FASEB J. Uncover Your Biological Pathway
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published as doi: 10.1096/fj.07-096891.
 (The FASEB Journal. 2008;22:1973-1980.)
© 2008 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.07-096891v1
22/6/1973    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miyahara, S.
Right arrow Articles by Hafezi-Moghadam, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miyahara, S.
Right arrow Articles by Hafezi-Moghadam, A.

In vivo imaging of endothelial injury in choriocapillaris during endotoxin-induced uveitis

Shinsuke Miyahara*,{dagger}, Lama Almulki*,{dagger}, Kousuke Noda*,{dagger}, Toru Nakazawa*,{dagger}, Toshio Hisatomi*,{dagger}, Shintaro Nakao*,{dagger}, Kennard L. Thomas*,{dagger}, Alexander Schering*,{dagger}, Souska Zandi*,{dagger}, Sonja Frimmel*,{dagger}, Faryan Tayyari*,{dagger}, Rebecca C. Garland*,{dagger}, Joan W. Miller*,{dagger}, Evangelos S. Gragoudas*,{dagger}, Sharmila Masli{dagger},{ddagger} and Ali Hafezi-Moghadam*,{dagger},1

* Angiogenesis Laboratory, Massachusetts Eye & Ear Infirmary, and

{dagger} Department of Ophthalmology, Harvard Medical School, Boston, Massachusetts, USA; and

{ddagger} Schepens Eye Research Institute, Boston, Massachusetts, USA

1Correspondence: Angiogenesis Laboratory, 325 Cambridge St., 3rd Floor, Boston, MA 02114 USA. E-mail: ahm{at}meei.harvard.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Early detection of ocular inflammation may prevent the occurrence of structural damage or vision loss. Here, we introduce a novel noninvasive technique for molecular imaging and quantitative evaluation of endothelial injury in the choriocapillaris of live animals, which detects disease earlier than currently possible. Using an established model of ocular inflammation, endotoxin-induced uveitis (EIU), we visualized the rolling and adhesive interaction of fluorescent microspheres conjugated to recombinant P-selectin glycoprotein ligand-Ig (rPSGL-Ig) in choriocapillaris using a scanning laser ophthalmoscope (SLO). The number of rolling microspheres in the choriocapillaris peaked 4–10 h after LPS injection. The number of the accumulated microspheres peaked 4 h after LPS injection in the temporal choriocapillaris and 4 and 36 h after LPS injection in the central areas around the optic disk. Furthermore, we semiquantified the levels of P-selectin mRNA expression in the choroidal vessels by reverse transcription-PCR and found its pattern to match the functional microsphere interactions, with a peak at 4 h after LPS injection. These results indicate that PSGL-1-conjugated fluorescent microspheres allow specific detection of endothelial P-selectin expression in vivo and noninvasive assessment of endothelial injury. This technique may help to diagnose subclinical signs of ocular inflammatory diseases.—Miyahara, S., Almulki, L., Noda, K., Nakazawa, T., Hisatomi, T., Nakao, S., Thomas, K. L., Schering, A., Zandi, S., Frimmel, S., Tayyari, F., Garland, R. C., Miller, J. W., Gragoudas, E. S., Masli, S., Hafezi-Moghadam, A. In vivo imaging of endothelial injury in choriocapillaris during endotoxin-induced uveitis.


Key Words: inflammation • adhesion molecules • subclinical diagnosis • noninvasive molecular imaging • vascular diseases


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
THE CHORIOCAPILLARIS IS ESSENTIAL for the metabolic needs of the outer retina. Abnormalities of the choriocapillaris may compromise retinal function and lead to loss of vision, for instance, in uveitis or central serous chorioretinopathy (1 2 3) . In age-related macular degeneration (AMD), initial disturbance of the retinal pigment epithelium may lead to choroidal neovascularization (4 , 5) . Early detection of choriocapillaris dysfunction may be important for initiating treatment at a time point that can prevent structural damage. In vivo visualization techniques of the choroidal microcirculation, including conventional fluorescein angiography or the experimental laser-targeted angiography for animals (6 , 7) , have been used to investigate the choroidal vascular network and hemodynamic conditions (8 9 10) . For example, using laser-targeted angiography, Hirata et al. (10) investigated fluorescein diffusion patterns in the choriocapillaris flow, which revealed a lobelike structure in the choriocapillaris. However, these methods are not capable of evaluating leukocyte-endothelial interactions in choriocapillaris flow in vivo.

Leukocyte-endothelial interaction is fundamental to the pathogenesis of various ocular inflammatory diseases (11 12 13 14) . At inflammatory sites, endothelial cells express adhesion molecules that cause leukocyte recruitment in a multistep process, which starts with rolling of leukocytes, continues with their firm adhesion, and may lead to transmigration into the extravascular space (15 16 17) . Interacting leukocytes release cytokines, proteases, and reactive radical species, which contribute to the injury of the inflamed tissue (15 , 18 , 19) . Leukocyte rolling, the first step in the recruitment process, is mediated primarily by the interaction between P-selectin on the endothelial surfaces and its main ligand, P-selectin glycoprotein ligand-1 (PSGL-1), constitutively expressed on the leukocyte surface (20 21 22) . These specific biological processes that take place during inflammation may be used for noninvasive molecular imaging of ocular diseases.

In this work, we introduce a novel molecular imaging technique that uses fluorescent microspheres, conjugated with adhesion molecules, to detect endothelial injury of the choriocapillaris under physiological blood flow conditions (16) . Because leukocytes and platelets depend on PSGL-1 for their recruitment to the vascular endothelium under inflammatory or injurious conditions (23) , we use the interaction of microspheres conjugated with this molecule in a model of acute inflammation to investigate the expression of its endothelial binding partner, P-selectin, in vivo.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Endotoxin-induced uveitis
All experiments were performed in accordance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and were approved by the Animal Care and Use Committee of the Massachusetts Eye & Ear Infirmary. Male Lewis rats (8–10 wk old; n=84) were obtained from Charles River (Wilmington, MA, USA). Uveitis was induced in rats by injecting 100 µg of lipopolysaccharide (LPS; Salmonella typhimurium; Sigma Chemical, St. Louis, MO, USA) diluted in 0.1 ml sterile saline into one hind footpad of each animal. Control animals received a footpad injection of saline alone. All rats were maintained in an air-conditioned room with a 12-h light-dark cycle and were given free access to water and food until used for the experiments.

Conjugation of PSGL-1 to microspheres
Carboxylated fluorescent or nonfluorescent microspheres (2 µm, Polysciences, Inc., Warrington, PA, USA) were covalently conjugated to protein G (Sigma) using a carbodiimide-coupling kit (Polysciences, Inc.) (16) . Recombinant P-selectin glycoprotein ligand-Ig (rPSGL-Ig; Y’s Therapeutics, Inc., Burlingame, CA, USA) was incubated with the microspheres at 0.4 mg/ml overnight at room temperature. Microspheres were washed in PBS with 1% BSA before use in vivo. We injected 6 x 108 fluorescent microspheres in each rat.

Flow cytometry
The average number of PSGL-1 molecules on the microsphere surfaces were determined using flow cytometry, as described previously (16) . Briefly, nonfluorescent microspheres (106/ml, Polysciences, Inc.) conjugated to PSGL-Ig (Y’s Therapeutics) were incubated with PE-conjugated mouse anti-human PSGL-1 (KPL-1) or its isotype-matched control (BD Biosciences, Franklin Lakes, NJ, USA) for 30 min, centrifuged at 4000 g for 5 min, washed twice, and resuspended into PBS. The fluorescence intensity of 104 microspheres was measured on a FACScan (Coulter EPICS XL), equipped with the System Work II software. The surface expression was presented as the mean channel fluorescence on a logarithmic scale.

In parallel, calibration beads (Quantum Simply Cellular, Bangs Laboratories, Fishers, IN, USA) were coated with reference fluorescence antibodies, as described previously (16) . Briefly, four different populations of microspheres with known densities of binding sites for Fc were coated with goat anti-mouse IgG (16) . Uncoated microspheres were used as a control (16) . A calibration curve was constructed based on the mean fluorescence intensity of the microspheres, using the Quickcal software (V2.3; Bangs Laboratories).

Evaluation of microsphere rolling in the choriocapillaris
To evaluate microsphere rolling in the rat choriocapillaris during endotoxin-induced uveitis (EIU), we used a scanning laser ophthalmoscope (SLO; HRA2; Heidelberg Engineering, Dossenheim, Germany), coupled with a computer-assisted image analysis system to make continuous high-resolution images of the fundus. An argon blue laser was used as the illumination source, with a regular emission filter for fluorescein angiography, since the microsphere’s spectral properties are comparable with those of sodium fluorescein. The images were obtained at a rate of 15 frames/s and recorded on a computer for further analysis (11) . The experiments were performed at 4, 10, 24, 36, and 48 h after LPS injection. Six rats were used at each time point.

Immediately before microsphere injection, the rats were anesthetized with xylazine hydrochloride (10 mg/kg) and ketamine hydrochloride (50 mg/kg), and their pupils were dilated with 0.5% tropicamide and 2.5% phenylephrine hydrochloride. A contact lens was used to retain corneal clarity throughout the experiment. A catheter (BD Insyte Autoguard, 24-gauge, ref. no. 381412) was inserted into the tail vein of each animal. Animals were placed on a platform, allowing flexible positioning of the animals in relation to the SLO. Microspheres (6x108/ml in saline) were injected continuously through the catheter for 1 min at a rate of 1 ml/min. Rolling microspheres were defined as microspheres that moved at a velocity significantly lower than that of free-flowing microspheres. The number of rolling microspheres was obtained from 30 s of the recordings.

Evaluation of microsphere accumulation in the choriocapillaris
Thirty minutes after microsphere injection, the fundus was imaged by SLO for quantification of the accumulated microspheres in the choriocapillaris. The number of fluorescent dots in the temporal (frame temporally next to the optic disk) and central area (frame with the optic disk in the center) of the choriocapillaris was counted.

Ex vivo evaluation of accumulated microspheres
To prepare retinal and choroidal flatmounts, animals were anesthetized 4 h after LPS injection. Subsequently, 1 ml of microspheres (6x108/ml in saline) was injected continuously through the tail vein catheter over 1 min. Thirty minutes after microsphere injection, animals were perfused with rhodamine-labeled concanavalin A lectin (Con-A; Vector Laboratories, Burlingame, CA, USA), 10 µg/ml in PBS (pH 7.4) to stain vascular endothelial cells and firmly adhering leukocytes. Perfusion was performed after the chest cavity was opened, and a 24-gauge needle was introduced into the aorta. Drainage was achieved by opening the right atrium. The animals were then perfused with 20 ml PBS containing 2% paraformaldehyde to wash out intravascular content and unbound microspheres. Immediately after perfusion, the retina and choroid were microdissected and flatmounted, using a fluorescence antifading medium (Vector Laboratories).

The tissues were then observed under an epifluorescence microscope (DM RXA; Leica, Deerfield, IL, USA), with both a FITC filter (excitation, 488 nm; detection, 505–530 nm) and a rhodamine filter (excitation, 543 nm; detection, >560 nm). Images were obtained using a high-sensitivity digital camera, connected to a computer-assisted image analysis system. Using the openlab image analysis software, merged images of the microspheres (green fluorescent dots) with the retinal and the choroidal tissues (red) were generated.

Semiquantification of P-selectin gene expression
0, 4, 10, 24, 36, and 48 h after LPS injection, 1 eye from each rat was enucleated. Total RNA was isolated from the RPE-Bruch’s membrane-choroid complex after removal of the neural retina using TRIzol reagent (Invitrogen; Carlsbad, CA, USA). The extracted RNA was quantified, and 1 µg of the RNA was used to make cDNA with First-Strand cDNA Synthesis Kit (Amersham Biosciences, Piscataway, NJ, USA). For semiquantitative PCR, 1 µl of each first-strand reaction was then amplified using P-selectin- and GAPDH-specific oligonucleotide primers. PCR amplification was performed with denaturation at 94°C for 1 min, annealing at 55°C for 1 min, and polymerization at 72°C for 1 min. The reaction was performed for 35 cycles for P-selectin and 25 cycles for GAPDH. The primers were CAAGAGGAACAACCAGGACT (sense) and AATGGCTTCACAGGTTGGCA (antisense) for P-selectin, and TGGCACAGTCAAGGCTGAGA (sense) and CTTCTGAGTGGCAGTGATGG (antisense) for GAPDH. After completion, the samples (6 µl) were analyzed by agarose gel electrophoresis and ethidium bromide staining (11) .

Statistical analysis
All values are expressed as mean ± SE. Data were analyzed by Student’s t test. Differences between the experimental groups were considered statistically significant or highly significant when the probability values were <0.05 or <0.01, respectively.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Characterization of PSGL-1-conjugated microspheres
To quantify the number of PSGL-1 molecules conjugated onto the surface of our microspheres, we generated nonfluorescent carboxylated microspheres covalently bound to protein G and subsequently coated them with recombinant PSGL-1, based on our previous report (16) . We used a PE-conjugated anti-PSGL-1 mAb or its isotype-matched control to label the PSGL-1 on the microspheres and measured their fluorescent intensity by flow-cytometry (Fig. 1 A). Microspheres conjugated with PSGL-1 showed a mean fluorescence of 211.5, when incubated with PE-conjugated anti-PSGL-1 mAb, compared with 7.1, when incubated with isotype-matched control (Fig. 1A ). To convert the mean fluorescence intensity obtained from the PSGL-1-conjugated microspheres to specific numbers of PSGL-1 molecules, we measured the fluorescence intensity of calibration microbeads with known site densities of PE-conjugated IgG, and examined them under the same flow-cytometric setting (Fig. 1A ). From the mean fluorescent intensities of the microbeads, a calibration curve was generated (R2=0.9997), indicating that, on average, 27,253 PSGL-1 molecules were bound on the surfaces of our microspheres (Fig. 1B ).


Figure 1
View larger version (16K):
[in this window]
[in a new window]

  		Figure 1. Quantitative analysis of PSGL-1-conjugated to microspheres. A) Flow cytometric histogram of PSGL-1-conjugated microspheres (diagonal lines) labeled with PE-conjugated anti-PSGL-1 mAb, isotype control (dotted line), and calibration beads with known binding sites (solid line). B) Flow cytometric quantification of mean fluorescence values of calibration beads (circles) after incubation with PE-conjugated IgG. Mean fluorescence value of PSGL-1-conjugated microspheres (+). Calculated copy number of PE-KPL-1 bound to PSGL-1-conjugated microspheres based on linear regression (y=136x–1533, R2=0.9997).

Microsphere rolling in the choriocapillaris
Immediately after intravenous injection of the PSGL-1-conjugated microspheres, free-flowing and rolling microspheres were observed in the choriocapillaris of the examined rats (Fig. 2 A). In the untreated control group (time 0), only very few PSGL-1-conjugated microspheres showed rolling interaction with the endothelium of the choriocapillaris (3.8±1.1) (Fig. 2B ). However, 4 and 10 h after LPS injection, the number of microspheres rolling along the venous walls increased significantly (12±1, P=0.0003 at 4 h and 12.7±1.9, P=0.003 at 10 h), suggesting an increase in endothelial P-selectin expression at these time points (Fig. 2B ). Twenty-four hours after LPS injection, the flux of rolling microspheres, although still significantly elevated, started to decline (10.7±2.1, P=0.016). This decline continued 36 and 48 h after LPS injection (5.3±1.4, P=0.4 and 5±1.1, P=0.5, respectively), suggesting a resolution of the acute inflammatory reaction (Fig. 2B ). To illustrate the rolling of microspheres in the choriocapillaris, a representative PSGL-1-conjugated microsphere is followed by freeze frame advancing while the elapsed tracking time is indicated (16 , 23) (Fig. 2C ).


Figure 2
View larger version (14K):
[in this window]
[in a new window]

  		Figure 2. In vivo imaging of microsphere rolling in choriocapillaris during acute inflammation. A) The movement of PSGL-1-conjugated fluorescent microspheres was detected in the choriocapillaris flow 4 h after LPS injection. Tracks of rolling microspheres, dashed white lines. Rolling microspheres moved within small limited areas, corresponding to the previously described lobules (10) . White arrows indicate the points of appearance of individual rolling microspheres; arrowheads show the points of disappearance of the same rolling microspheres. Other white spots indicate noninteracting, freely flowing microspheres. B) Rolling flux of control (gray diamonds) and PSGL-1-conjugated (black squares) microspheres in the choriocapillaris of normal (0 h) and EIU rats at different time points (4, 10, 24, 36, and 48 h) after LPS injection. Values expressed as mean ± SE; n = 6 animals in each group; *P < 0.05, {ddagger}P < 0.01. C) Sequence of fundus images 4 h after LPS injection, showing displacement of a rolling PSGL-1-conjugated fluorescent microsphere in the choriocapillaris of an EIU rat. t = elapsed time after start of tracking.

Microsphere accumulation in the choriocapillaris
Thirty minutes after the initial injection of the conjugated microspheres, the number of free-flowing microspheres in the choriocapillaris of normal and EIU rats was substantially diminished, presumably due to the interaction of the microspheres with the endothelium of the vessels throughout the body. This allowed us to conveniently identify and quantify the number of accumulated microspheres in the choriocapillaris as distinct stationary fluorescent marks with very high contrast against the nonfluorescent background (Fig. 3 ). To investigate whether it is possible to reveal the level of endothelial injury in the ocular vessels with the PSGL-1-conjugated microspheres, we induced uveitis in rats and quantified at different time points the number of adhering microspheres (Fig. 3A ). In normal control animals, a low number of microspheres constitutively adhered to the endothelium of the choriocapillaris (14±1). In contrast, in the EIU animals, a large number of microspheres (132.8±9.5) accumulated in the temporal area (temporal midperiphery) with a peak at 4 h after LPS injection, showing a significant 9.5-fold increase compared to the untreated control group (P=2.1x10–7) (Fig. 3B ). In comparison, the number of accumulated microspheres in the central area (around the optic disk) peaked at 4 and 36 h after LPS injection (107.3±15.2 at 4 h, P=6.4x10–8, and 84.8±3.2, P=2x10–9 at 36 h), an increase of 6.9- and 5.5-fold compared to the control group, respectively (Fig. 3C ).


Figure 3
View larger version (19K):
[in this window]
[in a new window]

  		Figure 3. Accumulation of firmly adhering PSGL-1-conjugated microspheres in the choriocapillaris microcirculation of EIU animals. Microsphere accumulation in the choriocapillaris was investigated using a scanning laser ophthalmoscope. Asterisks show location of the optic disk; open arrowheads (triangles) point toward the optic disc (not depicted in the micrograph). A) Representative micrographs showing a small number of unconjugated microspheres (a) and a comparably small number of PSGL-1-conjugated microspheres (b) in the choriocapillaris of normal control rats. In the temporal area, the number of PSGL-1-conjugated microspheres accumulated in the choriocapillaris of EIU rats peaked at 4 h after LPS injection (c) and decreased gradually by 36 h after LPS injection (d). In contrast, in the central area, the number of PSGL-1-conjugated microspheres revealed a biphasic pattern with two peaks at 4 h (e) and 36 h (f) after LPS injection, respectively. B) Temporal choriocapillaris microcirculation. Average numbers of accumulated plain (gray diamonds) and PSGL-1-conjugated microspheres (black squares) in healthy normal (0 h) and EIU animals at different time points (4, 10, 24, 36, and 48 h after LPS injection) in the temporal area of the choriocapillaris microcirculation of live rats. Values are expressed as mean ± SE; n = 6 animals in each group; {ddagger}P < 0.01. C) Central choriocapillaris microcirculation. Average numbers of accumulated plain (gray diamonds) and PSGL-1-conjugated microspheres (black squares) in healthy normal (0 h) and EIU animals at different time points (4, 10, 24, 36, and 48 h after LPS injection) in the central area of the choriocapillaris microcirculation of live rats. Values are expressed as mean ± SE; n = 6 animals in each group; {ddagger}P < 0.01.

Ex vivo visualization of accumulated microspheres
To confirm that the PSGL-1-conjugated microspheres, detected in vivo, were indeed in the choriocapillaris, as was postulated on the basis of the depth of the SLO focus, we further examined the accumulation of the conjugated microspheres using the retinal and choroidal flatmount technique. We injected 6 x 108 PSGL-1-conjugated microspheres through a tail vein catheter into EIU rats. Thirty minutes later, we perfused the animals with rhodamine-coupled concanavalin A to remove nonfirmly adhering microspheres and to stain the endothelial surface. We then enucleated the eyes and prepared retinal and choroidal flatmounts. Using epifluorescence microscopy, we were able to confirm the specific adhesion of microspheres in the retinal vessels and choriocapillaris (Fig. 4 ). In line with our SLO findings, the flatmounts showed a large number of PSGL-1-conjugated microspheres accumulated in the retinal vessels and choriocapillaris of the EIU animals. Interestingly, the retinal flatmounts revealed that nearly all firmly adhering microspheres had accumulated in the major retinal veins (Fig. 4C, D ). This is consistent with previous reports showing that, during EIU, most leukocytes are found in the retinal veins (13 , 24) , suggesting that our microspheres mimic the pathophysiologically relevant phenomenon of leukocyte recruitment in EIU.


Figure 4
View larger version (43K):
[in this window]
[in a new window]

  		Figure 4. Ex vivo visualization of the accumulation of PSGL-1-conjugated microspheres in the choriocapillaris and retinal vessels. Micrographs depict choroidal (A, B) and retinal (C, D) flatmounts of normal and EIU animals, respectively (4 h after LPS treatment) that were injected with microspheres (yellow arrows) through the tail vein. Animals were perfused with rhodamine-labeled concavalin A to stain the vasculature. A, B) Firmly adhering microspheres in the choriocapillaris of a normal animal (A) and an EIU animal (B), 4 h after LPS treatment. C, D)Firmly adhering microspheres in retinal vessels of a normal animal (C) and an EIU animal (D), 4 h after LPS treatment. Similar to accumulating leukocytes during EIU, PSGL-1-conjugated microspheres mainly were found in the retinal veins. Scale bar = 100 µm.

P-selectin gene expression
To investigate whether the changes in PSGL-1-conjugated microsphere recruitment during EIU reflect specific changes in endothelial antigen expression, we semiquantified the expression of P-selectin mRNA in the choroidal vessels of the EIU animals at various time points after LPS-injection, using PCR and gel electrophoresis (Fig. 5 ). We found a peak expression of P-selectin mRNA 4 h after LPS injection, corresponding to the high levels of microsphere accumulation in the choriocapillaris at this time point. These results suggest that the rolling and adhesion of the PSGL-1-conjugated microspheres in the choriocapillaris correlate with the endothelial P-selectin expression and are an indirect means for its quantification.


Figure 5
View larger version (17K):
[in this window]
[in a new window]

  		Figure 5. P-selectin mRNA-expression in choroidal vessels in EIU animals. A) Bands indicate the expression level of P-selectin and GAPDH mRNA in the choroidal tissues of rats at the indicated time points after LPS injection (control, no LPS-treatment). GAPDH was used as a control. B) Fold increase of choroidal P-selectin mRNA-expression in LPS-treated animals compared to the non-LPS-treated controls (0 h) as determined by band densitometry. Data represent mean ± SE; n = 3.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Vascular injury and inflammatory leukocyte recruitment are central components of prominent ocular diseases, such as uveitis, diabetic retinopathy, and age-related macular degeneration (13 , 25 26 27 28 29) . However, to date, there is no method for detection of leukocyte-endothelial interactions in humans or the extent of endothelial injury in the choriocapillaris in vivo.

In this study, we introduce a novel technique for noninvasive visualization of endothelial injury during ocular inflammation under physiological flow conditions. To accomplish this, we generated PSGL-1-conjugated fluorescent microspheres with known site densities and studied their interaction with the vascular endothelium of the choriocapillaris using SLO. The PSGL-1 molecule we used, rPSGL-Ig, is a fully human recombinant fusion protein of PSGL-1 and IgG-1 (30) that has been in clinical trials for acute myocardial infarction (31) and renal (32) and liver (personal communication) transplant for prevention of ischemia reperfusion injury. Because the molecule is tolerated in humans, our imaging technique may thus be conveniently adapted for early diagnosis of human ocular inflammatory diseases.

Our results show that the early rise in the accumulation of PSGL-1-conjugated microspheres in EIU animals correlates with the endothelial P-selectin mRNA expression. The quantification of the microsphere-endothelial interactions in the choriocapillaris allows us to estimate the expression level of endothelial P-selectin, an established marker of vascular injury in living animals. However, since PSGL-1 also binds to E-selectin, it is possible that changes in microsphere accumulation may, in part, also reflect the level of expression of the endothelial E-selectin. Furthermore, PSGL-1 conjugated microspheres may accumulate in EIU animals by binding to L-selectin on the surface of firmly adhering leukocytes. Although at the current SLO resolution, it is not possible to distinguish between interaction of the microspheres with endothelium vs. firmly adhering leukocytes, future improvements of the imaging technique may allow such distinctions.

Intriguingly, our measurements of the accumulation of the PSGL-1-conjugated microspheres revealed distinct patterns in different areas of the choriocapillaris flow. In the central area around the optic disk, microsphere accumulation peaked at 4 and 36 h after LPS injection, while the number of accumulated microspheres in the temporal area showed only one peak at 4 h after LPS injection, suggesting regionally diverse inflammatory responses within the choriocapillaris. These data indicate that this new technique provides the sensitivity to detect subtle regional differences in inflammatory response at a functional level.

Our investigations also show a higher level of microsphere-endothelial interactions in the choriocapillaris flow compared to that of the retinal microcirculation during EIU. It is possible that the higher vascular density in the choriocapillaris may account, in part, for the higher number of accumulated microspheres. However, the drastic differences that we found suggest functional differences between these two distinct vascular beds.

We further show an early peak in the expression of P-selectin mRNA in the choroid of EIU animals. To our knowledge, this is the first report of the measurement of P-selectin mRNA expression in the choroid during EIU. However, our mRNA results may not illuminate the subtle regional differences that were depicted in the in vivo experiments, as mRNA was collected from the entire choroidal complex. Furthermore, P-selectin is both de novo synthesized and rapidly released from cytosolic granules (Weibel-Palade bodies) on endothelial activation (33) . Immunohistochemistry shows P-selectin up-regulation in the iris-ciliary body as early as 15 min and 5–7 h after LPS injection (20) . While the first peak after 15 min is likely due to rapid release of P-selectin protein from the cytosolic granules, the second peak is consistent with the time course of mRNA up-regulation in our experiments.

Using the method described herein, we quantitatively evaluated the rolling flux of our PSGL-1-conjugated fluorescent microspheres in the choriocapillaris flow and determined its peak time to be at 4–10 h after LPS injection. Interestingly, previous studies with acridine orange digital fluorography showed that the number of rolling leukocytes in the retina of LPS-treated rats peaks 12 h after LPS injection (34) . Because our results indicate an earlier peak than the acridine orange-labeled leukocytes in the retinal vessels, our technique may thus allow an earlier detection of endothelial changes than conventional visualization techniques of leukocyte-endothelial interaction in vivo.

Consistent with the previously reported lobelike structure of the choriocapillaris, in our study, all rolling microspheres moved within confined areas of the choriocapillaris, which may correspond to the area of the anatomical lobe (9 , 10) .

In conclusion, our new technique allows for the first time convenient and quantitative imaging of adhesion molecule expression on the endothelium of the choriocapillaris in vivo. The fact that a variety of adhesion molecules or antibodies can be conjugated to the microspheres (16) , makes this technique a versatile and powerful tool for the study of the expression and function of endothelial surface antigens and detection of endothelial injury during disease.


   ACKNOWLEDGMENTS
 
This work was supported by U.S. National Institutes of Health (NIH) grant AI050775 (to A.H.-M.) and National Eye Institute core grant EY14104, as well as the American Health Assistance Foundation. We are indebted to the Massachusetts Lions Eye Research Fund, Inc., for generous funds provided for laboratory equipment used in this project. We thank Research to Prevent Blindness for unrestricted funds awarded to the Department of Ophthalmology at Harvard Medical School. We are grateful to the Marion W. and Edward F. Knight AMD Fund for support of A.H.-M.’s research. Recombinant PSGL-1 (Y’s PSGL) was a generous gift of Y’s Therapeutics, Inc.; Burlingame, CA, USA. We thank Drs. Takeru Yoshimura and Eiichi Sekiyama for their expertise in real-time PCR.

Received for publication August 29, 2007. Accepted for publication December 1, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Savage, H. I., Hendrix, J. W., Peterson, D. C., Young, H., Wilkinson, C. P. (2004) Differences in pulsatile ocular blood flow among three classifications of diabetic retinopathy. Invest. Ophthalmol. Vis. Sci. 45,4504-4509[Abstract/Free Full Text]
  2. Schocket, L. S., Brucker, A. J., Niknam, R. M., Grunwald, J. E., DuPont, J., Brucker, A. J. (2004) Foveolar choroidal hemodynamics in proliferative diabetic retinopathy. Int. Ophthalmol. 25,89-94[CrossRef][Medline]
  3. Nagaoka, T., Kitaya, N., Sugawara, R., Yokota, H., Mori, F., Hikichi, T., Fujio, N., Yoshida, A. (2004) Alteration of choroidal circulation in the foveal region in patients with type 2 diabetes. Br. J. Ophthalmol. 88,1060-1063[Abstract/Free Full Text]
  4. Pournaras, C. J., Logean, E., Riva, C. E., Petrig, B. L., Chamot, S. R., Coscas, G., Soubrane, G. (2006) Regulation of subfoveal choroidal blood flow in age-related macular degeneration. Invest. Ophthalmol. Vis. Sci. 47,1581-1586[Abstract/Free Full Text]
  5. Friedman, E., Krupsky, S., Lane, A. M., Oak, S. S., Friedman, E. S., Egan, K., Gragoudas, E. S. (1995) Ocular blood flow velocity in age-related macular degeneration. Ophthalmology 102,640-646[Medline]
  6. Bischoff, P. M., Niederberger, H. J., Torok, B., Speiser, P. (1995) Simultaneous indocyanine green and fluorescein angiography. Retina 15,91-99[CrossRef][Medline]
  7. Hirata, Y., Nishiwaki, H. (2006) The choroidal circulation assessed by laser-targeted angiography. Prog. Retin. Eye. Res. 25,129-147[CrossRef][Medline]
  8. Khoobehi, B., Shoelson, B., Zhang, Y. Z., Peyman, G. A. (1997) Fluorescent microsphere imaging: a particle-tracking approach to the hemodynamic assessment of the retina and choroid. Ophthalmic. Surg. Lasers 28,937-947[Medline]
  9. Kuroki, A. M., Bhutto, I. A., Kitaoka, T., Amemiya, T. (2002) Natural course of experimental choroidal neovascularization: three-dimensional study with corrosion cast and scanning electron microscope. Ophthalmic Res. 34,200-205[CrossRef][Medline]
  10. Hirata, Y., Nishiwaki, H., Miura, S., Ieki, Y., Honda, Y., Yumikake, K., Sugino, Y., Okazaki, Y. (2004) Analysis of choriocapillaris flow patterns by continuous laser-targeted angiography in monkeys. Invest. Ophthalmol. Vis. Sci. 45,1954-1962[Abstract/Free Full Text]
  11. Miyahara, S., Kiryu, J., Tsujikawa, A., Katsuta, H., Nishijima, K., Miyamoto, K., Yamashiro, K., Nonaka, A., Honda, Y. (2003) Argatroban attenuates leukocyte- and platelet-endothelial cell interactions after transient retinal ischemia. Stroke 34,2043-2049[Abstract/Free Full Text]
  12. Miyahara, S., Kiryu, J., Yamashiro, K., Miyamoto, K., Hirose, F., Tamura, H., Katsuta, H., Nishijima, K., Tsujikawa, A., Honda, Y. (2004) Simvastatin inhibits leukocyte accumulation and vascular permeability in the retinas of rats with streptozotocin-induced diabetes. Am. J. Pathol. 164,1697-1706[Abstract/Free Full Text]
  13. Hafezi-Moghadam, A., Noda, K., Almulki, L., Iliaki, E. F., Poulaki, V., Thomas, K. L., Nakazawa, T., Hisatomi, T., Miller, J. W., Gragoudas, E. S. (2007) VLA-4 blockade suppresses endotoxin-induced uveitis: in vivo evidence for functional integrin up-regulation. FASEB J. 21,464-474[Abstract/Free Full Text]
  14. Nakazawa, T., Hisatomi, T., Nakazawa, C., Noda, K., Maruyama, K., She, H., Matsubara, A., Miyahara, S., Nakao, S., Yin, Y., Benowitz, L., Hafezi-Moghadam, A., Miller, J. W. (2007) Monocyte chemoattractant protein 1 mediates retinal detachment-induced photoreceptor apoptosis. Proc. Natl. Acad. Sci. U. S. A. 104,2425-2430[Abstract/Free Full Text]
  15. Hafezi-Moghadam, A., Ley, K. (1999) Relevance of L-selectin shedding for leukocyte rolling in vivo. J. Exp. Med. 189,939-948[Abstract/Free Full Text]
  16. Hafezi-Moghadam, A., Thomas, K. L., Prorock, A. J., Huo, Y., Ley, K. (2001) L-selectin shedding regulates leukocyte recruitment. J. Exp. Med. 193,863-872[Abstract/Free Full Text]
  17. Sugama, Y., Tiruppathi, C., offakidevi, K., Andersen, T. T., Fenton, J. W., 2nd, Malik, A. B. (1992) Thrombin-induced expression of endothelial P-selectin and intercellular adhesion molecule-1: a mechanism for stabilizing neutrophil adhesion. J. Cell Biol. 119,935-944[Abstract/Free Full Text]
  18. Matsuo, Y., Kihara, T., Ikeda, M., Ninomiya, M., Onodera, H., Kogure, K. (1995) Role of neutrophils in radical production during ischemia and reperfusion of the rat brain: effect of neutrophil depletion on extracellular ascorbyl radical formation. J. Cereb. Blood Flow Metab. 15,941-947[Medline]
  19. Ghezzi, P., Dinarello, C. A., Bianchi, M., Rosandich, M. E., Repine, J. E., White, C. W. (1991) Hypoxia increases production of interleukin-1 and tumor necrosis factor by human mononuclear cells. Cytokine 3,189-194[CrossRef][Medline]
  20. Suzuma, K., Mandai, M., Kogishi, J., Tojo, S. J., Honda, Y., Yoshimura, N. (1997) Role of P-selectin in endotoxin-induced uveitis. Invest. Ophthalmol. Vis. Sci. 38,1610-1618[Abstract/Free Full Text]
  21. Vachino, G., Chang, X. J., Veldman, G. M., Kumar, R., Sako, D., Fouser, L. A., Berndt, M. C., Cumming, D. A. (1995) P-selectin glycoprotein ligand-1 is the major counter-receptor for P-selectin on stimulated T cells and is widely distributed in non-functional form on many lymphocytic cells. J. Biol. Chem. 270,21966-21974[Abstract/Free Full Text]
  22. Moore, K. L., Patel, K. D., Bruehl, R. E., Li, F., Johnson, D. A., Lichenstein, H. S., Cummings, R. D., Bainton, D. F., McEver, R. P. (1995) P-selectin glycoprotein ligand-1 mediates rolling of human neutrophils on P-selectin. J. Cell Biol. 128,661-671[Abstract/Free Full Text]
  23. Hafezi-Moghadam, A., Thomas, K. L., Cornelssen, C. (2004) A novel mouse-driven ex vivo flow chamber for the study of leukocyte and platelet function. Am. J. Physiol. Cell. Physiol. 286,C876-C892[Abstract/Free Full Text]
  24. Baatz, H., Pleyer, U., Thiel, H. J., Hammer, C. (1995) In vivo study of leukocyte-endothelium interaction in endotoxin-induced uveitis. Invest. Ophthalmol. Vis. Sci. 36,1960-1967[Abstract/Free Full Text]
  25. Anderson, D. H., Mullins, R. F., Hageman, G. S., Johnson, L. V. (2002) A role for local inflammation in the formation of drusen in the aging eye. Am. J. Ophthalmol. 134,411-431[CrossRef][Medline]
  26. Yang, P., de Vos, A. F., Kijlstra, A. (1997) Macrophages and MHC class II positive cells in the choroid during endotoxin induced uveitis. Br. J. Ophthalmol. 81,396-401[Abstract/Free Full Text]
  27. Miyamoto, K., Hiroshiba, N., Tsujikawa, A., Ogura, Y. (1998) In vivo demonstration of increased leukocyte entrapment in retinal microcirculation of diabetic rats. Invest. Ophthalmol. Vis. Sci. 39,2190-2194[Abstract/Free Full Text]
  28. Abiko, T., Abiko, A., Clermont, A. C., Shoelson, B., Horio, N., Takahashi, J., Adamis, A. P., King, G. L., Bursell, S. E. (2003) Characterization of retinal leukostasis and hemodynamics in insulin resistance and diabetes: role of oxidants and protein kinase-C activation. Diabetes 52,829-837[Abstract/Free Full Text]
  29. Ishida, S., Usui, T., Yamashiro, K., Kaji, Y., Ahmed, E., Carrasquillo, K. G., Amano, S., Hida, T., Oguchi, Y., Adamis, A. P. (2003) VEGF164 is proinflammatory in the diabetic retina. Invest. Ophthalmol. Vis. Sci. 44,2155-2162[Abstract/Free Full Text]
  30. Khor, S. P., McCarthy, K., DuPont, M., Murray, K., Timony, G. (2000) Pharmacokinetics, pharmacodynamics, allometry, and dose selection of rPSGL-Ig for phase I trial. J. Pharmacol. Exp. Ther. 293,618-624[Abstract/Free Full Text]
  31. Mertens, P., Maes, A., Nuyts, J., Belmans, A., Desmet, W., Esplugas, E., Charlier, F., Figueras, J., Sambuceti, G., Schwaiger, M., Mortelmans, L., Van de Werf, F. (2006) Recombinant P-selectin glycoprotein ligand-immunoglobulin, a P-selectin antagonist, as an adjunct to thrombolysis in acute myocardial infarction. The P-Selectin Antagonist Limiting Myonecrosis (PSALM) trial. Am. Heart. J. 152,125e121–e128[Medline]
  32. Gaber, A. O., Mulgaonkar, S., Kahan, B., Bowers, V., Woodle, S., Bajjoka, I., Butt, K., Jensik, S., Nezakatgoo, N., Klintmalm, G., Patton, P. (2007) YSPSL (rPSGL-Ig) for the prevention of delayed graft function (DGF): preliminary results of ongoing dose escalation and efficacy study. American Transplant Congress (poster), http://www.atcmeeting.org/2007/index.php
  33. Dore, M., Korthuis, R. J., Granger, D. N., Entman, M. L., Smith, C. W. (1993) P-selectin mediates spontaneous leukocyte rolling in vivo. Blood 82,1308-1316[Abstract/Free Full Text]
  34. Miyamoto, K., Ogura, Y., Hamada, M., Nishiwaki, H., Hiroshiba, N., Honda, Y. (1996) In vivo quantification of leukocyte behavior in the retina during endotoxin-induced uveitis. Invest. Ophthalmol. Vis. Sci. 37,2708-2715[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.07-096891v1
22/6/1973    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miyahara, S.
Right arrow Articles by Hafezi-Moghadam, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miyahara, S.
Right arrow Articles by Hafezi-Moghadam, A.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS