|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-Dystroglycan is involved in positive selection of thymocytes by participating in immunological synapse formation
,2
* Institute for Immunobiology, Department of Immunology, Shanghai Medical College of Fudan University, Shanghai, China; and
Immunology Division, E-Institutes of Shanghai Universities, Shanghai, China
2Correspondence: Department of Immunology, Shanghai Medical College of Fudan University, 138 Yixueyuan Rd., Shanghai 200032, China. E-mail: sdxiongfd{at}126.com
| ABSTRACT |
|---|
|
|
|---|
-Dystroglycan has been proved to be involved in lymphocyte activation by participating in immunological synapse (IS) formation. Considering the existence of IS formation in thymic development, we questioned whether
-dystroglycan was expressed in thymus and influenced thymic development. In this study, we demonstrated that
-dystroglycan was expressed on fetal thymocytes, especially on double-positive (DP, CD4+CD8+) cells. Blocking
-dystroglycan by treatment of fetal thymus organ culture (FTOC) with anti-
-dystroglycan antibody IIH6C4 decreased the number of DP cells compared with nontreated or isotype antibody controls. Down-regulation of
-dystroglycan by retroviruses carrying antisense cDNA of dystroglycan in reaggregate thymus organ culture (RTOC) further confirmed these results. Enhanced apoptosis of DP cells was observed after blocking
-dystroglycan. Interestingly, we found that blocking
-dystroglycan reduced IS formation between DP cells and thymic epithelial cells. Furthermore, blocking
-dystroglycan up-regulated CD95/CD95L expression and reduced Bcl-2 expression on DP cells in the developing thymus. Finally, the increase in the apoptosis of DP cells was associated with a consequent decrease in the positive selection, as indicated by the reduction of both ERK phosphorylation in DP cells and single-positive (SP, CD4+ or CD8+) cell outcome. Altogether, these results indicated that
-dystroglycan was involved in positive selection of thymocytes by participating in the IS formation.—Gong, Y., Zhang, R., Zhang, J., Xu, L., Zhang, F., Xu, W., Wang, Y., Chu, Y., Xiong, S.
-Dystroglycan is involved in positive selection of thymocytes by participating in immunological synapse formation.
Key Words: thymic development fetal thymus organ culture reaggregate thymus organ culture
| INTRODUCTION |
|---|
|
|
|---|
In mature T cells, TCR signaling is associated with the formation of a multimolecular complex, the immunological synapse (IS), at the T-cell/antigen presenting cell (APC) interface (6)
. However, the relevance of signaling complex formation to TCR signaling during thymus development is less clear. Recent studies have begun to analyze IS formation during thymic selection using lipid bilayers that contain peptide/MHC complexes (7)
, in the context of thymocyte responses in a negative selection system (8)
and under conditions that lead to positive selection (9
, 10)
. Among them, one study (9)
has provided further evidence that the presence or absence of CD80 costimulation influences the outcome of TCR signaling in DP thymocytes through differential lipid raft recruitment, thus determining overall signal strength and influencing developmental cell fate. Overall, these studies suggest a possible mechanism whereby the factors that participate in IS formation can affect the quantitative or qualitative variations in TCR signaling, leading to the different outcome of thymocyte selection, as hypothesized by Minter and Osborne (11)
.
Dystroglycan (DG) was originally isolated from muscle as a component of dystrophin-glycoprotein complex (DGC), which was shown to be disrupted or missing in the human disease Duchenne muscular dystrophy (12)
. It consists of
and β subunits generated by proteolytic cleavage of a single precursor protein (13
14
15
16)
.
-Dystroglycan links to the extracellular matrix (ECM) via several ligands, including agrin, laminin-1, laminin-2, perlecan (17
18
19
20)
, merosin (21
, 22)
, neurexin (23)
, and biglycan (24)
, whereas β-dystroglycan links
-dystroglycan to actin cytoskeleton via dystrophin or utrophin (25
, 26)
, Chen et al. (27)
reported that dystroglycan could directly bind to the actin cytoskeleton. Accumulating evidence indicates that dystroglycan is involved in synapse formation in the neural-muscle junction (NMJ) and the central nervous system (CNS) (28
29
30
31
32)
. Dystroglycan is also widely expressed by a number of nonmuscle tissues, including brain, kidney, liver, digestive tract, trachea, reproductive organs, cochlea, skin, etc. (33
34
35
36
37
38
39
40)
. As a receptor of laminin and agrin, dystroglycan is also implicated in such specific developmental processes as epithelial morphogenesis and tumorgenesis (41
42
43
44
45
46
47
48
49)
. In pancreatic β-cells, blocking the binding of laminin-1 to
-dystroglycan with a monoclonal antibody (Ab) IIH6C4 dramatically decreases the number of β-cells (47)
. However, whether
-dystroglycan is expressed in thymus and influences thymocyte development is still not clear. Our previous studies have shown that
-dystroglycan is expressed on lymphocytes and contributes to lymphocyte activation by participating in IS formation (50)
. Thus, we infer that
-dystroglycan might also be expressed on fetal thymocytes and could contribute to thymocyte development.
In this study we examined the expression of
-dystroglycan on fetal thymocytes and studied the possible role of
-dystroglycan on thymocyte development. We found that
-dystroglycan was constitutively expressed on fetal thymocytes and contributed to positive selection by participating in IS formation. Our findings will aid us in deciphering the mechanisms underlying the role of
-dystroglycan in thymocyte development.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Fetal thymus organ culture (FTOC)
FTOC has been described in detail elsewhere (51)
. Briefly, thymus lobes dissected from 15-gd fetal mice were placed on to the surface of a 0.8-µm nucleopore filter (Millipore, Bedford, MA, USA), which rested on blocks of surgical Gelfoam (Upjohn C. Kalamazoo, MI, USA) in 24-well plates with 1 ml of complete RPMI1640 medium supplemented with 20% fetal bovine serum (FBS, HyClone Laboratories, Logan, UT, USA). In Ab blocking experiments, anti-
-dystroglycan Ab IIH6C4 (mouse IgM, Upstate, Lake Placid, NY, USA), mouse IgM (isotype control for IIH6C4, BD Biosciences, San Diego, CA, USA), or anti-
-dystroglycan Ab VIA4-1 (IgG, Upstate) was added to the medium at the concentrations indicated. mAbs (IIH6C4, VIA4-1) have previously been described (52
, 53)
. IIH6C4 has been shown to block binding of
-dystroglycan to laminin and agrin (53
54
55)
. VIA4-1 binds to
-dystroglycan but does not interfere with binding to laminin (53)
. Thymus lobes were cultured in groups of 6 per well with a media change every 3 days of culture. The cultures were grown in a fully humidified incubator with 5% CO2 at 37°C. At day 3 or 6, thymocytes were harvested as described previously (56)
. Briefly, the thymus lobes were placed into a solution of collagenase (0.4 mg/ml) in 0.2 M phosphate buffer with 0.2 mg/ml EDTA, and the tissue was incubated at 37°C for 30 min. The lobes were dispersed into a single-cell suspension by gentle aspiration with a Pasteur pipette. This treatment disaggregates most of the lymphoid cells from the tissue. Subsequent incubation of the fragments of thymus tissue in a solution of 0.25% trypsin in the same EDTA/phosphate buffer as the collagenase for an additional 15–30 min at 37°C resulted in retrieval of the remaining lymphoid and nonlymphoid stromal cells of the culture. The dispersal of cells by pipetting was repeated until no visible fragments of tissue remained. After washing once in Hanks balanced salt solution (HBSS) plus 5% FBS to prevent further enzyme action, cell viability and cell number in both collagenase- and trypsin-extracted samples were determined by trypan blue exclusion assay. Viability was always >95%. The total number of cells recovered from each culture was determined by adding the cell recovery from collagenase treatment and trypsin treatment together.
RT-PCR and real-time PCR
Total RNA was isolated using Trizol reagent system, and residual DNA was eliminated by treatment with DNase I. Reverse transcription was performed using Moloney Murine Leukemia Virus (M-MuLV) reverse transcriptase (MBI Fermentas, Hanover, MD, USA), according to the manufacturers instructions. Subsequent amplification of DNA was performed using specific primers.
-Dystroglycan was amplified with forward AGGCGTCCATGCACTCAG and reverse TATTCACTACAGGCACCAAC primers. As a control for total RNA concentration, RT-PCR for GAPDH was performed with forward CTGCACCACCAACTGCTTAG and reverse GTCTGGGATGGAAATTGTGA primers and the mRNA concentrations were normalized to GAPDH. The resulting PCR products were analyzed by electrophoresis on a 1.5% agarose/TBE gel, and the amplicons were visualized and photographed under UV detection to identify the specificity and sensitivity of the products.
Portions of the cDNA were quantitatively analyzed for the specific expression of Bcl-2 and Bax by real-time PCR using a LightCycler instrument (Roche, Nutley, NJ, USA) and DNA-binding dye SYBR Green I (Roche) according to the manufacturers instructions. The primers used to amplify Bcl-2 were forward GTCACAGAGGGGCTACGAGT and reverse CAGCCAGGAGAAATAAACAG; for Bax, forward TGCTACAGGGTTTCATCCAGG and reverse TTCCAGATGGTGAGCGAGGC. Gene expression levels were normalized among samples using GAPDH primers listed above.
Flow cytometry
For two-color surface labeling, thymocytes (1x106) were incubated with anti-CD4-FITC (H129.19) and anti-CD8-PE (53–6.7) or the appropriately labeled isotype control Abs (BD Biosciences) at 4°C for 30 min, followed by washing 3x with PBS and fixing for 10 min in 4% paraformaldehyde. For three-color surface labeling, thymocytes (1x106) were incubated with 100 µl (1 µg) Ab against
-dystroglycan (6C1, mouse IgG, Chemicon, El Segundo, CA, USA) at 4°C for 30 min. After washing 3x with PBS, thymocytes were incubated for another 30 min with FITC-labeled rabbit anti-mouse IgG (Rockland, Gilbertsville, PA, USA), anti-CD4-PerCP (RM4–5), and anti-CD8-PE or the appropriate isotype control Abs (BD Biosciences) at 4°C, followed by washing 3x with PBS and fixing for 10 min in 4% paraformaldehyde. In some experiments, thymocytes were also stained with anti-CD4-PerCP, anti-CD8-FITC (53-6.7), and anti-CD95-PE (15A7) or anti-CD95L-PE (MFL3) (eBioscience, San Diego, CA, USA). Cells were analyzed on a FACSCalibur (Becton Dickinson, San Jose, CA, USA) with CellQuest software (Becton Dickinson).
Thymocyte apoptosis was measured as described elsewhere (57
58
59)
. Cells (1x106) were pelleted and gently resuspended in 1.5 ml hypotonic propidium iodide (PI, Sigma) solution (50 µg/ml in 0.1% sodium citrate plus 0.1% Triton X-100). The tubes were kept at 4°C in the dark overnight. The PI-fluorescence of individual nuclei was measured by flow cytometry using CellQuest software. The percentage of apoptotic cell nuclei (hypodiploid DNA peak in the DNA fluorescence histogram) was calculated. Thymocyte apoptosis was also determined using 7-aminoactinomycin (7-AAD, Sigma) staining in combination with CD4 and CD8 immunolabeling (60)
. Cell suspensions were first labeled with anti-CD4-FITC and anti-CD8-PE and then fixed in 80% ethanol for 30 min on ice. After fixation, cells were resuspended in PBS containing 0.1% Tween-20, 0.1 mM EDTA, and 25 µg/ml 7-AAD and immediately analyzed by flow cytometry. In addition, thymocyte apoptosis was determined using annexin V staining. Thymocytes were labeled with anti-CD4-PerCP and anti-CD8-PE and stained with annexin V-FITC (BD Biosciences), according to manufacturers instructions, then immediately analyzed by flow cytometry.
Intracellular phospho-ERK staining was adapted from a published protocol (61
, 62)
. Briefly, thymocytes (1x106) were pelleted and resuspended in 2% paraformaldehyde and incubated at 37°C for 10 min. The cells were pelleted and resuspended in ice-cold 90% methanol and incubated on ice for 30 min. After incubation, the cells were resuspended in Alexa Fluor 488-conjugated antiphospho-ERK Ab (Cell Signaling Technology, Beverly, MA, USA), incubated for 20 min at room temperature. After washing, the cells were labeled with anti-CD4-PerCP and anti-CD8-PE and analyzed by flow cytometry.
Retroviral vector and virus-producing cells (VPCs)
Plasmid pEGFP-DG (provided as a gift by Steven J. Winder, University of Sheffield, Sheffield, UK) was digested by XhoI and SmaI restriction enzymes to obtain fragments encoding full length of dystroglycan. The latter were reversely subcloned into pLXSN (63)
for the construction of antisense plasmid pLXSN-ASDG that was subsequently confirmed by PCR and DNA sequencing. Purified plasmids pLXSN and pLXSN-ASDG prepared by Qiagen Plasmid Mega Kit (Qiagen, Hilden, Germany) were each transfected into packaging cells PA317, and G418-resistant cells were cloned. Graded dilutions of filtered supernatants from the selected clones were measured for virus titers, assayed by G418-resistance of NIH-3T3 cells cultured with the supernatants for 1 day. Clones producing more than 106 CFU/ml were selected for subsequent experiments and named PA317-pLXSN and PA317-pLXSN-ASDG.
Preparation of thymocytes and thymic epithelial cells
CD4+CD8+ thymocytes were purified from thymuses of newborn mice (0–3 days) by positive panning on Petri dishes coated with 1 µg/ml anti-CD8 (53
54
55
56)
for 60 min at 4°C followed by 12–15 washes to remove unbound cells. Adherent cells were recovered and plated for a second time on anti-CD8-coated Petri dishes, and the process was repeated. More than 95% of the recovered adherent cells were CD4+CD8+ (9
, 64
65
66
67
68)
. Thymic epithelial cells were obtained by disaggregating 2-deoxyguanosine (2-dGuo, Sigma) -treated 15-gd fetal thymus lobes, as described elsewhere (69
, 70)
.
Reaggregate thymus organ culture (RTOC)
VPCs PA317-pLXSN, PA317-pLXSN-ASDG, and their parent cells PA317 as a control were reaggregated with thymic epithelial cells and fetal thymocytes from 15-gd fetal thymuses at a ratio of 1:25:6 by centrifugation, and small pieces of the aggregates were drawn in 1 µl into plastic tips to place onto the surface of a filter for 6 days of culture, as described elsewhere (71)
. In some experiments, purified DP thymocytes and thymic epithelial cells were mixed together by centrifugation at a ratio of 1:1, and the cell pellet was transferred to the surface of a filter for culture. In Ab blocking experiments, 10 µg/ml anti-
-dystroglycan Ab IIH6C4 or mouse IgM was added to the medium. After the indicated time period, cultures were teased apart and the recovered thymocytes were evaluated and analyzed by flow cytometry.
Proliferation assay
In each well of a 96-well round-bottom microtiter plate (Nunc. Roskilde, Denmark), splenocytes (5x106 cells/ml) from 4- to 6-week-old BALB/c mice were cultured in RPMI 1640 medium with or without 10 µg/ml concanavalin A (Con A, Sigma, St. Louis, MO, USA) and/or anti-
-dystroglycan Ab IIH6C4 (10 µg/ml). Additional cultures of splenocytes were incubated with or without anti-CD28 Ab (37–51, 2.5 µg/ml, BD Biosciences) and/or IIH6C4 in the 96-well plates either precoated with anti-CD3 Ab (2C11, 5 µg/ml, BD Biosciences) or not. All cell cultures were incubated in a fully humidified incubator with 5% CO2 at 37°C for 56 h. [3H]-thymidine (0.5 µCi, Shanghai Atomic Energy Institute, Chinese Academy of Science) was added to each well, and the cells were incubated for another 16 h. Cells were harvested onto glass fiber paper using a semiautomatic cell harvester (Shanghai Atomic Energy Institute, Chinese Academy of Science). Thymidine incorporation (cpm) was determined by a liquid scintillation counter (SN-6904, Shanghai Atomic Energy Institute, Chinese Academy of Science).
Formation and flow cytometric analysis of thymocyte-epithelial cell conjugates
Prior to conjugate formation, DP thymocytes were labeled with PKH26 (Sigma) according to manufacturers instructions, and thymic epithelial cells were labeled with CFSE (Sigma) at a concentration of 10 nM, for 10 min at 37°C. Thymocytes and thymic epithelial cells were then mixed at a ratio of 3:1 and treated with anti-
-dystroglycan, isotype Abs, or media at 37°C for 30 min and centrifuged. The resultant cell pellet was incubated at 37°C for 60 min, resuspended in PBS, and analyzed for conjugate formation by flow cytometry immediately, as described elsewhere (9)
.
Confocal observation of the thymocyte-epithelial cell conjugates
Confocal analysis of thymocyte-epithelial cell conjugates was performed as described elsewhere (9)
with modification. DP thymocytes and thymic epithelial cells were mixed at a ratio of 3:1 and treated with anti-
-dystroglycan, isotype Abs, or media at 37°C for 30 min and centrifuged at 500 g for 2 min in conical tubes. After centrifugation, the cells were incubated at 37°C for 60 min, resuspended, and adhered to poly(L-lysine)-coated slides at room temperature. Slides were fixed in 3.7% paraformaldehyde for 30 min and blocked at 4°C overnight in 1% FCS-PBS. The thymocytes were labeled with CD3-FITC mAb (eBioscience) at 4°C for 30 min, after washing cells were permeabilized in 0.1% Triton X-100 and the actin cytoskeleton was revealed by phalloidin-TRITC (Sigma) staining according to manufacturers instructions. Analyses were performed using two-photon confocal microscopy (Leica, Germany).
Statistics
Statistical significance between any two groups was analyzed by Students t test. Differences were considered statistically significant at values of P < 0.05.
| RESULTS |
|---|
|
|
|---|
-Dystroglycan was dynamically expressed on fetal thymocytes
-dystroglycan in fetal thymus. As fetal thymus from 14- or 15-gd mice is still a nonlymphoid tissue, we examined thymuses from 15- to 19-gd fetal mice. It was found that the gene coding for
-dystroglycan could be specifically amplified from total mRNA of thymuses from 15- to 19-gd fetal mice (Fig. 1
-dystroglycan was dynamically expressed on the four subpopulations of thymocytes from 15- to 19-gd fetal mice, especially on DP cells and SP cells (Fig. 1B
-dystroglycan on DP cells from 16- to 19-gd fetal mice was 97.62%, 99.57%, 99.59%, and 99.98% respectively; on CD4 SP cells from 16- to 19-gd fetal mice, 54.55%, 80.22%, 76.60%, and 90.42%, respectively; on CD8 SP cells from 16- to 19-gd fetal mice, 52.34%, 50.35%, 62.71%, and 95.41%, respectively; and on double-negative (DN, CD4–CD8–) cells from 15- to 19-gd fetal mice, 0.86%, 2.88%, 2.05%, 1.18%, and 8.30%, respectively (Fig. 1B
-dystroglycan was expressed on a large number of DP cells, while its expression on SP cells increased gradually over the course of development. However, DN cells expressed little to no
-dystroglycan even at the later stages of thymocyte development.
|
We also analyzed the thymocytes recovered from FTOC at 2–6 days of culture and found that
-dystroglycan was dynamically expressed on those thymocytes in a manner analogous to that in vivo (data not shown). These results demonstrated that
-dystroglycan was dynamically expressed on fetal thymocytes, especially on DP cells, suggesting a possible role of
-dystroglycan in thymocyte development.
Blocking
-dystroglycan decreased the number of DP thymocytes
Then we examined whether
-dystroglycan would play a role in thymocyte development. FTOC offers a model system in which the cellular interactions involved in fetal thymocyte development can be readily monitored and manipulated and have been used widely to study thymocyte development (72
73
74)
. However, blocking Ab was routinely used to explore the function of
-dystroglycan in certain tissues or cells (44
, 47
48
49)
. To explore the potential role of
-dystroglycan on thymocyte development, blocking Abs against
-dystroglycan IIH6C4 (10 µg/ml) were added to the media of FTOC. The results showed that blocking
-dystroglycan decreased the yield of total thymocytes recovered from 3 and 6 days of culture (Fig. 2
A). The degree of the decrease in cell number was dependent on Ab concentration, most apparent with the concentration of 10 µg/ml (data not shown). Thus, 10 µg/ml IIH6C4 was used for the subsequent experiments. To examine the specificity of
-dystroglycan blocking Ab IIH6C4 in reducing the yield of thymocytes from FTOC, control cultures were grown in the presence of mAb V1A4-1, which binds to
-dystroglycan but does not interfere with binding to laminin and agrin (53)
. The addition of V1A4-1 (10 µg/ml) to the cultures did not result in any decrease in the yield of total thymocytes (data not shown).
|
We subsequently examined which subpopulation of thymocytes was most affected by the treatment with IIH6C4. Flow cytometric analysis revealed that at 3 days of culture, the percentage of DP cells was significantly decreased in IIH6C4-treated FTOC compared with nontreated or isotype Ab controls, while the percentage of DN cells was increased. At 6 days of culture, the change was more striking (Fig. 2B
). However, we calculated that the absolute number of DN cells remained unchanged in IIH6C4-treated lobes, while the absolute number of DP cells was significantly decreased compared with nontreated or isotype Ab controls (Fig. 2C
). Moreover, the absolute numbers of CD4 SP and CD8 SP cells were also decreased at 6 days of culture (Fig. 2D
). No significant difference was found between nontreated and isotype Ab controls in the number of the four subpopulations of thymocytes (Fig. 2A-D
). These results demonstrated that blocking
-dystroglycan in FTOC reduced the absolute number of thymocytes, especially DP cells, a population that expresses high levels of
-dystroglycan.
To rule out the possibility that complement-dependent cytotoxicity (CDC) could be the cause of the decrease in cell number, we measured the complement levels in FTOC supernatants and organ extracts using the standard CH50 assay. We found that complement was not detectable in either FTOC supernatants or organ extracts (data not shown).
To further confirm the above results from Ab blocking experiments, we examined the effect of down-regulating
-dystroglycan expression on thymocyte development by infection with retroviruses carrying antisense cDNA of
-dystroglycan. As described elsewhere (71)
, RTOC was established with VPCs, thymic epithelial cells, and fetal thymocytes. This method was reported to ensure a highly efficient gene transfer into immature thymocytes (71)
. In our preliminary experiments, we investigated the infection efficiency by infecting thymocytes in RTOC with retroviruses carrying GFP marker. By FACS analysis of the GFP+ thymocytes, we found that the infection efficiency was
50–60%, comparable with that of other report (71)
. Our results showed that RTOC with VPCs PA317-pLXSN-ASDG resulted in a notable reduction of
-dystroglycan expression on total thymocytes and especially on DP cells recovered from 6 days RTOC compared to cultures with PA317-pLXSN or PA317 (data not shown). Our results showed that down-regulation of
-dystroglycan decreased the percentage and number of DP and SP cells (Fig. 3
A–C). Consistent with the results from Ab blocking experiments, these results further demonstrated that down-regulation of
-dystroglycan decreased the number of thymocytes especially DP cells and suggested that
-dystroglycan might be involved in thymocyte development.
|
Blocking
-dystroglycan increased apoptosis of DP thymocytes
The results described above implied that blocking
-dystroglycan decreased the number of thymocytes, especially DP cells. To examine whether apoptosis could explain the decreased number of thymocytes, we measured the hypodiploid DNA content of cultured thymocytes using PI staining. We found that the percentage of apoptotic thymocytes was increased about twice in IIH6C4-treated lobes (45.82%) than that in nontreated controls (25.90%) and isotype Abs-treated controls (26.24%) (Fig. 4
A).
|
To examine which subpopulations underwent increased apoptosis, we used 7-AAD staining in combination with CD4 and CD8 labeling. Enhanced apoptosis was observed in DP cells and, to a lesser extent, in SP cells but not in DN cells in IIH6C4-treated lobes compared with nontreated or isotype Ab controls (Fig. 4B
). Similarly, down-regulation of
-dystroglycan by retroviruses in RTOC also increased the percentage of apoptotic DP and SP cells (data not shown). Blocking
-dystroglycan increased the percentage of apoptotic DP cells and SP cells, indicating that
-dystroglycan might play a role in the development of both DP cells and SP cells or that the observed effects of blocking
-dystroglycan on SP cells development might be the result of its effects on DP cells development.
To rule out the possibility of Ab-induced apoptosis, we investigated the effect of anti-
-dystroglycan Ab IIH6C4 on mature lymphocytes, not under thymic development, and which also expressed
-dystroglycan. Addition of IIH6C4 (10 µg/ml) enhanced the proliferation of lymphocytes activated by Con A plus anti-CD3 and anti-CD28, as determined by [3H]-thymidine incorporation assay (Fig. 4C
). These results indicated that Ab IIH6C4 per se was unable to directly induce apoptosis in cells expressing
-dystroglycan and that
-dystroglycan might be implicated in antiapoptosis and/or survival signals of DP cells.
Blocking
-dystroglycan inhibited the formation of IS between DP thymocytes and thymic epithelial cells
Minter and Osborne (11)
hypothesized that the IS might be critical in transducing survival signals during thymocyte development and suggested that factors affecting IS assembly might influence T cell selection. Our previous studies have suggested that
-dystroglycan expressed on lymphocytes contributes to lymphocyte activation by participating in IS formation (50)
. To determine whether
-dystroglycan was involved in IS formation between DP cells and thymic epithelial cells, we adopted a model that was developed to study thymocyte responses as a consequence of interactions with epithelial cells using conjugates generated in vitro (9)
. We found that blocking
-dystroglycan significantly (P<0.01) reduced conjugate formation between DP cells and thymic epithelial cells from 13.02% to 7.16% (45% reduction) (Fig. 5
A). At the same time, blocking
-dystroglycan reduced actin rearrangement between DP cells and thymic epithelial cells (Fig. 5B
). These results indicated that
-dystroglycan was involved in IS formation between DP cells and thymic epithelial cells.
|
Both CD95/CD95L and Bcl-2 pathways were involved in increased apoptosis of DP thymocytes induced by blocking
-dystroglycan
We explored signaling pathways that could be involved in increased apoptosis of DP cells by blocking
-dystroglycan expression. Previous studies have suggested that CD95/CD95L pathway plays a pivotal role in thymocyte apoptosis (75)
and that disruption of the cytoskeleton causes cell apoptosis via activation of CD95 (76)
. This finding led to the speculation that CD95/CD95L pathway might be involved in our system. Flow cytometric analysis demonstrated that in IIH6C4-treated lobes, the expression of CD95 and CD95L was preferentially increased in DP cells and, to a lesser extent, in SP cells but not in DN cells compared to that of nontreated or isotype Ab controls (Fig. 6
A, B). These results indicated that CD95/CD95L pathway was involved in the increased apoptosis of DP thymocytes induced after blocking of
-dystroglycan.
|
Bcl-2 expression is enhanced in developing thymocytes after positive selection and promotes survival of positively selected thymocytes. Although Bcl-2 is not a causal event in positive selection, its up-regulation is tightly correlated with positive selection events (77)
. We questioned whether the Bcl-2 pathway was also involved in increased apoptosis of developing thymocytes. Real-time RT-PCR analysis indicated that the expression of Bcl-2 was decreased in IIH6C4-treated lobes, compared to that of nontreated or isotype Ab controls (Fig. 6C
), although Bax expression was not altered. These results suggested that Bcl-2 pathway may be partially involved in the increased apoptosis of developing thymocytes. Collectively, our results indicated that both CD95/CD95L and Bcl-2 pathways were probably implicated in the increased apoptosis of DP cells induced by blocking
-dystroglycan.
Increased apoptosis in DP cells after blocking of
-dystroglycan was associated with a decrease in positive selection
Finally, we examined the consequences of blocking
-dystroglycan on positive selection. We first analyzed a key event in positive selection, ERK phosphorylation in DP cells. Cross-linking of the TCR on developing DP thymocytes induces phosphorylation of ERK, which is critical for thymocyte maturation (4)
. We established RTOC with purified DP thymocytes and thymic epithelial cells and examined the effect of anti-
-dystroglycan Ab IIH6C4 on ERK phosphorylation in DP cells. We found that, consistent with our above results, the percentage of apoptotic cells in DP thymocytes was increased after blocking
-dystroglycan for 36 h (Fig. 7
A). Meanwhile, the percentage of phospho-ERK-positive cells in DP thymocytes was significantly decreased from 38.46% to 16.54% (P<0.01, Fig. 7B
), indicating that positive selection might be reduced. To further explore the effect of
-dystroglycan blocking on positive selection, cultures were maintained for 3 days and then thymocytes were recovered. We found that the absolute numbers of CD4 SP and CD8 SP cells were significantly decreased after blocking
-dystroglycan (P<0.01, Fig. 7C
). Thus, our results suggested that increased apoptosis in DP cells induced by blocking
-dystroglycan was associated with a decrease in positive selection.
|
| DISCUSSION |
|---|
|
|
|---|
-dystroglycan in positive selection by participating in IS formation between DP cells and thymic epithelial cells. These results, consistent with our previous study (50)
-dystroglycan functions in lymphocyte development and activation.
The thymus provides a specialized microenvironment for T-cell development (78)
. Previous studies have shown that many components are involved in thymocyte development (72
73
74
, 79)
, including ECM integrin (80)
and laminin (81
, 82)
. Laminin-2, a ligand of
-dystroglycan (83)
, and its integrin receptor VLA-6 interaction play an active role in thymocyte development by delivering cell survival and differentiation signals at specific stages of development in young adult mice. Laminin-2 deficient mice show a significant reduction in thymus size and thymocyte number compared to normal littermates and also exhibit apparent alterations of thymic architecture (81)
. It is of interest that the interaction between laminin 5 made by epithelial cells and thymocytes is required for the survival and differentiation of mouse thymocytes (82)
. Merosin, another ligand of
-dystroglycan found in thymus, functions as a costimulatory molecule for human thymocyte proliferation (84
, 85)
. Dystroglycan, an important ECM component, interacts with laminin1 and laminin2 in skeletal muscle and kidney glomerular basement membrane. Williamson et al. (86)
have generated a null allele of dystroglycan (Dag1neo2) in mice. Homozygous Dag1neo2 embryos exhibit gross developmental abnormalities beginning around 6.5 days of gestation. These results strongly suggest that dystroglycan might be a crucial protein in embryo development. Our present study indicated that
-dystroglycan was involved in thymocyte development as well as its ligands, such as laminins and merosin, providing additional understanding for the function of ECM in thymocyte development.
Our results indicated that
-dystroglycan was involved in IS formation between DP cells and thymic epithelial cells. Previous studies, including those involving muscle and others tissues, have demonstrated that dystroglycan acts as a linker between ECM and the actin cytoskeleton and that polymerization of the actin cytoskeleton provides the initial cellular polarization necessary for signaling molecule recruitment and intracellular responses to TCR signals within lymphocytes (87)
, which supports our hypothesis. Further support is found in the modified affinity/avidity model that posits positive costimulation affects the fate of developing thymocytes (88)
. Consequently, a moderate affinity/avidity TCR/peptide/MHC interaction, which would normally fall within the threshold for positive selection, could be negatively selected if excessive positive costimulatory signals were delivered in combination with a TCR signal. By extension, a thymocyte expressing a TCR with the same moderate affinity/avidity interaction would fail to be positively selected if inhibitory costimulation was partnered with TCR signaling. Studies have shown that increased signaling through CD2 and CD28 leads to changes in selection (88)
and that thymic epithelia engineered to express CD80 convert positive selection of thymocytes to negative selection as a result of enhanced signaling through costimulatory-dependent raft recruitment (9)
. These studies argue for changing the affinity/avidity model to incorporate the demonstrated effects of both negative and positive costimulatory signals on thymocyte selection. One recent study has identified PD-1/PD-L1 as a negative regulator of positive selection that can modulate thymocyte fate decisions (62)
. Our present study demonstrated that blocking
-dystroglycan impaired ERK phosphorylation in DP thymocytes and led to the increased apoptosis of DP cells, which resembled death by neglect undergone by the majority of DP thymocytes that failed to recognize any of the available peptide/MHC molecules. Thereby, our study indicated that
-dystroglycan might serve as a positive regulator of positive selection capable of modulating thymocyte fate decisions.
Although dystroglycan signaling pathways have not been clearly defined, particularly in thymocytes, other reports have provided evidence supporting the participation of dystroglycan, and therefore the DGC, in cell-survival signaling in differentiated muscle cells (89)
. The role of ECM in mediating cell-substrate interactions and subsequent intracellular signaling has been well established in numerous cell types (90)
. It is, therefore, not unexpected that disruption of cell association with ECM results in increased cell death, presumably through a loss in intracellular survival signaling emerging from cell-substrate interactions (91)
. Evidence of adhesion-mediated phosphorylation of DGC components (including β-dystroglycan) and the ability of these events to regulate protein-protein interactions (92)
provide further evidence that the DGC is involved in the propagation of signals from ECM. Binding sites for the adaptor molecule Grb2 have been identified on β-dystroglycan (93)
. Furthermore, Grb2 has been identified as a component of the Ras/MAPK signaling pathway and has been linked to the maintenance of growth factor or ECM-mediated survival signaling (94)
. Consequently, one possible mechanism by which the MAPK/ERK pathway may become activated following binding of the DGC to ECM is via the adaptor molecule Grb2. Relevant to this point, one study suggested a role for dystroglycan as a scaffold that can interact with components of the ERK-MAP kinase cascade including MEK and ERK (95)
. These studies provide evidence of direct or indirect interactions between members of the DGC and established MAPK/ERK pathway and serve to bolster our findings that blocking
-dystroglycan impaired ERK phosphorylation in DP thymocytes resulting in increased apoptosis of DP cells.
We demonstrated that enhanced apoptosis as well as increased expression of CD95 and CD95L was observed in DP cells and, to a lesser extent, in SP cells in IIH6C4-treated lobes when compared with nontreated or isotype Ab controls. DP thymocytes selectively undergo apoptosis when exposed to agonistic anti-CD95 Abs in vitro and in vivo, whereas SP thymocytes were resistant to CD95-induced apoptosis despite their abundant expression of CD95 (96
, 97)
.
What will happen to DP cells if the mice were treated in vivo with anti-
-dystroglycan antibody? We hypothesize that after in vivo treatment with anti-
-dystroglycan antibody, DP cells would also undergo increased apoptosis due to the unsuccessful IS formation. FTOC culture system is a widely used three-dimensional in vitro culture system for thymocyte development, which highly resembles the situation of thymocyte development in vivo. Our previous study (98)
compared the FTOC and the in vivo system extensively and also confirmed that the whole situation of thymocyte development, including total thymocyte number, the percentages of the four subpopulations, was very similar for the two systems, except for a 2 day delay for the FTOC system. Therefore, in vivo blocking or down-regulation of
-dystroglycan expression may generate the similar effects as shown in our present study. Williamson et al. (86)
demonstrated that the homozygous dystroglycan–/– embryos exhibited gross developmental abnormalities beginning around 6.5 days of gestation, indicating that dystroglycan might be a crucial protein in embryo development and also providing us an indirect support. Actually, considering that
-dystroglycan also plays critical roles in synapse formation in neural-muscle junction, lymphocyte synapse formation and activation, and also other specific developmental processes such as renal epithelial morphogenesis, we suppose that blocking
-dystroglycan in vivo would lead to a more serious consequence.
In summary, these data demonstrated that by inhibiting IS formation, blocking
-dystroglycan led to increased apoptosis of DP thymocytes and, thereby, altered positive selection. Both CD95/CD95L and Bcl-2 pathways were involved in increased apoptosis of DP thymocytes. Our findings indicated that
-dystroglycan was involved in positive selection by participating in IS formation between DP cells and thymic epithelial cells.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Received for publication July 8, 2007. Accepted for publication November 29, 2007.
| REFERENCES |
|---|
|
|
|---|
-dystroglycan is involved in epithelial development. J. Cell Biol. 130,79-91
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |