We therefore examined the localization of endogenous IRAK-1 after treatment of RAW264.7 or MCF-7 cells with LPS or IL-1. IRAK-1 in RAW264.7 and MCF-7 cells was found in higher molecular weight forms after LPS and IL-1β, but not TNF-
treatment (Fig. 4B, C
). Interestingly, modified IRAK-1 was significantly increased in the nuclear fraction on LPS or IL-1 stimulation (Fig. 4B, C
). In contrast, TLR4, which is located both on the cell surface and in the cytoplasm, and GAPDH, which is located in the cytoplasm, were not found in the nuclear fraction, demonstrating the purity of the nuclear fraction (Fig. 4B, C
). The increased nuclear concentrations of IRAK-1 in IL-1 stimulated cells suggested that IRAK-1 may shuttle between cytoplasm and nucleus. To examine this question, we treated the cells with leptomycin B (LMB), a CRM-1-dependent nuclear export inhibitor. We found that LMB caused a significant accumulation of IRAK-1 in the nucleus (Fig. 4D
). However, the IRAK-1 in the nuclear fraction was unmodified (Fig. 4D
).
|
To determine the nature of modification of nuclear IRAK-1, we performed immunoprecipitation with anti-IRAK-1 antibodies followed by Western blot analysis with specific antibodies to ubiquitin, SUMO-1, and phosphorylated-serine/threonine. We found that the nuclear IRAK-1 in IRAK-1 overexpressing HEK-293-I1A cells, in LPS-stimulated TLR4/MD2/CD14 HEK-293 cells, and in LPS-stimulated RAW264.7 cells is associated with ubiquitin (Fig. 4E-G
), suggesting that ubiquitination plays a role in IRAK-1 nuclear translocation on TLR/IL-1R stimulation. However, we were unable to demonstrate sumoylation or phosphorylation of nuclear IRAK-1 (data not shown).
To further demonstrate the nuclear translocation of IRAK-1 on TLR/IL-1R stimulation, we performed confocal microscopy analysis. In unstimulated MCF-7 cells, endogenous IRAK-1 is predominantly localized in the cytoplasm (Fig. 4H
, control). However, at 2 h after IL-1 stimulation, there is an increased amount of IRAK-1 in the nucleus (Fig. 4H
, IL-1 2 h). Of note, although levels of nuclear IRAK-1 are relatively small as compared to those in the cytoplasm, these findings are consistent with data from cell fractionation assays demonstrating that only a small portion of modified IRAK-1 is translocated to the nucleus (Fig. 4A, B, D
). We also examined IRAK-1 nuclear translocation after leptomycin B treatment by confocal microscopy and found that LMB caused dramatic accumulation of IRAK-1 in the nucleus (Fig. 4H
). Simultaneous treatment of cells with IL-1 and LMB resulted in amounts of IRAK-1 nuclear staining that were comparable to those found after treatment with LMB alone, suggesting that LMB-induced IRAK-1 nuclear export blockade is a dominant effect.
IRAK-1 binds to the promoter of NF-
B-dependent gene
The presence of IRAK-1 in the nucleus, coupled with our findings that overexpression of IRAK-1 results in enhanced NF-
B-dependent gene expression, suggested that IRAK-1 might be directly involved in NF-
B-dependent transcriptional events, including association with the promoter region of NF-
B-dependent genes. To examine this question, we performed chromatin immunoprecipitation (ChIP) assays and found that IRAK-1 rapidly binds to the I
B-
promoter in MCF-7 cells after stimulation with IL-1 (Fig. 5
A, C). p65 also bound to the I
B-
promoter under these conditions (Fig. 5A
). To demonstrate the specificity of the ChIP assay, we amplified the GAPDH promoter from the DNA precipitated by anti-IRAK-1 antibody. We found minimal binding of IRAK-1 to the GAPDH promoter and also that the binding remained unchanged after cellular stimulation with IL-1. Moreover, IgG did not bind to the I
B-
promoter (Fig. 5A
). We also performed ChIP assays on the mouse macrophage cell line, RAW264.7. IRAK-1 bound to the I
B-
promoter in RAW264.7 cells on LPS stimulation (Figs. 5B, D
).
|
IRAK-1 enhances NF-
B binding to the promoter of NF-
B-dependent gene
Although nuclear translocation of p65 does not change during the first 2 h after IRAK-1 induction in HEK-293-I1A cells, enhanced binding of p65 to the promoters of NF-
B dependent genes, such as I
B-
, during this period could be a potential mechanism for their increased expression. To explore this possibility, ChIP assays were performed 2 or 4 h after tetracycline treatment of HEK-293-I1A cells expressing inducible Flag-tagged IRAK-1. IRAK-1 binding to the NF-
B-responsive elements within the I
B-
promoter was increased on IRAK-1 induction (Fig. 6
A–B). p65 binding to the two promoters was also increased after IRAK-1 induction (Fig. 6A
), suggesting that expression of IRAK-1 promotes p65 binding to NF-
B-responsive promoter elements.
|
IRAK-1 phosphorylates histone H3 in vitro and is required for IL-1-induced phosphorylation of histone H3 at serine 10 in vivo
Phosphorylation of histone H3 occurs with active transcription (43
44
45)
. Because IRAK-1 is a serine/threonine kinase, binds to NF-
B response elements, and activates the expression of NF-
B-dependent genes, it is possible that it may also be able to phosphorylate histone H3. In initial experiments using an in vitro kinase assay, we found that recombinant IRAK-1 purified from bacteria not only phosphorylates MBP, a putative IRAK-1 substrate, as previously shown by ourselves and others (46
, 47)
, but also phosphorylates histone H3 (Fig. 7
A). However, IRAK-1 was unable to phosphorylate two unrelated proteins, HMGB1 and BSA, indicating the specificity of the assay (Fig. 7A
). IRAK-1 was also found to undergo autophosphorylation (Fig. 7A
), consistent with previous reports (41)
. IRAK-1 overexpressed in HEK-293-I1A cells and purified by affinity purification was also able to phosphorylate MBP and histone H3 (Fig. 7B
).
|
To test whether endogenous histone H3 is phosphorylated in vivo after IL-1 stimulation, MCF-7 cells were cultured in serum-free medium for 3 days, and then treated with IL-1β for 30 or 60 min. As shown in Fig. 7C
, phosphorylation of histone H3 at serine 10 was increased after IL-1β stimulation. To determine whether IRAK-1 is required for histone H3 phosphorylation after IL-1β treatment, MCF-7 cells expressing inducible IRAK-1 siRNA were cultured in serum-free medium and then induced or not for 3 days to knock down IRAK-1. The cells were then treated with IL-1β. Phosphorylation of histone H3 at serine 10 was increased in uninduced MCF-7 cells on IL-1β stimulation (Fig. 7D
). However, the increase in phosphorylation of histone H3 at serine 10 was abolished when IRAK-1 was knocked down (Fig. 7D
).
| DISCUSSION |
|---|
|
|
|---|
B activation, as shown by previous findings that IRAK-1-lacking cells have attenuated expression of NF-
B-dependent genes and also that IRAK-1-deficient mice are resistant to LPS-induced septic shock (37
B-dependent transcriptional activity and enhanced nuclear translocation of NF-
B in LPS-stimulated neutrophils (51)
The kinase activity of IRAK-1 does not appear to be necessary for its ability to activate NF-
B, as cells with kinase-dead IRAK-1 mutants still demonstrate normal IKK activation after TLR/IL-1R engagement (37
, 38
, 40)
. Such results indicate that IRAK-1 can function as an adaptor, facilitating association of TRAF6, TAK1, and other kinases required for phosphorylation of IKK. However, as shown in the present experiments, even though expression of NF-
B-dependent genes is markedly inhibited in IRAK-1-deficient cells, I
B-
degradation still occurs after TLR/IL-1R engagement, indicating that IRAK-1 is not required for this process. These findings also suggest that IRAK-1 has additional activities, other than its participation in I
B-
degradation, that are responsible for its involvement in modulating NF-
B-dependent gene expression.
In these experiments, IL-1 induced NF-
B-dependent gene expression was markedly diminished in cells in which IRAK-1 levels were decreased through transient expression of IRAK-1-specific siRNA, even though I
B-
degradation and NF-
B nuclear translocation remained intact under these conditions. Such results indicate that whereas low levels of IRAK-1 are sufficient for IKK activation, higher expression is required for the participation of IRAK-1 in NF-
B-dependent transcriptional events. These data also suggest that IRAK-1 participates in NF-
B-associated transcriptional activity through mechanisms other than facilitating nuclear translocation of NF-
B.
It has been shown previously that overexpressed IRAK-1 usually undergoes autophosphorylation and is able to activate NF-
B, even when there are no extracellular stimuli (41)
. In those studies, however, exogenous IRAK-1 was either stably expressed or transiently expressed for a prolonged period, allowing the autophosphorylated exogenous IRAK-1 to activate IKK and induce subsequent I
B-
degradation (21
, 37
38
39
40)
. Thus, the previous experiments were unlikely to identify mechanisms, other than the classical one of IKK phosphorylation, which might participate in IRAK-1-mediated NF-
B activation. In the present experiments, we took advantage of a tet-on system, which permitted modulation of IRAK-1 expression over short time periods. Using this methodology, we found that overexpressed IRAK-1 stimulated NF-
B-dependent gene expression before there was any degradation of I
B-
or nuclear translocation of p65, indicating that IRAK-1 could modulate the transcriptional activity of NF-
B through mechanisms other than its participation in IKK activation.
IRAK-1 is phosphorylated, ubiquitinated, and undergoes proteasome-dependent degradation after cellular stimulation with IL-1 and LPS (17
18
19)
. We found that nuclear localization of IRAK-1 is increased on IL-1 and LPS stimulation. The nuclear IRAK-1 found in IL-1 and LPS-stimulated cells is predominantly in a high-molecular-weight form and is ubiquitinated, suggesting that ubiquitination plays a role in IRAK-1 nuclear translocation. Protein ubiquitination includes K48 and K63 polyubiquitination, with K48 ubiquitination primarily mediating proteasome-dependent protein degradation, whereas K63 ubiquitination modulating a variety of molecular activities, including protein-protein interactions, transcriptional factor activity, and intracellular protein localization (20
, 52)
. In addition to TLR ligation inducing ubiquitination leading to proteasome-mediated protein degradation, a recent study demonstrated that the Toll signaling component, Pellino, mediates K63 polyubiquitination of IRAK-1 (53)
. K63 polyubiquitination has been shown to be involved in nuclear translocation of neurotrophin receptor interacting factor (NRIF) on stimulation of neuronal cells and such ubiquitination is mediated by TRAF6 (54)
. Although we have demonstrated that IRAK-1 is translocated to nucleus and nuclear IRAK-1 is ubiquitinated, there is at present no direct evidence of an involvement of K63 polyubiquitination in IRAK-1 nuclear translocation. Furthermore, identification of the ubiquitin ligase that mediates polyubiquitination of IRAK-1, as well as determination of how polyubiquitination modulates nuclear IRAK-1 activity will require further investigation.
Treatment of cells with leptomycin B dramatically increased nuclear accumulation of IRAK-1, indicating that active CRM-1-dependent events are involved in regulating nuclear concentrations of IRAK-1. However, in leptomycin B-treated cells, the form of IRAK-1 that accumulates in the nucleus is unmodified IRAK-1. These findings indicate that IRAK-1 shuttles between cytoplasm and nucleus in unstimulated cells and that IL-1 or LPS stimulation-induced ubiquitination of IRAK-1 may either lead to enhanced nuclear translocation or inhibited export from the nucleus. How ubiquitination or other modification of IRAK-1 blocks nuclear export will require further investigation.
We found that IRAK-1 binds to the promoter of NF-
B-dependent gene, I
B-
. Moreover, IRAK-1 was able to promote the ability of p65 to bind to the promoter region of I
B-
. However, we were unable to detect any direct interaction between p65 and IRAK-1 on IL-1 stimulation. Therefore, it remains to be elucidated how IRAK-1 enhances p65 binding to the promoter of its target genes. Nevertheless, since the ability of p65 to bind to specific I
B gene promoter regions is well correlated with the transcriptional activity of NF-
B, the present experiments identify a novel mechanism by which IRAK-1 can mediate NF-
B-dependent transcriptional events.
Active transcription requires loosening of chromatin, which is composed of DNA wound on core histones (55)
. Histone modification is a critical step in gene transcription. Notably, covalent modification of histone tails positively or negatively regulates gene expression (56
, 57)
. Phosphorylation of histone H3 on serine 10 is known to correlate with active gene expression (43
44
45)
. For example, previous studies showed that IKK-
is translocated to nucleus on cellular stimulation with TNF-
and is able to phosphorylate histone H3 at serine 10, an essential event in NF-
B-dependent gene expression (58
, 59)
. We found that IRAK-1 is able to phosphorylate histone H3 at serine 10 in vitro and also that IRAK-1 is required for IL-1-stimulated phosphorylation of histone H3 at serine 10. Because phosphorylation of histone H3 at serine 10 is known to be involved in positive gene transcription, these results suggest that IRAK-1 may be able to regulate gene expression, independent of NF-
B.
The present experiments demonstrate a novel role for IRAK-1 in modulating transcription. In particular, because IRAK-1 translocates to the nucleus after TLR/IL-1R engagement and is capable of directly phosphorylating histone H3, it may independently function as a transcriptional regulatory factor. In addition, through facilitating association of p65 with binding sites in the promoters of NF-
B-dependent genes, nuclear IRAK-1 is capable of modulating NF-
B-associated transcriptional events. These findings add IRAK-1 to the growing list of NF-
B-associated molecules that shuttle into the nucleus and participate in regulation of NF-
B activity in both cytoplasmic and nuclear locations.
| ACKNOWLEDGMENTS |
|---|
Received for publication November 4, 2007. Accepted for publication January 17, 2008.
| REFERENCES |
|---|
|
|
|---|
B pathway. Trends Immunol. 26,469-476[CrossRef][Medline]
B pathway. Nat. Cell Biol. 7,758-765[CrossRef][Medline]
B and c-Jun N-terminal kinase (JNK) activation diverge at IL-1 receptor-associated kinase (IRAK). Proc. Natl. Acad. Sci. U. S. A. 98,4461-4465
B. J. Biol. Chem. 276,41661-41667
B signaling module. Oncogene 25,6706-6716[CrossRef][Medline]
B with chromatin: the art of being at the right place at the right time. Nat. Immunol. 6,439-445[CrossRef][Medline]
B. Nat. Rev. Mol. Cell. Biol. 5,392-401[CrossRef][Medline]
B-mediated transactivation by protein acetylation. Biochem. Pharmacol. 68,1221-1229[CrossRef][Medline]
B2/p100 induces Bcl-2 expression. Leukemia 17,1349-1356[CrossRef][Medline]
B pathway. Oncogene 25,6717-6730[CrossRef][Medline]
B activation, IL-2 production and stress-activated protein kinases in the murine T cell line EL4. Eur. J. Immunol. 28,3100-3109[CrossRef][Medline]
B. Biochem. J. 339,227-231[CrossRef][Medline]
B. J. Immunol. 172,2522-2529
B activation and worse outcomes in sepsis. Am. J. Respir. Crit. Care Med. 173,1335-1341
B kinase-alpha in NF-
B-dependent gene expression. Nature 423,659-663[CrossRef][Medline]This article has been cited by other articles:
![]() |
C. Behrens, L. Feng, H. Kadara, H.-J. Kim, J. J. Lee, R. Mehran, W. K. Hong, R. Lotan, and I. I. Wistuba Expression of Interleukin-1 Receptor-Associated Kinase-1 in Non-Small Cell Lung Carcinoma and Preneoplastic Lesions Clin. Cancer Res., January 1, 2010; 16(1): 34 - 44. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lorne, X. Zhao, J. W. Zmijewski, G. Liu, Y.-J. Park, Y. Tsuruta, and E. Abraham Participation of Mammalian Target of Rapamycin Complex 1 in Toll-Like Receptor 2- and 4-Induced Neutrophil Activation and Acute Lung Injury Am. J. Respir. Cell Mol. Biol., August 1, 2009; 41(2): 237 - 245. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Liu, Y.-J. Park, Y. Tsuruta, E. Lorne, and E. Abraham p53 Attenuates Lipopolysaccharide-Induced NF-{kappa}B Activation and Acute Lung Injury J. Immunol., April 15, 2009; 182(8): 5063 - 5071. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Song, G. Liu, C. A. Bosworth, J. R. Walker, G. A. Megaw, A. Lazrak, E. Abraham, W. M. Sullender, and S. Matalon Respiratory Syncytial Virus Inhibits Lung Epithelial Na+ Channels by Up-regulating Inducible Nitric-oxide Synthase J. Biol. Chem., March 13, 2009; 284(11): 7294 - 7306. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |