FASEB J. FASEB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

(The FASEB Journal. 2008;22:918-929.)
© 2008 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schmidt, R. L.
Right arrow Articles by Tang, A. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schmidt, R. L.
Right arrow Articles by Tang, A. H.
(The FASEB Journal. 2008;22:918-929.)
© 2008 FASEB

Infection-induced proteolysis of PGRP-LC controls the IMD activation and melanization cascades in Drosophila

Rebecca L. Schmidt*, Theodore R. Trejo{dagger}, Timothy B. Plummer{dagger}, Jeffrey L. Platt{dagger},{ddagger},§ and Amy H. Tang*,{dagger},1

Departments of
* Biochemistry and Molecular Biology,

{dagger} Surgery,

{ddagger} Immunology, and

§ Pediatrics, Mayo Clinic Cancer Center, Mayo Clinic College of Medicine, Rochester, Minnesota, USA

1Correspondence: Mayo Clinic College of Medicine, 200 First St. SW, Medical Sciences 2–85, Rochester, MN 55905 USA. E-mail: tang.amy{at}mayo.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The Drosophila immune deficiency (IMD) pathway, homologous to the mammalian tumor necrosis factor (TNF-{alpha}) signaling pathway, initiates antimicrobial peptide (AMP) production in response to infection by gram-negative bacteria. A membrane-spanning peptidoglycan recognition protein, PGRP-LC, functions as the receptor for the IMD pathway. This receptor is activated via pattern recognition and binding of monomeric peptidoglycan (DAP-type PGN) through the PGRP ectodomain. In this article, we show that the receptor PGRP-LC is down-regulated in response to Salmonella/Escherichia coli infection but is not affected by Staphylococcus infection in vivo, and an ectodomain-deleted PGRP-LC lacking the PGRP domain is an active receptor. We show that the receptor PGRP-LC regulates and integrates two host defense systems: the AMP production and melanization. A working model is proposed in which pathogen invasion and tissue damage may be monitored through the receptor integrity of PGRP-LC after host and pathogen are engaged via pattern recognition. The irreversible cleavage or down-regulation of PGRP-LC may provide an additional cue for the host to distinguish pathogenic microbes from nonpathogenic ones and to subsequently activate multiple host defense systems in Drosophila, thereby effectively combating bacterial infection and initiating tissue repair.—Schmidt, R. L., Trejo, T. R., Plummer, T. B., Platt, J. L., Tang, AH. Infection-induced proteolysis of PGRP-LC controls the IMD activation and melanization cascades in Drosophila.


Key Words: innate immunity • host defense • IMD signaling pathway • antimicrobial peptide


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
ON PATHOGEN DETECTION, THE HUMAN immune system mounts a two-pronged defense that integrates both innate and adaptive immune responses. In contrast, Drosophila melanogaster relies solely on a highly conserved innate immune system for defense against pathogens (1 , 2) . Thus, Drosophila provides a simple model system for gaining insights into human innate immune signal transduction pathways disentangled from those of adaptive immunity. Innate immunity in Drosophila consists of two integral parts: cellular and humoral immunity (1 , 3) . Cellular immunity includes phagocytosis, coagulation, and melanization in response to infection and tissue damage (1 , 4 5 6) . Humoral immunity produces antimicrobial peptides (AMPs) in the fat body and secretes them into the hemolymph to bind and neutralize invading microbes. AMP production is controlled by two evolutionarily conserved signal transduction pathways: TOLL and IMD, which in turn activate distinct NF-{kappa}B transcription factors that drive production of specific AMPs (1 , 7) .

The Drosophila TOLL signaling pathway controls the production of Drosomycin and other immunity factors in response to fungal and gram-positive bacterial invasion (1 , 8 , 9) . However, unlike mammalian TOLL-like receptors (TLRs), Drosophila TOLL does not directly recognize microbial molecular patterns such as components of the bacterial cell wall. Rather, pattern recognition in the TOLL pathway depends on a number of upstream pattern recognition molecules: a circulating PGRP-SA (Semmelweis), gram-negative binding proteins (GNBP1 and GNBP3), PGRP-SD, a serine protease (Persephone) and a serine protease inhibitor (Serpin) (10 11 12 13 14 15) . There are three protease-dependent recognition cascades upstream of TOLL that converge at the proteolytic cleavage of the cytokine Spätzle (Spz) as reviewed in (1) . The cleaved Spätzle binds to TOLL and activates the downstream NF-{kappa}B signaling pathway (16 , 17) . Multiple serine proteases have been identified in Spätzle processing (18 19 20) . Thus, the mode of TOLL activation sets a precedent for a protease-dependent mechanism of innate immune activation in Drosophila.

The Drosophila IMD pathway controls the production of Diptericin and other immunity factors in response to gram-negative bacterial infection (1 , 8 , 21) . Activation of the IMD pathway requires the type II transmembrane receptor PGRP-LC and its coreceptors (22 23 24 25) . There are 13 members in the Drosophila PGRP family (26 27 28 29) , some of them, PGRP-LC, -LE, -SA, -SD, -SC1a, have known function in discriminating microbial infection, binding PAMPs and thus functioning as pattern recognition receptors (11 , 15 , 22 23 24 , 30 31 32) . PGRP-LC recognizes gram-negative bacteria and activates the IMD pathway through binding of unique microbial pattern recognition molecules, such as DAP-PGN with its extracellular PGRP domain (31 , 33 , 34) . However, the cleavage mechanism by which DAP-PGN is generated during an active infection is not clear. The dimerization of PGRP-LC can activate the IMD pathway in Drosophila S2 cells (35 , 36) , but whether the receptor integrity of PGRP-LC is affected by infection-mediated proteolysis has not been determined.

The insect exoskeleton provides the first line of defense as a physical barrier to pathogen infection (6 , 37 , 38) . When the structural integrity of the Drosophila exoskeleton is compromised, multiple innate defense mechanisms are activated, including AMP production and melanization (1 , 6) . The melanization cascade mediates hemolymph activation, wound clotting, and melanin production at the exoskeletal breakage site to prevent internal spread of microorganisms (4 , 6 , 37 , 39) . Two signaling components in the TOLL and IMD pathway are known to regulate both melanization responses and AMP production. One is the coreceptor of PGRP-LC, PGRP-LE, whose expression induces an infection-independent activation of melanization responses in Drosophila (30) . Another is a serine protease inhibitor, Serpin27A (Spn27A) that is known to suppress TOLL activation and melanization cascades in Drosophila (40 41 42 43) . However, the functional synergy between AMP production and melanization remains to be further defined in Drosophila.

What factors enable a host cell to differentiate between a pathogenic vs. a nonpathogenic microbe is a fundamental question in cell biology. Our understanding of innate immunity has advanced with the realization that innate immunity receptors/sensors are able to recognize both exogenous and endogenous signals (44 45 46 47) . Yet how endogenous and exogenous immune stimuli are generated during infection is unclear. The small size and nature of these innate immune agonists suggests an enzyme-mediated cleavage event for their production during pathogen-host antagonism. Since bacterial cell wall components may be cleaved during infection to generate microbial molecular patterns such as LPS and PGN, it is conceivable that some host innate immunity receptors/sensors on the cell surface may also be similarly exposed to infection/inflammation-dependent proteolysis. Both pathogens and commensals share common PAMPs, but hosts do not attack commensal bacteria under normal circumstances (48 49 50 51) . It is likely, therefore, that some mechanisms in addition to the pattern recognition strategy may exist (51 52 53) .

In this report, we present evidence to show that the receptor PGRP-LC is down-regulated in response to Salmonella/Escherichia coli (gram-negative bacteria) infection, while no change in PGRP-LC expression occurs following challenge by Staphylococcus (gram-positive bacteria) in vivo. A membrane-spanning and ectodomain (PGRP)-deleted PGRP-LC functions as a constitutively active receptor in the absence of bacterial infection. PGRP-LC may control both AMP production and melanization. Thus, PGRP-LC may not only recognize exogenous microbial molecular patterns (DAP-PGN) through its extracellular PGRP domain but also activate the IMD pathway in response to pathogen infection and tissue damage following the loss of its structural integrity.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Reagents
Alexa Fluor 594-conjugated E. coli was purchased from Molecular Probes (Invitrogen) and washed extensively before microinjection. Purified human neutrophil elastase (24 U/ml) was purchased from Calbiochem (La Jolla, CA, USA) and 1–2 µl of elastase (3 U/ml) was microinjected in each animal. Anti-FLAG-M5 and anti-Actin antibodies were purchased from Sigma-Aldrich (St. Louis, MO, USA) and were used at a 1:2000 dilution for Western blot analysis.

PGRP-LC transgenic flies
Multiple UAS transgenic lines carrying the full-length N-terminal FLAG-tagged or C-terminal GFP-tagged PGRP-LCa/x as well as the receptor fragments (PGRP-LC-I, -II, -III, -IV, -V and -VI) were established using P-element-mediated transformation ( Fig. 2A ) (54) . To generate PGRP-LC fragments lacking extracellular domain (PGRP), PGRP-LC-I (1–323 amino acids) contains a membrane-spanning intracellular (IC) fragment that is identical among all three PGRP-LC isoforms, while soluble PGRP-LC-II (1–291 amino acids) contains the common intracellular fragment that interacts with IMD ( Fig. 5A ). Either a membrane-tethered extracellular (EC) fragment [PGRP-LCa-III (292–520 amino acids) or PGRP-LCx-IV (292–500 amino acids)] or only a soluble EC fragment [PGRP-LCa-V (312–520 amino acids) or PGRP-LCx-VI (312–500 amino acids)], lacking the IC domain was designed, PCR synthesized, sequence confirmed, and cloned into pMET and pUAST vectors. A FLAG tag was added to the N terminus of each truncated receptor to facilitate subsequent biochemical analyses. Multiple independent transgenic lines (4 5 6 7 8 9 10 11 12) were generated for each transgene. Genetic crosses were performed according to standard procedures.


Figure 1
View larger version (50K):
[in this window]
[in a new window]

  		Figure 1. IMD activation during natural infection vs. septic injury and E. coli infect Drosophila intestines in natural infection. Wild-type (OR) flies were challenged with gram-negative bacteria using two standard methods: natural infection and septic injury. A, C) For natural infection, adult flies were exposed to concentrated live and fixed (dead) gram-negative bacteria, as well as protease-deficient E. coli, BL21(DE3) for 2 days on low-salt LB plates. AMP production (Drosomycin and Diptericin mRNA expression) was examined by Northern blots (A). The relative levels of AMP expression, Diptericin/rp49 and Drosomycin/rp49, are shown in the bar graph (C). Note that only live bacteria infection was sufficient to induce robust IMD activation, whereas the dead and protease-deficient E. coli did not. B, D) For septic injury, adult flies were punctured using microinjection needles dipped in concentrated live and fixed (dead) gram-negative bacteria, as well as protease-deficient E. coli, BL21(DE3), and inoculated overnight. AMP production (Drosomycin and Diptericin mRNA expression) was examined by Northern blot analysis (B). The relative levels of Diptericin/rp49 and Drosomycin/rp49 mRNAs are shown in the bar graph (D). Note that sterile puncture is sufficient to induce IMD activation, and live Salmonella injection further augments IMD activation. Northern blot analysis was performed using 25 µg of total RNA extracted from the treated flies, and the blots were hybridized with 32P-labeled cDNA probes to antimicrobial peptides of Drosomycin and Diptericin. The rp49 mRNA expression was used as an internal control. E–H) 1x PBS control and E. coli-infected flies via natural infection method were embedded in paraffin blots. The abdominal morphologies of uninfected and E. coli-infected adult flies are shown. Hematoxylin and eosin staining (H&E) is used to view adult abdominal morphology/cellular histology using serial paraffin sections (E, F). Gram staining was used to stain for the presence of commensal and/or E. coli introduced in the food postinfection (G, H). Note that there is markedly enhanced Gram-negative staining in the intestines of E. coli-infected flies when compared to uninfected flies (marked by red arrows), demonstrating that natural infection is an effective method to infect adult flies.


Figure 2
View larger version (45K):
[in this window]
[in a new window]

  		Figure 2. PGRP-LC is down-regulated in response to natural infection in vivo. A) Schematic representations of the full-length and the truncated receptors (I to VI) are shown. Identical intracellular and transmembrane (TM) domains are shown as gray boxes, and the divergent extracellular PGRPx/a domains are shown as purple and blue boxes. The FLAG tag (black bar) was added to the N terminus of PGRP-LC, and the GFP tag (green circle) was added to the C-terminus of PGRP-LC to facilitate subsequent biochemical and imaging studies. B) The expression levels of the receptor PGRP-LCx/a under the control of Cg-GAL4 in adult stages are shown. C–F) Transheterozygous adult flies (C) and larvae (E, F) carrying FLAG-tagged PGRP-LC under the control of Cg-GAL4 were placed on E. coli, Salmonella, Staph, or sterile LB plates for 2 days under natural infection conditions. No bacterial injection or physical wounding was administrated to the animals during natural infection. The position of the full-length PGRP-LCa/x is marked by black arrows on Western blots. Two nonspecific bands at 55 and 85 kDa that cross-reacted with anti-FLAG-M5 mAb in fly protein extracts are marked by asterisks (*). Cleaved PGRP-LC fragments are highlighted by red arrows. D) PGRP-LCa-GFP expression in the larval fat bodies under the control of Cg-GAL4 was monitored in response to E. coli infection. The mock infection was carried out on a sterile LB plate. GFP and bright-field images captured at the start and end points of the experiments are shown.


Figure 3
View larger version (51K):
[in this window]
[in a new window]

  		Figure 3. PGRP-LC is down-regulated in response to septic injury in vivo, and membrane-expressed PGRP-LC is readily accessible to protease cleavage. Larvae expressing PGRP-LC-GFP in fat bodies under the control of Cg-GAL4 were microinjected with live Salmonella, dead RED-E. coli, or exogenous elastase. A, D, H) Preinjection images of the transgenic larvae are shown. B, C) Marked reduction of the PGRP-LC- GFP signal was observed in 2–4 h on live Salmonella infection. E, F) Larvae were microinjected with Alexa Fluor 594-conjugated E. coli (dead RED-E. coli). The microinjection needle and injection position are indicated by white arrows, GFP (E) and bright field (F). G) Although some red Alexa Fluor 594-conjugated E. coli were clearly adhered to the surface of the fat bodies (insert), only a moderate reduction in PGRP-LC-GFP signal was observed. H–J) To determine whether the receptor PGRP-LC is accessible to serine protease-mediated cleavage, a small amount (1–2 µl) of elastase (24 U/ml) was microinjected into Cg-PGRP-LC-GFP larvae. I, J) The PGRP-LC-GFP signal rapidly disappeared within 2–6 min, indicating that the surface-expressed PGRP-LC was readily accessible for elastase cleavage. K) Larvae expressing FLAG-tagged PGRP-LCa were punctured with a sterile or a Salmonella-dipped microinjection needle. Western blot analysis was performed. The full-length PGRP-LC is marked by a black arrow and a cleaved PGRP-LC intermediate is marked by a red arrow on the Western blot. L) Bright green Cg-PGRP-LC-GFP larvae were selected for Salmonella injection. A glass microinjection needle dipped in concentrated Salmonella was used to puncture larvae once in the dorsal flank. A time-lapse series of GFP signals was recorded in the wounded animals.


Figure 4
View larger version (68K):
[in this window]
[in a new window]

  		Figure 4. A membrane-spanning and ectodomain-deleted PGRP-LC-I is an active receptor. The full-length (FL) and the truncated receptors (I to VI) were expressed under the control of Cg-GAL4, Yp1-GAL4, and HML-GAL4. No bacterial injection or puncture was administrated to these animals. A) Transheterozygous adults were placed on LB or E. coli plates overnight. Northern blots were carried out as described. B, C) IMD activation in transheterozygous flies expressing PGRP-LC-FL, I and II in fat bodies and immune cells was examined in the absence of E. coli infection. Four independent transgenic lines (I11A, I23B, I30A, and I31A) on different chromosomes were examined and all exhibited robust production of Diptericin mRNA under the control of either Cg-GAL4 or YP1-GAL4. D) Expression of PGRP-LC-FL and PGRP-LC-I under the control of Cg-GAL4 activated the melanization cascade while other PGRP-LC fragments (II to VI) did not. The melanization phenotypes in larvae and adults are shown.


Figure 5
View larger version (28K):
[in this window]
[in a new window]

  		Figure 5. A working model summarizing the TOLL and IMD activation mechanisms in Drosophila. Schematic illustration of the infection-dependent activation of Drosophila IMD and TOLL pathways is shown. It is well established that the TOLL ligand, Spätzle, is processed by an infection-activated proteolytic cascade and the cleaved Spätzle binds and activates the TOLL pathway (1) . The receptor PGRP-LC can be activated by direct binding of bacterial elicitors (monomeric or polymeric DAP-PGN) (1 , 31 , 33) . In addition to the known mechanism of PGRP-LC activation via DAP-PGN binding, we propose that PGRP-LC may also be activated by an infection-induced proteolysis mechanism. The receptor integrity of PGRP-LC may constitute a "tissue well-being" signal. The ectodomain (PGRP) -cleaved receptor is an active receptor that may signal irreversible damage to PGRP-LC and thus send a clear "danger" signal to the hosts. The activated PGRP-LC may coordinate two host defense systems (AMP production and melanization) to fend off bacterial infection and initiate tissue repair.

The PCR primers were as follows (restriction enzyme sites are underlined, start codon and stop codon are bold-faced, and the FLAG epitope tag is bold-faced and underlined): N-terminal PGRP-LC forward FLAG primer (EcoRI): 5'-GGCGAATTCAGGAGAACGCCACCATGGATTACAAGGATGACGACGATAAGCCTTTTAGCAATGAAACGGAAATGAGCC-3'; intracellular reverse primer (NotI) terminating right before the TM domain: 5'-GGCGCGGCCGCTCAGGTGGCCAGTACGATACCCAGAGG-3'; intracellular plus TM common region reverse primer (NotI) terminating at the conserved amino acids TTNLFGKTLNQ: 5'-GGCGCGGCCGCTCATTGGTTCAACGTCTTTCCGAAGAGA-3'; Forward FLAG tagged TM and extracellular domain primer (EcoRI): 5'-GGCGAATTCAGGAGAACGCCACCATGGATTACAAGGATGACGACGATAAGGCCGTCACAGTTACAGTGGTTTTTGTAAC-3'; C-terminal PGRP-LCa reverse primer (NotI): 5'-GGCGCGGCCGCTCACGACCAATGAGTCCAGTTGGC-3'; C-terminal PGRP-LCx reverse primer (NotI): 5'-GGCGCGGCCGCTTAGATTTCGTGTGACCAGTGCGGCCA-3'; FLAG tagged extracellular PGRP-LCa forward primer (EcoRI): 5'-GGCGAATTCAGGAGAACGCCACCATGGATTACAAGGATGACGACGATAAG ACCACAAATCTCTTCGGAAAGACGTTGAA-3'; FLAG tagged extracellular PGRP-LCx forward primer (EcoR I): 5'-GGCGAATTCAGGAGAACGCCACCATGGATTACAAGGATGACGACGATAAG ACCACAAATCTCTTCGGAAAGACGTTGAA-3'.

Bacterial infection in vivo
For natural infection, the OR or transheterozygous flies expressing either FLAG- or GFP-tagged full-length PGRP-LC were placed on LB plates containing freshly grown and confluent E. coli [XL1-Blue and BL21 (DE3) (Stratagene, La Jolla, CA, USA)], Salmonella typhimurium (Salmonella), Staphylococcus carnosus (Staph), or sterile LB plates as controls. Yeast paste with or without E. coli/Salmonella/Staph added was provided as a food and water source for the 2-day infection experiments. One-fifth of the standard amount of NaCl was used to make the low-salt LB plates. No injection or physical wounding was administered to these animals in natural infection.

For septic injury, a glass microinjection needle dipped in concentrated bacteria was used to puncture larvae one time in the dorsal flank. The puncture wounds were small, and no discernible amount of body fluid was lost from the injected animals. Live animals were collected for Western blot analysis at 10 h (PBS puncture) and 7 h (Salmonella puncture) after injection.

RNA etraction and Northern blot
RNA extraction was carried out as described (55) . Activation of TOLL or IMD was assayed by determining the expression level of Drosomycin or Diptericin mRNA using total RNA extracted from the treated flies. Ribosomal protein rp49 mRNA was used as internal control to monitor the uniformity of RNA loading.

Histology and immunohistochemistry
Immunohistochemical staining was performed on formalin/DMSO-fixed and paraffin-embedded whole-mount Drosophila adults. Our fixation and embedding protocol was modified based on the standard histology protocols commonly used for processing human tumor tissues. Five-micrometer-cut sections were deparaffinized, rehydrated in graded ethanol and stained with Hematoxylin and eosin (H&E) and Gram staining as described (56 57 58) .


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Natural infection vs. septic injury
Using the two well-established methods of infection, natural infection and septic injury, we compared IMD activation by Northern blot analysis of Diptericin and Drosomycin mRNA expression in wild-type OR flies (11 , 59 , 60) . No injection, puncture or physical wounding was administered in natural infection. Natural infection of OR flies on live Salmonella/E. coli lawn induced a robust activation of the IMD pathway; in contrast, exposure of OR flies to dead Salmonella/E. coli lawn did not activate the IMD pathway (Fig. 1 A, C). The results confirm that live Salmonella/E. coli are potent inducers of IMD activation, while dead Salmonella/E. coli are unable to trigger IMD activation in natural infection.

Using septic injury to infect OR flies, we observed markedly elevated levels of Diptericin mRNA expression when live Salmonella were microinjected, a clear indication of IMD activation (Fig. 1B, D ). However, sterile PBS microinjection also led to a moderate induction of the IMD pathway, likely due to tissue damage at injection sites. The IMD activation was much more pronounced when live Salmonella were coinjected when compared to PBS or dead bacterial injection (Fig. 1B, D ). Consistent with the published literature (1) , infection of OR flies with live gram-negative bacteria, either through natural infection or microinjection, is a potent inducer of the IMD activation. On the other hand, tissue damage caused by sterile injection alone is sufficient to induce moderate IMD activation even in the absence of bacterial infection. Thus, natural infection may be a suitable method to examine endogenous receptor/sensor processing during live infection, while septic injury may be a better method to deliver pattern molecules (e.g., Lysine-type PGN and DAP-PGN) directly into Drosophila (33 , 34) bypassing the exoskeleton barriers.

There is no established protocol to vigorously differentiate the presence of commensal vs. invading bacteria in vivo, although the IMD activation observed above is a clear indication that natural infection is an effective method to infect hosts when pathogens are fed to the flies in their food (Fig. 1A, C ). To demonstrate that E. coli indeed got into the hosts using the natural infection method, we embedded 1x PBS-treated and E. coli-infected adults flies in paraffin blocks and performed H&E and Gram staining to show where E. coli reside in the fly bodies after natural infection. The results demonstrated that E. coli indeed get into the fly intestines as shown by the enhanced Gram staining in the guts (Fig. 1F, H ) when compared to the controls (Fig. 1E, G ). Thus, natural infection should be a useful method to dissect the complex cellular and pathological interactions during pathogen-host antagonisms in the Drosophila gastrointestinal systems. The simple paraffin section and Gram staining method should be useful for determining pathogen invasion mechanisms; mobilization of host cellular defenses; infection initiation, progression and resolution; ultimately to understand the dynamics and interplay between pathogen-host interaction at the molecular, cellular, organ and organismal levels in Drosophila.

Loss of receptor integrity of PGRP-LC in response to live Salmonella/E. coli infection under natural infection condition in vivo
To determine whether PGRP-LC expression and receptor integrity was modulated by live infection in vivo, we generated transgenic flies expressing full-length PGRP-LCx/a with either a C-terminal GFP-tag or an N-terminal FLAG-tag. The extracellular GFP tag or intracellular FLAG tag on PGRP-LC was used to track receptor cleavage postinfection by live imaging and biochemical analyses (Fig. 2 A). PGRP-LC was expressed under the control of Cg-GAL4, which directs transcription in the larval fat body, the anterior lobe of the lymph gland, and the circulating hemocytes (61) . The expression of FLAG-tagged PGRP-LCa/x was readily detected in both adults and larval stages, and no degradation products were detected under normal conditions (Fig. 2B ). The GFP-tagged-PGRP-LC has a membrane expression pattern in fat bodies in vivo, and the extracellular PGRP-LC-GFP signal was stably maintained under uninfected conditions (Fig. 2D6 , Supplemental Movies 1 and 2).

To examine whether distinct types of bacterial infection modulated the receptor PGRP-LC differently, we examined how the PGRP-LC expression in transheterozygous animals was altered in response to gram-negative or gram-positive bacterial natural infection in vivo. We inoculated the FLAG-PGRP-LC transheterozygous adults on low-salt LB plates with or without Salmonella or Staphylococcus under natural infection conditions. We found that FLAG-PGRP-LC was markedly downregulated in response to Salmonella infection but not to Staphylococcus infection by Western blot analysis (Fig. 2C ). Interestingly, some FLAG-PGRP-LC cleavage intermediates were also detected during Salmonella natural infection in vivo (red arrow in Fig. 2E, F ). A significant reduction in fat body membrane PGRP-LC-GFP signal was observed when the transgenic animals were placed on a lawn of E. coli for 24 h by live imaging analysis (Fig. 2D1-4 , Supplemental Movies 3 and 4). These results suggest that PGRP-LC expression may be modulated by live Salmonella/E. coli infection in vivo.

Loss of receptor integrity of PGRP-LC on septic injury in vivo
To determine whether PGRP-LC integrity was modulated by tissue damage in vivo, septic injury was used to inject the PGRP-LC transheterozygous animals with sterile PBS or Salmonella as described by Lemaitre et al. (59) . A significant reduction in the extracellular GFP signal on PGRP-LC-GFP was observed 2–6 h postmicroinjection of live Salmonella (Fig. 3 A, C). A time-lapse series of the infection-mediated reduction of membrane PGRP-LC-GFP signal is shown in Fig. 3L . In agreement with the results above showing that the IMD pathway can be activated simply by sterile PBS injection, septic injury in the absence of bacterial infection was also sufficient to induce partial FLAG-PGRP-LC cleavage (Fig. 3K ). Importantly, PGRP-LC down-regulation was much more rapid and pronounced on Salmonella coinjection, suggesting that live Salmonella infection further augments PGRP-LC down-regulation induced by septic injury (Fig. 3K ).

To track the injected bacterial movement and location in vivo, we used the Alexa Fluor 594-conjugated E. coli to examine whether microinjection of RED-tagged dead E. coli would trigger cleavage of the extracellular GFP tag on PGRP-LC. Some of the injected RED E. coli bacteria were found to adhere on the surface of the fat bodies and a moderate reduction of PGRP-LC-GFP signal was observed 6 h postinjection, suggesting that the presence of PAMPs, even those on dead E. coli, may be sufficient to engage microbes and host immune cells. Septic injury induces partial PGRP-LC down-regulation due to tissue damage, but a live infection may be required for extensive receptor down-regulation (Fig. 3D-G and inset). These observations made in PGRP-LC transgenic animals in vivo are consistent with the observation made in Drosophila S2 cells stably expressing PGRP-LC (unpublished results). Indeed, both infection methods clearly show that the receptor PGRP-LC is down-regulated in response to live Salmonella/E. coli infection. While dead bacteria can be recognized by host immune cells, they do not significantly reduce PGRP-LC expression in the absence of live infection. These results are consistent with the idea that live infection or tissue damage may trigger the release of yet-to-be-identified proteases that modulate PGRP-LC to signal the onset of infection or tissue injury.

The receptor PGRP-LC is readily accessible for serine protease-mediated cleavage
Since PGRP-LCa/x/y recognizes a diverse array of gram-negative bacteria in Drosophila, we reasoned that a localized secretion of a small amount of infection-induced proteases might be sufficient to trigger the cleavage/down-regulation of PGRP-LC that would subsequently alert host cells and activate IMD pathway in response to pathogen infection. To test this concept, we examined whether a serine protease can directly cleave the extracellular GFP-tagged PGRP-LC in vivo. We chose elastase, an exogenous serine protease rapidly released by mammalian neutrophils as a first line of host defense in response to infection and tissue injury. We showed that elastase-induced activation of the IMD pathway was dependent on PGRP-LC expression and the receptor PGRP-LC is a direct substrate of elastase in vitro and in S2 cells (unpublished results). Thus, elastase was used as a model serine protease in this study.

A small amount of exogenous elastase was injected into PGRP-LC-GFP larvae, and the intense fat body GFP signal rapidly disappeared within 2–6 min, suggesting that PGRP-LC is readily accessible to elastase-mediated cleavage in vivo (Fig. 3H-J ). Although elastase is not an infection-induced protease, we reasoned that elastase may be able to mimic some aspects of the yet-to-be-identified endogenous proteases likely emanating from pathogen-host antagonism in Drosophila. Combined with the observations described above, these results show that the receptor PGRP-LC is down-regulated in response to pathogen infection and tissue damage in vivo, and furthermore, the membrane PGRP-LC can be cleaved by a model serine protease.

Protease-deficient E. coli do not activate IMD pathway in vivo
Because PGRP-LC can be modulated by infection-dependent proteolysis in response to pathogen invasion, we then examined whether protease-deficient bacteria were defective in inducing IMD activation in vivo. We chose E. coli strain BL21(DE3) for this study because its outer membrane serine protease OmpT is mutated. OmpT, a known surface serine protease, is responsible for conferring resistance to AMPs and is physiologically relevant for the virulence of Yersinia pestis and clinical E. coli isolates (62 63 64 65 66 67 68) . To avoid tissue damage, we used the natural infection method to examine whether live BL21(DE3) infection is sufficient to induce IMD activation. We found that the IMD pathway was not activated in the OR flies placed on the confluent BL21(DE3) and/or dead bacterial lawn (Fig. 1A ). Thus, the results indicated that live E. coli infection induced potent IMD activation, while either dead or protease-deficient E. coli did not (Fig. 1A, C ), suggesting that live infection may be required for IMD activation under natural infection conditions. It is conceivable that the bacterial surface serine protease OmpT may have a role in modulating PGRP-LC signaling during live E. coli infection in vivo.

A membrane-spanning and ectodomain-deleted PGRP-LC-I activates IMD pathway in vivo
If a serine protease is released during host-pathogen antagonism, it may cleave the extracellular sensor (PGRP domain) of PGRP-LC during live infection. We examined whether an ectodomain (PGRP)-deleted PGRP-LC is a functional receptor that could activate the IMD pathway independent of infection. The Drosophila PGRP-LC gene has three isoforms (a, x, and y) with identical intracellular and transmembrane domains but diverse extracellular domains (69) . We asked whether the shared common domain of PGRP-LCx/a/y could signal without the extracellular PGRP domains. Interestingly, a cleaved PGRP-LC intermediate of molecular mass corresponding to an ectodomain-truncated receptor was also detected on Western blot following infection and physical wounding in vivo (Fig. 2E, F ). We hence tested whether the infection/injury-dependent cleavage of ectodomain (PGRP) might be a signal to activate the IMD pathway in response to pathogen infection or tissue injury.

We generated transgenic flies carrying six truncated receptors (PGRP-LC-I -II, -III, -IV, -V, or -VI) based on amino acid sequence homology, receptor topology and the PGRP-LC intermediates detected by Western blot analysis (Fig. 1A , 69–71). The full-length (FL) and truncated PGRP-LC fragments were expressed in the immune cells of transgenic flies in vivo under the control of three different innate immunity drivers, YP1-GAL4, Cg-GAL4, and HML-GAL4. HML-GAL4 directs transcription of UAS-transgene in hemocytes (72) . Membrane-spanning PGRP-LC-I contains the intracellular and transmembrane fragment that is common in all three PGRP-LC isoforms, and soluble PGRP-LC-II contains the common intracellular fragment that interacts with IMD (Fig. 2A ). Using these transgenic fly lines, we then analyzed whether expression of an ectodomain-deleted receptor (I and II) was sufficient to induce IMD activation in vivo independent of bacterial infection, and conversely whether expression of an intracellular domain-deleted receptor (III, IV, V, and VI) was sufficient to block the IMD activation in vivo. Indeed, expression of PGRP-LC-I in fat bodies and immune cells induced robust IMD activation in the absence of bacterial infection, as indicated by Diptericin mRNA expression (Fig. 4 A–C). Moreover, the full-length and PGRP-LC-I-mediated induction of Diptericin mRNA expression was overwhelmingly much stronger than that induced by E. coli natural infection in vivo (Fig. 4A-C ). In contrast, expression of the other PGRP-LC fragments (II, III, IV, V, or VI) did not induce any discernible IMD activation, suggesting that overexpression/dimerization of the PGRP-LC intracellular domain alone (PGRP-LC-II) may not be sufficient to activate the IMD pathway in vivo (Fig. 4A, B ). These results demonstrate that expression of the ectodomain-deleted PGRP-LC-I (but not PGRP-LC-II) in fat bodies and hemocytes is sufficient to induce IMD activation independent of bacterial infection. Thus, an ectodomain (PGRP)-deleted transmembrane receptor (PGRP-LC-I), containing only the protein fragment common among all three PGRP-LC isoforms (a, x, and y), appears to be an active receptor.

A membrane-spanning and ectodomain-deleted PGRP-LC activates the melanization cascades in vivo
Under the control of Cg-GAL4, the PGRP-LC-I transgenic animals exhibited spontaneous and massive melanization in larval, pupae, and adult tissues in the absence of bacterial infection (Figs. 2D and 4D) . The melanization phenotype was not observed when the PGRP-LC-FL and PGRP-LC-I were expressed under the control of YP1-GAL4, another fat body-specific driver (21 , 73) . A rather limited melanization was also observed when PGRP-LC-I was expressed under the control of HML-GAL4, suggesting that the melanization phenotypes may be caused by PGRP-LC expression in the lymph gland of the transgenic animals. Animals expressing PGRP-LC-I exhibited a much more severe melanization reaction than those expressing the full-length receptor, confirming that PGRP-LC-I is an active receptor (Fig. 4D ). Expression of PGRP-LC-I under the control of Cg-GAL4 resulted in severe developmental delays (>10–15 days); the severity of the melanization phenotypes was dependent on the transgene expression levels. Because the larvae and pupae with massive melanization did not survive to adults, the adult melanization phenotypes were less severe than the larval melanization phenotypes observed (Fig. 4D ).


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Mammalian pattern recognition receptors do not have the receptor diversity to match the remarkable diversity of the microbial community (46 , 47 , 52 , 74) . Elucidating the molecular mechanisms by which host innate immune receptors differentiate pathogenic vs. nonpathogenic microbes is a fundamentally important problem in modern biology. The universal recognition of common microbial molecular patterns by pattern recognition receptors may not fully explain the discrimination between commensal and pathogenic bacteria in vivo since both commensals and pathogens have the similar PAMPs, yet mammalian immune systems do not normally attack commensals even though their colony numbers are being closely monitored by innate immune surveillance receptors such as TLRs (48 49 50 51) . Moreover, the recognition of microbial patterns (PGN or LPS) alone does not explain how host immune cells are activated in response to inflammation and injury in the absence of pathogen infiltration (45 , 75) . Because bacterial pathogenicity is not necessarily related to production of known exogenous stimuli of innate defense, some mechanisms besides recognition of these agonists may exist (45 , 51 , 53) . TLRs can recognize both exogenous substances and endogenous agonists (44 , 45 , 47) . Although how these exogenous and endogenous immune agonists are generated is unclear, an infection- and inflammation-dependent enzymatic cleavage event may be inferred.

Protease cascades are commonly activated in host-pathogen interaction, inflammation, tissue damage and remodeling, and cell migration and invasion (76 77 78 79) . Protease release is often associated with the presence of pathogenic microbes; for example, the involvement of serine proteases including elastase in mammalian immunological responses is widely implicated (80 81 82 83 84) . However, how the innate immune system responds to the activation of protease cascades and whether mammalian PAMP receptors are processed by infection/inflammation-induced proteases are not well understood. Drosophila offers an excellent genetic system to study how innate immunity receptors/sensors monitor infection and tissue injury. It is well known that serine proteases and proteolysis play pivotal roles in activating the TOLL pathway while the action of proteases has not been documented in the IMD pathway (1 , 9 , 18 , 19 , 85) .

Here, we use an in vivo model to show that live infection modulates the receptor integrity of PGRP-LC. PGRP-LC is down-regulated in response to live Salmonella/E. coli infection as well as tissue damage in vivo while the IMD pathway is not activated by either dead or protease-deficient E. coli during natural infection. An ectodomain (PGRP)-deleted transmembrane receptor, PGRP-LC-I, functions as a constitutively active receptor in the absence of pathogen infection. PGRP-LC may have dual roles in regulating and integrating two host defense systems (AMP production and melanization) to combat gram-negative infection in Drosophila. Our results suggest that natural infection may be a suitable method to examine IMD activation and endogenous PGRP-LC processing since it avoids infection-independent tissue damage, while septic injury may be a good method to directly deliver PAMPs into Drosophila bodies bypassing exoskeletal barriers.

The extracellular PGRP domain of PGRP-LC has been shown to be essential for binding DAP-PGN, a gram-negative PAMP, and subsequently activating the IMD pathway (31 , 33 , 34) . Thus, it is rather unexpected that the PGRP-ectodomain-deleted PGRP-LC-I can function as an active receptor while the ectodomain and transmembrane domain-deleted PGRP-LC-II is nonfunctional. The membrane localization of PGRP-LC appears to be important for IMD activation. It is also possible that the ectodomain might negatively regulate PGRP-LC by suppressing IMD activation in the absence of infection. The presence of distinct ectodomains in PGRP-LCx/a/y may serve to increase the diversity of gram-negative PAMP molecules that can be recognized by this receptor. Cell surface proteolysis and proteinase-activated receptors (PARs) are involved in many important biological processes (77 , 86) . Thus, it is likely that PGRP-LC may function in a similar fashion as Spz, PARs and Notch through a proteolytic cleavage and activation process.

Microbial pattern recognition is one of the most important mechanisms of innate immune activation and the first step where pathogen and host engage each other (74) . An infection-dependent modulation of host innate immunity receptors/sensors may be a second step in pathogen-host antagonism to further differentiate pathogenic vs. nonpathogenic microbes, specifically activate innate immunity receptors, and mount an effective and localized host defense against the invading microorganisms. TOLL activation sets a precedent for an infection-induced proteolysis mechanism of innate immune activation in Drosophila (1) . Using a model similar to the infection-induced Spz cleavage, we propose that PGRP-LC is a sentinel receptor for the IMD pathway that can be activated by PAMP recognition (DAP-PGN binding), as well as infection-induced PGRP-LC proteolysis (Fig. 5 ). The receptor integrity of PGRP-LC thereby constitutes a tissue well-being signal, and its down-regulation may signal the onset of pathogenic infection and tissue damage. After pattern recognition physically engages the pathogens and host cells, the enzymes/proteases released during pathogen-host antagonism, in turn, may cleave exogenous substrates to generate immune agonists (DAP-PGN) that can bind to PGRP-LC to activate the IMD pathway. At the same time, it is conceivable that these infection/inflammation-induced enzymes/proteases may also cleave endogenous substrates, i.e., the membrane receptor PGRP-LC on the fat body, permitting the intracellular domain of PGRP-LC to bind IMD and activate the IMD pathway (Fig. 5) . This new model of proteolysis-dependent PGRP-LC activation does not conflict with the DAP-PGN recognition model (31 , 34) . To the contrary, it complements and expands the microbial pattern recognition model in explaining how innate immune receptors are activated in response to infection, inflammation, and tissue damage.

The infection-dependent proteolysis of PGRP-LC and Spätzle support a simple model for a protease-dependent mechanism of innate immune surveillance and activation functioning supplementary to pattern recognition. The proteases released during infection and septic injury may be an important cue for a host cell to distinguish a pathogenic from a nonpathogenic microorganism. The irreversible proteolytic cleavage of the innate immunity receptors/ligands by proteases may alert host cells and signal the onset of tissue damage and pathogen invasion. In contrast to the vast array of microbial patterns, detecting the smaller pool of enzymes/proteases commonly released during infection and injury helps to explain how a small number of sentinel receptors in Drosophila could be so effective in sending an unambiguous "loss of well-being" signal to the host cells to specifically activate multiple host defense systems in response to infection by a diverse set of pathogenic microbes, while remaining unaffected by nonpathogenic microbes present ubiquitously in the environment. Such a locally activated proteolytic cascade may cleave host innate immune receptors/sensors locally, selectively activate the innate defense pathways, and confine host defense to a specific site of infection/injury in a temporally and spatially controlled manner. The infection-dependent proteolysis of the innate immune receptors/sensors might also provide a regulatory feedback mechanism for the host cells to fine tune their innate immune signaling pathways and mount a proper host defense against the invading pathogens while limiting collateral damage and side effect. Moreover, such an irreversible cleavage of the sentinel receptors would also preclude a microorganism’s ability to evade innate host surveillance through adaptive mutations that avoid detection by innate immune surveillance receptors. In mammals, such a protease-based activation mechanism would account for the attraction of protease-secreting immune cells (neutrophils, macrophages, and NK cells) to sites of inflammation, infection, tissue injury, and cancer metastasis in the early phase of immune response. Our observation that the structural integrity of Drosophila PGRP-LC can be modulated by live infection may thus provide some useful insights into the roles of proteases in TNF-{alpha}, NF-{kappa}B, and PAR signaling in innate immunity, inflammation, wound-healing, and tumorigenesis in mammalian systems.


   ACKNOWLEDGMENTS
 
We dedicate this paper to Dr. Paul Leibson, a beloved immunologist, who passed away on August 6, 2007. We are grateful to Paul Leibson, Jim Maher, Grazia Isaya, Edward Leof, Whyte Owen, and Nick Zagorski for critical reading of the manuscript. We thank Kathryn Anderson, Tony Ip, Lousia Wu, Julien Royet, Mika P. Rämet, Pascal Manfruelli, Stephen Hou, and the Bloomington Drosophila Stock Center for fly stocks and plasmids. We thank Karen R. Lien for assistance with immunohistochemical staining. R.L.S. is supported by the Mayo Clinic Pobanz Family Predoctoral Research Fellowship. J.L.P is supported in part by a National Institutes of Health grant (AI53733). A.H.T. and this work are supported by a startup fund to A.H.T. from the Mayo Foundation and in part by a National Institutes of Health grant (GM69922).

Received for publication December 21, 2006. Accepted for publication September 27, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Lemaitre, B., Hoffmann, J. (2007) The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 25,697-743[CrossRef][Medline]
  2. Royet, J., Reichhart, J. M., Hoffmann, J. A. (2005) Sensing and signaling during infection in Drosophila. Curr. Opin. Immunol. 17,11-17[CrossRef][Medline]
  3. Leclerc, V., Reichhart, J. M. (2004) The immune response of Drosophila melanogaster. Immunol. Rev. 198,59-71[CrossRef][Medline]
  4. Soderhall, K., Cerenius, L. (1998) Role of the prophenoloxidase-activating system in invertebrate immunity. Curr. Opin. Immunol. 10,23-28[CrossRef][Medline]
  5. Lackie, A. M. (1988) Hemocyte behaviour. Adv. Insect Physiol. 21,1-48
  6. Theopold, U., Li, D., Fabbri, M., Scherfer, C., Schmidt, O. (2002) The coagulation of insect hemolymph. Cell. Mol. Life Sci. 59,363-372[CrossRef][Medline]
  7. Brennan, C. A., Anderson, K. V. (2004) Drosophila: the genetics of innate immune recognition and response. Annu. Rev. Immunol. 22,457-483[CrossRef][Medline]
  8. De Gregorio, E., Spellman, P. T., Tzou, P., Rubin, G. M., Lemaitre, B. (2002) The Toll and Imd pathways are the major regulators of the immune response in Drosophila. EMBO J. 21,2568-2579[CrossRef][Medline]
  9. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J. M., Hoffmann, J. A. (1996) The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86,973-983[CrossRef][Medline]
  10. Levashina, E. A., Langley, E., Green, C., Gubb, D., Ashburner, M., Hoffmann, J. A., Reichhart, J. M. (1999) Constitutive activation of toll-mediated antifungal defense in serpin-deficient Drosophila. Science 285,1917-1919[Abstract/Free Full Text]
  11. Michel, T., Reichhart, J. M., Hoffmann, J. A., Royet, J. (2001) Drosophila Toll is activated by gram-positive bacteria through a circulating peptidoglycan recognition protein. Nature 414,756-759[CrossRef][Medline]
  12. Ligoxygakis, P., Pelte, N., Hoffmann, J. A., Reichhart, J. M. (2002) Activation of Drosophila Toll during fungal infection by a blood serine protease. Science 297,114-116[Abstract/Free Full Text]
  13. Gobert, V., Gottar, M., Matskevich, A. A., Rutschmann, S., Royet, J., Belvin, M., Hoffmann, J. A., Ferrandon, D. (2003) Dual activation of the Drosophila toll pathway by two pattern recognition receptors. Science 302,2126-2130[Abstract/Free Full Text]
  14. Wang, L., Weber, A. N., Atilano, M. L., Filipe, S. R., Gay, N. J., Ligoxygakis, P. (2006) Sensing of gram-positive bacteria in Drosophila: GNBP1 is needed to process and present peptidoglycan to PGRP-SA. EMBO J. 25,5005-5014[CrossRef][Medline]
  15. Bischoff, V., Vignal, C., Boneca, I. G., Michel, T., Hoffmann, J. A., Royet, J. (2004) Function of the Drosophila pattern-recognition receptor PGRP-SD in the detection of gram-positive bacteria. Nat. Immunol. 5,1175-1180[CrossRef][Medline]
  16. Weber, A. N., Tauszig-Delamasure, S., Hoffmann, J. A., Lelievre, E., Gascan, H., Ray, K. P., Morse, M. A., Imler, J. L., Gay, N. J. (2003) Binding of the Drosophila cytokine Spatzle to Toll is direct and establishes signaling. Nat. Immunol. 4,794-800[CrossRef][Medline]
  17. Hu, X., Yagi, Y., Tanji, T., Zhou, S., Ip, Y. T. (2004) Multimerization and interaction of Toll and Spatzle in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 101,9369-9374[Abstract/Free Full Text]
  18. Jang, I. H., Chosa, N., Kim, S. H., Nam, H. J., Lemaitre, B., Ochiai, M., Kambris, Z., Brun, S., Hashimoto, C., Ashida, M., Brey, P. T., Lee, W. J. (2006) A Spatzle-processing enzyme required for toll signaling activation in Drosophila innate immunity. Dev. Cell 10,45-55[CrossRef][Medline]
  19. Kambris, Z., Brun, S., Jang, I. H., Nam, H. J., Romeo, Y., Takahashi, K., Lee, W. J., Ueda, R., Lemaitre, B. (2006) Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation. Curr. Biol. 16,808-813[CrossRef][Medline]
  20. Gottar, M., Gobert, V., Matskevich, A. A., Reichhart, J. M., Wang, C., Butt, T. M., Belvin, M., Hoffmann, J. A., Ferrandon, D. (2006) Dual detection of fungal infections in Drosophila via recognition of glucans and sensing of virulence factors. Cell 127,1425-1437[CrossRef][Medline]
  21. Georgel, P., Naitza, S., Kappler, C., Ferrandon, D., Zachary, D., Swimmer, C., Kopczynski, C., Duyk, G., Reichhart, J. M., Hoffmann, J. A. (2001) Drosophila immune deficiency (IMD) is a death domain protein that activates antibacterial defense and can promote apoptosis. Dev. Cell 1,503-514[CrossRef][Medline]
  22. Gottar, M., Gobert, V., Michel, T., Belvin, M., Duyk, G., Hoffmann, J. A., Ferrandon, D., Royet, J. (2002) The Drosophila immune response against gram-negative bacteria is mediated by a peptidoglycan recognition protein. Nature 416,640-644[CrossRef][Medline]
  23. Ramet, M., Manfruelli, P., Pearson, A., Mathey-Prevot, B., Ezekowitz, R. A. (2002) Functional genomic analysis of phagocytosis and identification of a Drosophila receptor for E. coli. Nature 416,644-648[CrossRef][Medline]
  24. Choe, K. M., Werner, T., Stoven, S., Hultmark, D., Anderson, K. V. (2002) Requirement for a peptidoglycan recognition protein (PGRP) in relish activation and antibacterial immune responses in Drosophila. Science 296,359-362[Abstract/Free Full Text]
  25. Takehana, A., Katsuyama, T., Yano, T., Oshima, Y., Takada, H., Aigaki, T., Kurata, S. (2002) Overexpression of a pattern-recognition receptor, peptidoglycan-recognition protein-LE, activates imd/relish-mediated antibacterial defense and the prophenoloxidase cascade in Drosophila larvae. Proc. Natl. Acad. Sci. U. S. A. 99,13705-13710[Abstract/Free Full Text]
  26. Werner, T., Liu, G., Kang, D., Ekengren, S., Steiner, H., Hultmark, D. (2000) A family of peptidoglycan recognition proteins in the fruit fly Drosophila melanogaster. Proc. Natl. Acad. Sci. U. S. A. 97,13772-13777[Abstract/Free Full Text]
  27. Steiner, H. (2004) Peptidoglycan recognition proteins: on and off switches for innate immunity. Immunol. Rev. 198,83-96[CrossRef][Medline]
  28. Dziarski, R., Gupta, D. (2006) The peptidoglycan recognition proteins (PGRPs) (Online). Genome Biol. 7,232[CrossRef][Medline]
  29. Chaput, C., Boneca, I. G. (2007) Peptidoglycan detection by mammals and flies. Microbes Infect. 9,637-647[CrossRef][Medline]
  30. Takehana, A., Yano, T., Mita, S., Kotani, A., Oshima, Y., Kurata, S. (2004) Peptidoglycan recognition protein (PGRP)-LE and PGRP-LC act synergistically in Drosophila immunity. EMBO J. 23,4690-4700[CrossRef][Medline]
  31. Kaneko, T., Yano, T., Aggarwal, K., Lim, J. H., Ueda, K., Oshima, Y., Peach, C., Erturk-Hasdemir, D., Goldman, W. E., Oh, B. H., Kurata, S., Silverman, N. (2006) PGRP-LC and PGRP-LE have essential yet distinct functions in the Drosophila immune response to monomeric DAP-type peptidoglycan. Nat. Immunol. 7,715-723[CrossRef][Medline]
  32. Garver, L. S., Wu, J., Wu, L. P. (2006) The peptidoglycan recognition protein PGRP-SC1a is essential for Toll signaling and phagocytosis of Staphylococcus aureus in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 103,660-665[Abstract/Free Full Text]
  33. Leulier, F., Parquet, C., Pili-Floury, S., Ryu, J. H., Caroff, M., Lee, W. J., Mengin-Lecreulx, D., Lemaitre, B. (2003) The Drosophila immune system detects bacteria through specific peptidoglycan recognition. Nat. Immunol. 4,478-484[CrossRef][Medline]
  34. Kaneko, T., Goldman, W. E., Mellroth, P., Steiner, H., Fukase, K., Kusumoto, S., Harley, W., Fox, A., Golenbock, D., Silverman, N. (2004) Monomeric and polymeric gram-negative peptidoglycan but not purified LPS stimulate the Drosophila IMD pathway. Immunity 20,637-649[CrossRef][Medline]
  35. Choe, K. M., Lee, H., Anderson, K. V. (2005) Drosophila peptidoglycan recognition protein LC (PGRP-LC) acts as a signal-transducing innate immune receptor. Proc. Natl. Acad. Sci. U. S. A. 102,1122-1126[Abstract/Free Full Text]
  36. Mellroth, P., Karlsson, J., Hakansson, J., Schultz, N., Goldman, W. E., Steiner, H. (2005) Ligand-induced dimerization of Drosophila peptidoglycan recognition proteins in vitro. Proc. Natl. Acad. Sci. U. S. A. 102,6455-6460[Abstract/Free Full Text]
  37. Ashida, M., Brey, P. T. (1998) Recent advances in research on the insect prophenoloxidase cascade. Brey, P. T. Hultmark, D. eds. Molecular Mechanisms of Immune Response in Insects ,135-172 Chapman and Hall London.
  38. Onfelt Tingvall, T., Roos, E., Engstrom, Y. (2001) The imd gene is required for local Cecropin expression in Drosophila barrier epithelia. EMBO Rep. 2,239-243[CrossRef][Medline]
  39. Bidla, G., Lindgren, M., Theopold, U., Dushay, M. S. (2005) Hemolymph coagulation and phenoloxidase in Drosophila larvae. Dev. Comp. Immunol. 29,669-679[CrossRef][Medline]
  40. Green, C., Levashina, E., McKimmie, C., Dafforn, T., Reichhart, J. M., Gubb, D. (2000) The necrotic gene in Drosophila corresponds to one of a cluster of three serpin transcripts mapping at 43A1.2. Genetics 156,1117-1127[Abstract/Free Full Text]
  41. Ligoxygakis, P., Pelte, N., Ji, C., Leclerc, V., Duvic, B., Belvin, M., Jiang, H., Hoffmann, J. A., Reichhart, J. M. (2002) A serpin mutant links Toll activation to melanization in the host defence of Drosophila. EMBO J. 21,6330-6337[CrossRef][Medline]
  42. De Gregorio, E., Han, S. J., Lee, W. J., Baek, M. J., Osaki, T., Kawabata, S., Lee, B. L., Iwanaga, S., Lemaitre, B., Brey, P. T. (2002) An immune-responsive serpin regulates the melanization cascade in Drosophila. Dev. Cell 3,581-592[CrossRef][Medline]
  43. Hashimoto, C., Kim, D. R., Weiss, L. A., Miller, J. W., Morisato, D. (2003) Spatial regulation of developmental signaling by a serpin. Dev. Cell 5,945-950[CrossRef][Medline]
  44. Beg, A. A. (2002) Endogenous ligands of Toll-like receptors: implications for regulating inflammatory and immune responses. Trends Immunol. 23,509-512[CrossRef][Medline]
  45. Johnson, G. B., Brunn, G. J., Tang, A. H., Platt, J. L. (2003) Evolutionary clues to the functions of the Toll-like family as surveillance receptors. Trends Immunol. 24,19-24[CrossRef][Medline]
  46. Beutler, B. (2004) Inferences, questions and possibilities in Toll-like receptor signalling. Nature 430,257-263[CrossRef][Medline]
  47. Akira, S., Uematsu, S., Takeuchi, O. (2006) Pathogen recognition and innate immunity. Cell 124,783-801[CrossRef][Medline]
  48. Rakoff-Nahoum, S., Paglino, J., Eslami-Varzaneh, F., Edberg, S., Medzhitov, R. (2004) Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell 118,229-241[CrossRef][Medline]
  49. Sansonetti, P. J. (2004) War and peace at mucosal surfaces. Nat. Rev. Immunol. 4,953-964[CrossRef][Medline]
  50. Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. (2005) Host-bacterial mutualism in the human intestine. Science 307,1915-1920[Abstract/Free Full Text]
  51. Sansonetti, P. J. (2006) The innate signaling of dangers and the dangers of innate signaling. Nat. Immunol. 7,1237-1242[CrossRef][Medline]
  52. Medzhitov, R., Janeway, C. A., Jr (2002) Decoding the patterns of self and nonself by the innate immune system. Science 296,298-300[Abstract/Free Full Text]
  53. Matzinger, P. (2002) The danger model: a renewed sense of self. Science 296,301-305[Abstract/Free Full Text]
  54. Spradling, A. C., Rubin, G. M. (1982) Transposition of cloned P elements into Drosophila germ line chromosomes. Science 218,341-347[Abstract/Free Full Text]
  55. Tang, A. H., Tu, C.-P. D. (1995) Pentobarbital-induced changes in Drosophila glutathione S-transferase D21 and mRNA stability: gstD21 mRNA stability. J. Biol. Chem. 270,13819-13825[Abstract/Free Full Text]
  56. Gram, H. C. (1884) Uber die isolierte farbung der schizomyceten in schnitt- und trockenpraparaten. Fortschr. Med. 2,185-189
  57. Dempsey, L. A., Plummer, T. B., Coombes, S. L., Platt, J. L. (2000) Heparanase expression in invasive trophoblasts and acute vascular damage. Glycobiology 10,467-475[Abstract/Free Full Text]
  58. Ryan, K. J., Ray, C. G. (2004) Sherris Medical Microbiology McGraw-Hill New York.
  59. Lemaitre, B., Reichhart, J. M., Hoffmann, J. A. (1997) Drosophila host defense: differential induction of antimicrobial peptide genes after infection by various classes of microorganisms. Proc. Natl. Acad. Sci. U. S. A. 94,14614-14619[Abstract/Free Full Text]
  60. Basset, A., Khush, R. S., Braun, A., Gardan, L., Boccard, F., Hoffmann, J. A., Lemaitre, B. (2000) The phytopathogenic bacteria Erwinia carotovora infects Drosophila and activates an immune response. Proc. Natl. Acad. Sci. U. S. A. 97,3376-3381[Abstract/Free Full Text]
  61. Asha, H., Nagy, I., Kovacs, G., Stetson, D., Ando, I., Dearolf, C. R. (2003) Analysis of Ras-induced overproliferation in Drosophila hemocytes. Genetics 163,203-215[Medline]
  62. Sodeinde, O. A., Subrahmanyam, Y. V., Stark, K., Quan, T., Bao, Y., Goguen, J. D. (1992) A surface protease and the invasive character of plague. Science 258,1004-1007[Abstract/Free Full Text]
  63. Lundrigan, M. D., Webb, R. M. (1992) Prevalence of ompT among Escherichia coli isolates of human origin. FEMS Microbiol. Lett. 76,51-56[Medline]
  64. Stumpe, S., Schmid, R., Stephens, D. L., Georgiou, G., Bakker, E. P. (1998) Identification of OmpT as the protease that hydrolyzes the antimicrobial peptide protamine before it enters growing cells of Escherichia coli. J. Bacteriol. 180,4002-4006[Abstract/Free Full Text]
  65. Guina, T., Yi, E. C., Wang, H., Hackett, M., Miller, S. I. (2000) A PhoP-regulated outer membrane protease of Salmonella enterica serovar typhimurium promotes resistance to alpha-helical antimicrobial peptides. J. Bacteriol. 182,4077-4086[Abstract/Free Full Text]
  66. Ulvatne, H., Haukland, H. H., Samuelsen, O., Kramer, M., Vorland, L. H. (2002) Proteases in Escherichia coli and Staphylococcus aureus confer reduced susceptibility to lactoferricin B. J. Antimicrob. Chemother. 50,461-467[Abstract/Free Full Text]
  67. Kramer, R. A., Brandenburg, K., Vandeputte-Rutten, L., Werkhoven, M., Gros, P., Dekker, N., Egmond, M. R. (2002) Lipopolysaccharide regions involved in the activation of Escherichia coli outer membrane protease OmpT. Eur. J. Biochem. 269,1746-1752[Medline]
  68. McCarter, J. D., Stephens, D., Shoemaker, K., Rosenberg, S., Kirsch, J. F., Georgiou, G. (2004) Substrate specificity of the Escherichia coli outer membrane protease OmpT. J. Bacteriol. 186,5919-5925[Abstract/Free Full Text]
  69. Werner, T., Borge-Renberg, K., Mellroth, P., Steiner, H., Hultmark, D. (2003) Functional diversity of the Drosophila PGRP-LC gene cluster in the response to lipopolysaccharide and peptidoglycan. J. Biol. Chem. 278,26319-26322[Abstract/Free Full Text]
  70. Kim, M. S., Byun, M., Oh, B. H. (2003) Crystal structure of peptidoglycan recognition protein LB from Drosophila melanogaster. Nat. Immunol. 4,787-793[CrossRef][Medline]
  71. Chang, C. I., Ihara, K., Chelliah, Y., Mengin-Lecreulx, D., Wakatsuki, S., Deisenhofer, J. (2005) Structure of the ectodomain of Drosophila peptidoglycan-recognition protein LCa suggests a molecular mechanism for pattern recognition. Proc. Natl. Acad. Sci. U. S. A. 102,10279-10284[Abstract/Free Full Text]
  72. Goto, A., Kadowaki, T., Kitagawa, Y. (2003) Drosophila hemolectin gene is expressed in embryonic and larval hemocytes and its knock down causes bleeding defects. Dev. Biol. 264,582-591[CrossRef][Medline]
  73. Tauszig-Delamasure, S., Bilak, H., Capovilla, M., Hoffmann, J. A., Imler, J. L. (2002) Drosophila MyD88 is required for the response to fungal and Gram-positive bacterial infections. Nat. Immunol. 3,91-97[CrossRef][Medline]
  74. Janeway, C. A., Jr (1992) The immune system evolved to discriminate infectious nonself from noninfectious self. Immunol. Today 13,11-16[CrossRef][Medline]
  75. Tang, A. H., Brunn, G. J., Cascalho, M., Platt, J. L. (2007) Endogenous pathway to SIRS, sepsis and related conditions. J. Leuk. Biol. 82,282-285[Abstract/Free Full Text]
  76. Sternlicht, M. D., Werb, Z. (2001) How matrix metalloproteinases regulate cell behavior. Annu. Rev. Cell Dev. Biol. 17,463-516[CrossRef][Medline]
  77. Ossovskaya, V. S., Bunnett, N. W. (2004) Protease-activated receptors: contribution to physiology and disease. Physiol. Rev. 84,579-621[Abstract/Free Full Text]
  78. Egeblad, M., Werb, Z. (2002) New functions for the matrix metalloproteinases in cancer progression. Nat. Rev. Cancer 2,161-174[Medline]
  79. Krem, M. M., Di Cera, E. (2002) Evolution of enzyme cascades from embryonic development to blood coagulation. Trends Biochem. Sci. 27,67-74[CrossRef][Medline]
  80. Belaaouaj, A., McCarthy, R., Baumann, M., Gao, Z., Ley, T. J., Abraham, S. N., Shapiro, S. D. (1998) Mice lacking neutrophil elastase reveal impaired host defense against gram negative bacterial sepsis. Nat. Med. 4,615-618[CrossRef][Medline]
  81. Volanakis, J. E. (1998) Overview of the complement system. Volanakis, J. E. Frank, M. M. eds. The Human Complement System in Health and Disease ,9-32 Marcel Dekker New York.
  82. Dahlback, B. (2000) Blood coagulation. Lancet 355,1627-1632[CrossRef][Medline]
  83. Tkalcevic, J., Novelli, M., Phylactides, M., Iredale, J. P., Segal, A. W., Roes, J. (2000) Impaired immunity and enhanced resistance to endotoxin in the absence of neutrophil elastase and cathepsin G. Immunity 12,201-210[CrossRef][Medline]
  84. Wipke, B. T., Allen, P. M. (2001) Essential role of neutrophils in the initiation and progression of a murine model of rheumatoid arthritis. J. Immunol. 167,1601-1608[Abstract/Free Full Text]
  85. Chasan, R., Anderson, K. V. (1989) The role of easter, an apparent serine protease, in organizing the dorsal-ventral pattern of the Drosophila embryo. Cell 56,391-400[CrossRef][Medline]
  86. Coughlin, S. R., Camerer, E. (2003) PARticipation in inflammation. J. Clin. Invest. 111,25-27[CrossRef][Medline]



This article has been cited by other articles:


Home page
 DMMHome page
M. S. Dionne and D. S. Schneider
Models of infectious diseases in the fruit fly Drosophila melanogaster
Dis. Model. Mech., July 1, 2008; 1(1): 43 - 49.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schmidt, R. L.
Right arrow Articles by Tang, A. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schmidt, R. L.
Right arrow Articles by Tang, A. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS