| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
* Department of Cellular and Molecular Physiology, Yale University, New Haven, Connecticut, USA; and
Department of Cell and Developmental Biology, Weill Medical College of Cornell University, New York, New York, USA
1Correspondence: Department of Cellular and Molecular Physiology, Yale University, 333 Cedar St., New Haven, CT 06520, USA. E-mail: cecilia.canessa{at}yale.edu
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: ascidian • degenerin/epithelial sodium channel (ENaC) family • proton gating • Ciona • knockdown expression
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. ASICs are expressed in neurons and, with the exception of ASIC2b and ASIC4, are gated by a rapid decrease of the extracellular pH. Cloning and characterization of ASICs from different vertebrate species indicate a high degree of sequence conservation between evolutionary distant species, suggesting an important role of the ASICs in the nervous system of vertebrates.
Three of the four ASIC genes have been inactivated in the mouse, providing insight into possible functions. ASIC1-null mice show changes in hippocampal long-term potentiation (2)
, spatial learning and memory (2)
, and fear conditioning (3)
, whereas two independently derived ASIC2-null mice lines provided somewhat contradictory data about the involvement of ASIC2 in mechanosensation (4
, 5)
. ASIC3-null mice exhibited altered perception of moderate-to-high intensity pain (6)
. However, the mechanisms that activate these channels and the physiological consequences of ASIC activation remain poorly understood.
To further the understanding of the functional role of ASIC we examined the larva of Ciona intestinalis because its nervous system is similar to that of higher vertebrates but much simpler (
100 neurons) (7)
. Furthermore, recent phylogenetic analyses position ascidians as the closest living relatives of vertebrates (8)
. In addition, because ascidians diverged from the chordate branch before the gene duplication events leading to the vertebrate lineage, the Ciona genome contains in many instances only one ortholog of the several paralogue genes present in vertebrates (7)
, which simplifies the assessment of gene function because of the lack of possible redundancy.
In this work we report cloning and characterization of the single ASIC gene from C. intestinalis, its pattern of expression during development, the cellular distribution of the ASIC protein, and the functional effects of knocking down ASIC expression in the larval nervous system.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
.
Cloning of ASICa and ASICb cDNAs from C. intestinalis
Total RNA was extracted from the nervous systems of adults and different developmental stages of whole embryos with TRIzol reagent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized with 5 µg of total RNA using oligo-dT primers and SuperScript RT III reverse transcriptase (RT) (Invitrogen). Screening for ASIC mRNA was performed by RT-polymerase chain reaction (PCR) using degenerate primers from the highly conserved sequences NCNCRMVHMPG [sense: AA(C/T)TG(C/T)AG(A/G)ATGGTICA(C/T)ATGCCIGG] and GDIGGQMG [antisense: CCCAT(C/T)TGICCICCIAT(A/G)TCICC; I stands for inosine]. PCR was performed with Taq polymerase (Invitrogen) with the following parameters: 20 s at 94°C, 30 s at 55°C, and 30 s at 72°C, repeated for 30 cycles. Full-length cDNAs of CiASICa and CiASICb were cloned by RT-PCR with the following primers: CCACCATGATACAACCCAACGACAACG and CGTCACAATGCACTCAATTCATAATCG (sense for CiASIC1a and CiASIC1b, respectively) and GCTAATCTGGAACATCGTATGGGTAATGAATATCTGTCTCG (reverse for both CiASICa and b), using an Expand High Fidelity PCR System (Roche, Mannheim, Germany), and single-strand cDNA from embryos 12 h postfertilization as template. The reverse primer introduced the hemagglutinin (HA) epitope to the carboxyl terminus of CiASICa and CiASICb.
Cloning of the promoter/enhancer region of CiASIC
A 5-kb fragment upstream of the first exon of CiASIC (promoter/enhancer of CiASICb) was amplified with GCGTTCCGACCTCCGTTGTCGTGTCG (sense) and GCATTGTGACCTGTGATGACGTAACGC (reverse). The 5-kb region upstream of exon 5 of CiASIC (promoter/enhancer of CiASICa) was amplified using the following primers: CCTGTGATGACGTAACGCTTAGTGACG (sense) and GCTAGGATCCGCACTGTTACGTGTCACAGAGC (reverse). Fragments were cloned into pFB
SP6 vector (10)
for electroporation in Ciona embryos.
Western blotting and surface biotinylation of transfected Chinese hamster ovary (CHO) cells
CHO cells were transfected with CiASICa-HA and/or CiASICb-HA using Lipofectamine-2000 (Invitrogen). Twenty-four hours after transfection, cells were biotinylated with sulfo-NHS-SS-Biotin (Pierce Biotechnology, Rockford, IL, USA) (11)
. Proteins were resolved in 10% SDS-PAGE and transferred to polyvinylidene fluoride membranes (Immobilon-P; Millipore Co., Bedford, MA, USA). CiASICs were detected by Western blotting with anti-HA antibody conjugated to horseradish peroxidase (Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA). Signals were developed with ECL+ (Amersham Biosciences Corp., Piscataway, NJ, USA) and exposed to BioMax MR film (Eastman Kodak, Rochester, NY, USA).
Electroporation of plasmid DNA
Purified circular plasmids containing the CiASIC enhancers were used for electroporation of C. intestinalis embryos at the one-cell stage, following a previously described protocol (9)
.
RNA silencing by electroporation of double-stranded (ds) RNA
For synthesis of dsRNA, cDNA corresponding to the sequence K296–C430 of CiASICa was cloned into PCR II TOPO dual promoter plasmid (Invitrogen). Sense and antisense RNA strands were synthesized by in vitro transcription from the plasmid linearized with either XhoI or SpeI, using SP6 or T7 RNA polymerase (New England Biolabs Inc., Ipswich, MA, USA), respectively. After synthesis, the two products were mixed in equimolar ratio, heated to 70°C for 5 min, and allowed to slowly cool down to room temperature to anneal into dsRNA. dsRNA prepared from the coding sequence of green fluorescent protein (GFP) was used as a negative control. For RNA silencing experiments, 100 µg of CiASIC or control dsRNA was electroporated in embryos at the one-cell stage along with red fluorescent protein (RFP) reporter plasmid (RFP expressed under control of CiASICa enhancer). Only larvae showing RFP expression were analyzed.
Quantitative real-time (qRT)-PCR from single Ciona larvae
qRT-PCR was used to assess the level of CiASIC transcript after electroporation of larvae with dsRNA. Total RNA isolated from a single larva was reverse-transcribed and amplified with primers specific for CiASIC: GAGTACATGCGGCCATCTTACACCTCTCCAG (sense) and ATGAATATCTGTCTCGATGGATGCTGGAAACTC (antisense). PCR reactions were prepared with iQ SYBR Green SuperMix (Bio-Rad Laboratories, Hercules, CA, USA) with 3 mM MgCl2 and 1 µl of cDNA template and run in a iCycler (Bio-Rad Laboratories). All samples were run in triplicate. Quantitative PCR conditions were 95°C for 2 min, 40 cycles of 95°C for 15 s, and 65°C for 40 s. Melting curve analysis was added after the final PCR. Control reactions were run with no cDNA template or with non-reverse-transcribed RNA. Starting mRNA quantities were calculated from standard curves generated using serial dilutions of plasmid DNA containing CiASICa as template. Calculated mRNA expression levels were normalized to the expression levels of CiGAPDH in same cDNA sample. Quantitative PCR for CiGAPDH was performed as described above for CiASIC, using the following primers: GCACTCGTACACTGCTACCCAGAAGAC (sense), and GCTGTATCCAAATTCATTGTCGTACCAG (antisense).
Whole-mount in situ hybridization of Ciona embryos
Embryos were allowed to develop at 15°C until the specific stage indicated in each experiment before fixation in paraformaldehyde. Whole-mount in situ hybridization was performed at 55°C with digoxigenin-labeled RNA probes (Dig RNA labeling kit, Roche) following a previously described protocol (9)
.
Development of anti-CiASIC antibody
A cDNA fragment encoding from residue E575 to N660 of CiASICa was cloned in frame with glutathione S-transferase in pGEX-3X plasmid (Amersham Biosciences Corp.). The fusion protein was produced in Escherichia coli, purified by affinity chromatography with glutathione agarose beads (Sigma-Aldrich, St. Louis, MO, USA) and injected into the subcutaneous tissue of White New Zealand rabbits. After two immunizations at the interval of 3 weeks, we collected and tested the serum by Western blotting and immunofluorescence of CHO cells transfected with CiASICa-HA. The specificity of the anti-CiASIC was confirmed by double staining with monoclonal anti-HA antibody (Sigma-Aldrich) (Supplemental Fig. S3).
Whole-mount immunocytochemistry
Embryos were fixed in 250 mM NaCl, 250 mM 4-morpholinepropanesulfonic acid (MOPS), 10% paraformaldehyde, 75 mM lysine, and 10 mM sodium periodate at 4°C for 1 h. After fixation, embryos were washed 3x for 5 min each with PBS, permeabilized with 0.3 mM Triton X-100 in PBS for 10 min, and washed again 3x for 5 min with PBS. After a 1-h incubation in blocking solution (10% goat serum and 1% BSA in PBS), embryos were incubated with anti-CiASIC primary antibody (1:500 dilution in 20% goat serum and 1% BSA in PBS) for 2 h. After five 10-min washes in 1% BSA in PBS, embryos were incubated with fluorescein isothiocyanate-conjugated goat anti-IgG rabbit antibody at a 1:500 dilution in 10% goat serum and 1% BSA in PBS. After five washes in PBS, embryos were mounted with Vectashield mounting medium (Vector Laboratories, Burlingame, CA, USA). Digital images were obtained with a fluorescent confocal microscope (LSM Axiovert 100, Carl Zeiss, New York, NY, USA).
Dissociation and culture of neurons from Ciona larvae
Fertilized eggs were electroporated with CiASICa-promoter-GFP plasmid and incubated in artificial seawater (ASW): 420 mM NaCl, 9 mM KCl, 10 mM CaCl2, 22 mM MgCl2, 25 mM MgSO4, and 10 mM HEPES, pH 8.0) at 18°C for 20 h until they developed into larvae. Larvae were digested for 16 h at 4°C, in ASW containing 1 mg/ml cellulase, 0.1 mg/ml Pronase (Roche), 1 mg/ml collagenase type IA (Sigma-Aldrich), and 20 U/ml of papain (Sigma-Aldrich). After addition of FBS to a final concentration of 5%, cells were dissociated by inverting the tube several times and collected by centrifugation at 500 g for 3 min. Cells were washed once in L15+ medium (Leibovitz’s L15 Medium [Life Technologies, Inc., Carlsbad, CA] adjusted to 420 mM NaCl, 9 mM KCl, 10 mM CaCl2, 22 mM MgCl2, and 25 mM MgSO4), resuspended in the same medium and plated on poly-L-lysine-coated coverslips. After allowing the cells to attach for at least 2 h, cells expressing ASIC were identified by GFP fluorescence and used for electrophysiological measurements. Cells were maintained in culture for up to 5 days at room temperature with daily changes of medium.
Electrophysiology
Two-electrode voltage clamp (TEVC) of Xenopus laevis oocytes
CiASIC-HA plasmids were linearized at the 3' position for synthesis of cRNA (mMessage mMachine cRNA synthesis kit, Ambion Inc., Austin, TX, USA). Stage V and VI oocytes were injected with 4 ng of single cRNA or combinations of cRNAs as indicated in the experiments. Proton-activated currents were examined by TEVC 2–4 days after injection as described previously (11)
.
Patch-clamp of larval neurons
A whole-cell voltage-clamp configuration was used for current recordings of dissociated neurons. CiASIC-expressing cells were identified by GFP fluorescence. Patch pipettes were pulled from borosilicate glass (LG16, Dagan, Minneapolis, MN, USA) using a micropipette puller (PP-83, Narashige Scientific Instruments Laboratories, Tokyo, Japan) and fire polished to a final tip diameter of 1 µM. Pipettes filled with ASW solutions had resistances of 5–10 M
. Currents were recorded with an Axopatch-200B amplifier (Axon Instruments Inc., Union City, CA, USA) using DigiData 1200 series interface and pClamp8.1 software (both from Axon Instruments Inc.). Data were collected at 10 kHz, filtered at 1 kHz, and stored on a computer for analysis. Series resistance was compensated for electronically. Leakage currents were very small and were not subtracted from recordings. Pulses of pH 5.0 were delivered with a modified perfusion system SF-77B (Perfusion Fast-Step, Warner Instrument Corp., Hamden, CT, USA). Recordings were performed at room temperature. The composition of the pipette solution was 400 mM KCl, 1 mM EGTA, and 10 mM 4-morpholineethanesulfonic acid (Mes)-Tris (pH 7.4) and of the bath solution was ASW (pH 7.4).
Field potential recordings
We followed the procedure described in ref. 12
with the following modifications. Briefly, larvae were placed on a coverslip in the recording chamber and a micropipette of 3 µM diameter was applied on the initial part of the tail by suction. Measurements were obtained on the voltage-clamp configuration with the pipette voltage held at 0 mV. Currents were recorded differentially between the inside of the pipette and the bath. All bursts of electrical activity corresponded to movement of the larvae attached to the pipette and were visually monitored under the microscope. Bath and pipette solutions were ASW. Recordings were obtained for the duration of 3 min at room temperature with constant illumination.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
A). Closer examination of the genomic organization of CiASIC revealed another short ASIC-like gene model in the same genomic contig, upstream of CiASIC, encoding the N-terminal region of the channel (ci0100147958). Because of the upstream localization of this fragment with respect to the ASIC gene, we thought that it might correspond to exons that give rise to a splice variant. To confirm this hypothesis, we performed RT-PCR with RNA isolated from larvae using sense primers corresponding to the starting initiation sites in ci0100147989 and ci0100147958 and a common reverse primer at the end of CiASIC cDNA. Two cDNAs were obtained with their corresponding translated sequences shown in Supplemental Fig. S1. The two isoforms differ in the first one-third of the proteins but are identical in the last two-thirds, confirming that they encode two splice forms of the same gene. Henceforth, we refer to these cDNAs as CiASICa and CiASICb. Remarkably, the splicing site in Ciona corresponds exactly to the one found in mammalian ASIC1 and ASIC2 and to the putative splicing site of ASIC4.
|
The overall amino acid conservation between CiASIC and ASIC1 and ASIC2 from rat is 34%. The highest identity is found in the second transmembrane domain (85%) and in the extracellular loop (53%), whereas the intracellular N and C termini are rather divergent. The most notable difference is the longer intracellular N and C termini of CiASIC compared with other vertebrate ASICs. The relation of CiASIC to other ASICs cloned to date is shown in the dendrogram of Fig. 1B
.
As there are four ASIC genes in mammals and at least six in zebrafish (14)
, we searched for additional ASIC genes in Ciona. A BLAST search of the Joint Genome Institute (JGI) web site for Ciona complete genome sequence (JGI Ciona intestinalis v2.0, http://genome.jgi-psf.org/Cioin2/Cioin2.home.html) retrieved five gene models with sequence similarity to CiASIC: ci0100132238, ci0100142380, ci0100141492, ci0100141513, and ci0100138238. However, previously reported analysis of these genomic sequences by Okamura et al. (15)
as well as analysis of their corresponding expressed sequence tags indicated that they do not belong to the ASIC subfamily but form a separate cluster in the Deg/ENaC superfamily of channels (Supplemental Fig. S4).
Localization and time course of ASIC expression in Ciona
The central nervous system of the Ciona larva is composed of 100 neurons clustered in sensory vesicle and visceral ganglion (16)
, whereas the peripheral nervous system consists of papillary neurons and 20–30 epidermal sensory neurons (17)
. An additional type of neurons in the dorsal side of the tail, known as bipolar or planate neurons, has been identified. These neurons send two long projections, one of which ascends to the sensory vesicle and/or visceral ganglion and the other descends to the end of the tail (18)
.
By in situ hybridization we first detected expression of ASIC in cells of the tail epidermis at the neurula stage (Fig. 2
A, B). At a later tailbud stage, ASIC-expressing neurons in the tail and a single pair of neurons in the trunk were identified by whole-mount in situ hybridization and by immunofluorescence with a CiASIC antibody (Fig. 2C, F
). In hatched larvae, CiASIC protein was detected in all or most of the neurons in both sensory vesicle and visceral ganglion, as well as in bipolar neurons in the tail (Fig. 2G, H
). In contrast, axons from central neurons in the nerve cord and sensory neurons of the papilla and epidermal sensory neurons in the tail and trunk did not express ASIC.
|
In mammals ASIC2a localizes in the mechanosensory terminals of the skin (19)
, where it may participate in transduction of mechanosensation. In Ciona larvae the sensory cilium of epidermal sensory neurons is thought to constitute a mechanosensor. We therefore examined expression of CiASIC in the cilium of epidermal sensory neurons by double staining with antibodies for CiASIC and acetylated tubulin; the latter specifically labels tubulin in neuronal processes and sensory cilia. Figure 2I
shows cilia protruding from the tunic (labeled in red) that do not costain with CiASIC (green).
Two different promoter/enhancer elements, one located in intron 4 and the other upstream of exon 1 (Fig. 1A
), were fused to GFP and RFP, respectively, and electroporated into fertilized Ciona eggs. Both elements were able to drive expression of the reporter gene in neurons of sensory vesicle, visceral ganglion, and tail, in mostly overlapping patterns (Fig. 2J-L
), indicating that the two CiASIC isoforms are coexpressed in the same neurons.
Expression of CiASIC in the nervous system of adult Ciona was also examined. In the adult animal the cerebral ganglion located between the two siphons constitutes the nervous system, which was harvested and processed for RT-PCR with specific primers. These experiments repeated under various parameters did not yield a PCR product, indicating that CiASIC is not expressed in the adult but is restricted to the embryonic/larval stages, in which it is found in the sensory vesicle, visceral ganglion, and bipolar neurons of the tail.
Expression of CiASIC in Xenopus oocytes
To examine the functional properties of CiASICa and CiASICb we injected Xenopus laevis oocytes with the corresponding cRNAs, either individually or in combination. Whole-cell currents under voltage-clamp conditions were measured before and after stimulation with solutions of a large range of pH values, from 7.0 to 4.0. External protons did not elicit inward currents in any of the conditions tested. The absence of proton-induced currents was not due to low protein expression or to retention of the CiASIC proteins in the endoplasmic reticulum because Western blots and surface biotinylation of cells demonstrated abundant expression and localization of CiASICs at the plasma membrane (Supplemental Fig. S2).
Functional studies of CiASIC in isolated larval neurons
It is possible that CiASICs expressed in Xenopus oocytes do not exhibit proton sensitivity because they require coexpression of additional proteins and/or modulatory factors not present in heterologous environments. There is a precedent for other ascidian ion channels to be functional only when expressed in ascidian cells but not in oocytes (20)
. Therefore, we first attempted to patch neurons directly from the nervous system of larvae, but removal of the cuticle and epithelial layer that cover the nervous system resulted in significant damage of neurons even when the procedure was supplemented with a short treatment with cellulase (1 mg/ml, 20 min at room temperature). To overcome this problem, we developed a method to isolate larval neurons that preserved cell viability for 2–5 days in culture, as described in the Materials and Methods section. Electroporation of fertilized eggs with GFP driven by the promoter/enhancer region of CiASICa or CiASICb labeled only neurons in which the CiASIC cis-regulatory modules are active. These cells were identified in culture by their fluorescence (Fig. 4
A, B) and were the ones examined by patch-clamping. Neurons were clamped at –60 mV for recordings of whole-cell currents in external ASW solution buffered at pH 7.4 followed by stimulation with a pulse of pH 5.0 delivered for 500 ms by the tip of a perfusion system located in close proximity to the recorded cell. After recovery at pH 7.4, the membrane potential was changed to 0 mV. This depolarization induced repetitive "action currents" with inward and outward phases (Fig. 3
C). These regenerative and biphasic currents resemble those observed in mammalian neurons after activation of voltage-gated Na+ and K+ channels. The latter response served to verify cell viability and the identity of neurons. Only cells exhibiting this behavior were considered in the study. No proton-activated currents were elicited in any of the 10 neurons examined, indicating that viable Ciona neurons respond to depolarization by firing regenerative action currents but do not exhibit proton-activated currents.
|
|
Knockdown of CiASIC changes spontaneous swimming of the larvae
To investigate the functions of CiASIC in vivo, we performed RNA knockdown experiments by electroporating CiASIC dsRNA into one-cell Ciona embryos. We have used dsRNA as opposed to small interfering (si) RNA because long dsRNA molecules are processed into many siRNA species, which improves the efficiency of silencing. It was possible to use this approach because ascidians do not have interferon responses to long dsRNAs that prevent their use in mammalian systems (21)
. Embryos electroporated with GFP dsRNA were used as controls. Reduction of CiASIC transcript was assessed by qRT-PCR as described in the Materials and Methods section. The level of silencing was variable between individual larvae, with an average CiASIC mRNA quantity at 30% of that in controls (Fig. 4
A). The variability seemed to be due to the fact that some larvae were not successfully electroporated rather than to variable effects of dsRNA in individual larvae. Electroporated animals fell in two distinct categories: either comparable to the control or with knockdown at 
40% of the control. No intermediate RNA levels were observed. Larvae electroporated with CiASIC dsRNA developed with a time course comparable to that of the controls and did not show any morphological or behavioral abnormalities that could be detected during routine culture, suggesting that CiASIC is not required for basic development of the nervous system.
Neuronal activity in Ciona larvae is reflected in several stereotypical behaviors, one of which is rhythmic spontaneous swimming (22)
. We measured extracellular field currents associated with the spontaneous swimming activity in larvae electroporated with CiASIC-dsRNA or GFP-dsRNA as a control. Typical traces showing spontaneous bursts of activity are shown in Fig. 4B
. Unlike control larvae, which show regular intervals between bursts of activity (small SD from the mean period), the swimming activity pattern of CiASIC knockdowns is irregular (Fig. 4B, C
). In addition, the mean length of the interval between bursts of activity is significantly shorter in CiASIC knockdown relative to control larvae (Fig. 4D
). In contrast, the mean length of burst activity between the two groups and the frequency of activity within bursts were similar (data not shown).
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
reported two putative ASIC genes. However, we demonstrate here that those genes represent two splice forms of a single ASIC gene. CiASIC is probably a direct ortholog of the single primordial ASIC that gave rise to the four genes present in mammals after the two genome duplication events that occurred in the evolution of vertebrates (23
, 24)
. Further support for this assertion is the conserved organization of the ASIC gene. For instance, the splicing site of CiASIC and the large intron preceding it are still present in the mammalian ASIC1, ASIC2, and ASIC4 genes, 500 million years since ascidians diverged from the lineage leading to vertebrates. Comparison of CiASIC cDNA and protein sequences with the mammalian ones reveals the highest similarity to ASIC1 and ASIC2. Unlike ASIC2 of mammals, CiASIC protein is not enriched in mechanosensory termini, as cilia from epidermal sensory neurons do not express CiASIC. The wide distribution of CiASIC in the nervous system of the larva resembles more closely the pattern of expression of the mammalian ASIC1, which is also the most abundant and broadly distributed isoform in the nervous system.
An intriguing finding is that CiASIC is expressed exclusively in the larval nervous system but is absent in the adult. The nervous system of the larva shares hallmarks of that of other vertebrates including the presence of a dorsal neural tube. However, all of the structures that form the larval nervous system (visceral ganglion, dorsal tubular nerve cord, sensory vesicle, and sensory organs) are lost after metamorphosis to the adult form. Only the rudiment called the neurohypophysis is retained to become the cerebral ganglion and neural glands that constitute the nervous system of the adult (25)
. As only the larval stage of Ciona resembles that of other vertebrates, it seems that ASICs diverged as a new branch from the main Deg/ENaC family as the vertebrate nervous system evolved.
Proton-independent function for the ASICs
One of the most noticeable results of this work is that external protons do not gate CiASIC as happens in higher vertebrates. We documented the absence of proton sensitivity in heterologous systems as well as in endogenous channels expressed in larval neurons. The latter rules out the possibility of an accessory subunit or other endogenous components required for conferring proton sensitivity. This result, however, agrees with our previous observation that sensitivity of the ASICs to protons appeared late in evolution of vertebrates with the appearance of bony fish (26)
. The finding is also consistent with the notion that the pH of the intercellular space of small and simple organisms such as that of the ascidian larva changes with the pH of seawater, in the range of 6.9 to 8.8. Inability to isolate the pH surrounding neurons from fluctuations of the environment pH presumably prevented protons from evolving as a specific neuroligand in the central nervous system of these simple organisms. By contrast, higher vertebrates are endowed with mechanisms that isolate the nervous system from fluctuations in the environmental pH, thereby allowing for ion channels to become proton sensitive. This new property could then fulfill a specific neuronal function. An alternative explanation is that proton sensitivity is functionally neutral and persisted only in species capable of maintaining a stable pH, as is the case for the nervous system of higher vertebrates.
The atomic structure of chicken ASIC1 in the desensitized state has been solved recently by Jasti et al. (27)
. The structure reveals a cluster of negatively charged residues in the extracellular domain of each subunit that may form the putative "proton sensor." Twelve of the 13 residues in the cluster, with the exception of D408 in chicken that is N494 in Ciona, are conserved, indicating that proton binding is necessary but not sufficient for ASIC gating. The latter requires additional conformational changes of domains and residues not yet identified.
Despite substantial efforts in the field, the exact functions of ASICs are still not well understood. Relatively mild phenotypes of ASIC knockout mice have not provided conclusive answers to what are the functions of ASICs. We used down-regulation of the CiASIC transcript to examine the effects in development and in one of the few behaviors exhibited by Ciona larvae. No apparent changes in development of embryos electroporated with CiASIC dsRNA were observed. When embryos reached the larval stage we observed irregular swimming periods and increased activity, suggesting that CiASIC might modulate spontaneous swimming. Hatched larvae exhibit directional swimming driven by two types of tail movements: asymmetrical (unilateral) tail flicks and symmetrical swimming movements, which are spontaneous or induced by reduction in light intensity (light-off evoked) (22)
. Although the neural network that drives spontaneous swimming in the larva is not known, presumably it contains a central pattern generator circuit composed of neurons in the sensory vesicle and/or visceral ganglion that provide a rhythmic input to the motor neurons that innervate muscle cells of the tail. The output of this circuit can be further modulated by sensory input from otolith, ocellus, and epidermal sensory neurons. We examined only field currents associated with the spontaneous swimming activity because these are the most common movements in >3-h posthatching larvae (28)
. Knockdown of CiASIC interfered with the regularity of appearance of spontaneous swimming potentials, suggesting a role of CiASIC in the generation of rhythmicity in pacemaker neurons or modulation of input to pacemaker neurons and motor neurons. To date, ASICs have not been implicated in neural pattern generator circuits; however, another proton-insensitive Deg/ENaC channel expressed in Drosophila, PPK1, has been shown to modulate rhythmic muscle activity: specifically, ppk1–/– larvae showed increased locomotion due to a significant decrease in period between two contraction cycles (29)
. In view of the broad expression of CiASIC, it is possible that changes in rhythmic swimming activity are the result of higher sensitivity to the level of ASIC expression in neurons controlling rhythmic locomotion compared with other cells in the nervous system.
In summary, our results suggest that the ASICs became a distinct branch of the Deg/ENaC superfamily of ion channels at the origin of the chordates. Although the name "acid-sensing ion channel" was given to the mammalian ASIC1, the first member of the ASIC family that was found to be gated by protons, it has become evident that proton sensitivity is not the primary property of these channels. Our functional studies indicate that CiASIC is required for the normal swimming behavior of the Ciona larva. The fact that animals with low expression of CiASIC exhibit a phenotype is consistent with the presence of a single ASIC gene in a very simple nervous system devoid of compensatory and redundant mechanisms to substitute for ASIC function.
|
ACKNOWLEDGMENTS |
|---|
Received for publication October 17, 2007. Accepted for publication December 6, 2007.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
, control; 
, dsCiASIC RNA larvae. Control larvae exhibit a regular appearance of activity bursts as shown by the small SD from the mean interval length. dsCiASIC-electroporated larvae show loss of periodicity as the SD from the mean period length is high. Values were calculated from three independent experiments (t test = 1.18396E-06). D) Mean duration of the interval between swimming potential trains in control and dsCiASIC electroporated larvae showing shorter interburst intervals in dsCiASIC compared with control (t test=0.029466). Data from three independent experiments (n=12 larvae) are shown. 