FASEB J. Integrated DNA Technologies
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.06-7764com.
(The FASEB Journal. 2008;22:898-909.)
© 2008 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.06-7764comv1
22/3/898    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cho, C. H.
Right arrow Articles by Yarmush, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cho, C. H.
Right arrow Articles by Yarmush, M. L.
(The FASEB Journal. 2008;22:898-909.)
© 2008 FASEB

Homogeneous differentiation of hepatocyte-like cells from embryonic stem cells: applications for the treatment of liver failure

Cheul H. Cho, Natesh Parashurama, Eric Y. H. Park, Kazuhiro Suganuma, Yaakov Nahmias, Jaesung Park, Arno W. Tilles1, François Berthiaume and Martin L. Yarmush1

Center for Engineering in Medicine and Department of Surgery, Massachusetts General Hospital, Harvard Medical School, and the Shriners Hospitals for Children, Boston, Massachusetts, USA

1Correspondence: Center for Engineering in Medicine, Massachusetts General Hospital, Harvard Medical School, Shriners Hospitals for Children, 51 Blossom St., Boston, MA 02114, USA. E-mail: A.W.T, arno_tilles{at}hms.harvard.edu; M.L.Y, ireis{at}sbi.org


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
One of the major hurdles of cellular therapies for the treatment of liver failure is the low availability of functional human hepatocytes. While embryonic stem (ES) cells represent a potential cell source for therapy, current methods for differentiation result in mixed cell populations or low yields of the cells of interest. Here we describe a rapid, direct differentiation method that yields a homogeneous population of endoderm-like cells with 95% purity. Mouse ES cells cultured on top of collagen-sandwiched hepatocytes differentiated and proliferated into a uniform and homogeneous cell population of endoderm-like cells. The endoderm-like cell population was positive for Foxa2, Sox17, and AFP and could be further differentiated into hepatocyte-like cells, demonstrating hepatic morphology, functionality, and gene and protein expression. Incorporating the hepatocyte-like cells into a bioartificial liver device to treat fulminant hepatic failure improved animal survival, thereby underscoring the therapeutic potential of these cells.—Cho, C. H., Parashurama, N., Park, E. Y. H., Suganuma, K., Nahmias, Y., Park, J., Tilles, A. W., Berthiaume, F., Yarmush, M. L. Homogeneous differentiation of hepatocyte-like cells from embryonic stem cells: applications for the treatment of liver failure.


Key Words: coculture • endoderm • animal model • bioartificial liver device


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
THE LIVER IS THE LARGEST INTERNAL organ in the body and accounts for 2% of the weight of an adult. Loss of liver function causes 25,000 deaths a year and is one of the leading causes of death in the United States (1) . The only known treatment for liver failure is orthotopic liver transplantation. Unfortunately, this modality is limited by the shortage of available donor organs (2) . Alternatively potential treatments to liver failure include hepatocyte transplantation (3 , 4) , transplanted tissue engineered liver (5 , 6) , and extracorporeal bioartificial liver (BAL) device (7 , 8) . However, the low availability of functional human hepatocytes severely limits these potential therapies. Therefore, the generation of a hepatic progenitor cell, with the ability to proliferate in vitro while retaining liver-specific function, is a major goal of the field.

Adult liver or hematopoietic cells are one potential source for hepatic progenitor cells. Several groups have discovered potential hepatic progenitors. The liver resident oval cells, small binucleated progenitors, have been shown to restore liver functions in vivo (9) . Human bone marrow-derived stem cells have been shown to differentiate to hepatocytes in vitro (10 , 11) and reverse liver failure in vivo (12) . However, both cell types are present in minute fractions and thus are tedious to isolate and difficult to expand.

Embryonic stem (ES) cells are considered a potential source of cells for hepatic therapies due to their limitless capacity for self-renewal and proliferation, and their ability to differentiate into all major cell lineages (13 14 15) . Several groups have already reported the differentiation of ES cells into hepatocyte-like cells. Chinzei et al. (16) and others have shown that ES cells cultured as embryoid bodies (EBs) differentiate spontaneously into hepatocyte-like cells (16 17 18 19 20) . Efforts to induce a higher rate of differentiation toward the hepatic phenotype have shown limited success. These included various media and matrix combinations (21) , essential growth factors (22) , compounds such as sodium butyrate (23 , 24) , or encapsulation-based systems (25 , 26) . To date, the differentiation of ES cells toward the hepatic phenotype has resulted in mixed cell populations and low yields in the range of 10–50%.

One alternative approach for the differentiation of ES cells along the hepatic lineage is to expose them to cues from the liver. For example, recent studies have shown that stem cells from mesenchymal and hematopoietic origin can be induced to become hepatocyte-like cells following coculture with liver cells (12 , 27) . Imamura et al. (28) have shown that immature ES cells can be driven to differentiate into a hepatic phenotype following transplantation in partially hepatectomized nude mice. More recently, Fair et al. (29) have shown that ES cell engraftment into the liver can correct factor IX deficiency in mice. Taken together, these studies suggest that liver-specific cues may direct differentiation toward a hepatic phenotype both in vivo and in vitro.

Here we describe a rapid differentiation method to obtain a homogeneous endoderm-like cell population with 95% purity. The direct differentiation was achieved by culturing mouse ES cell on top of a collagen sandwich of primary rat hepatocytes. We show that the presence of adult hepatocytes, but not liver endothelial cells or fibroblasts, promotes the differentiation and the proliferation of ES cells into a strikingly uniform population of endoderm-like cells, expressing the major endodermal markers Forkhead box protein A2 (Foxa2, formerly HNF3β), SRY-box containing gene 17 (Sox17), and alpha-fetoprotein (AFP) (30 , 31) . When these ES cell (ESC)-derived endoderm-like cells were replated on a feeder layer of 3T3-J2 fibroblasts, further proliferation and differentiation along the hepatocyte lineage was observed, demonstrating hepatic morphology, functionality, and gene and protein expression. Furthermore, by seeding a bioartificial liver (BAL) device with these ES-derived hepatocyte-like cells we demonstrate an increased survival of rats following D-galactosamine (GalN)-induced fulminant hepatic failure (FHF).


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Cell cultures
Hepatocytes were isolated from adult female Lewis rats (Charles River Laboratories, Boston, MA, USA) weighing 150–200 g, using a modified two-step collagenase perfusion procedure (32) as described previously (33) . Primary rat hepatocytes were sandwiched between two layers of collagen to maintain their stable liver specific functions (34 , 35) . Tissue culture dishes (35 mm) were coated with 0.5 mL of a mixed solution of 9 parts of type I rat tail collagen (1.1 mg/mL in 1 mM HCl) and 1 part 10x DMEM and incubated for 1 h at 37°C to form a collagen gel. After gelation, 1 million hepatocytes (12.5x103 cells/cm2) in 1 mL hepatocyte culture medium were seeded and incubated in 90% air/10% CO2 at 37°C. To achieve uniform densities, the substrates were shaken every 15 min for the first hour after cell seeding. The following day, the culture medium was removed and a second collagen gel layer was overlaid on the hepatocytes and incubated for 1 h at 37°C. After gelation, 1 mL of hepatocyte culture medium was applied. Culture medium was changed daily. Hepatocyte culture medium consisted of DMEM supplemented with 10% fetal bovine serum (Life Technologies, Inc., Gaithersburg, MD, USA), 7 ng/mL glucagon (Bedford Laboratories, Bedford, OH, USA), 7.5 µg/mL hydrocortisone (Pharmacia Corporation, Kalamazoo, MI, USA), 0.5 U/mL insulin (Eli Lilly, Indianapolis, IN, USA), 20 ng/mL epidermal growth factor (Sigma Chemical Co., St. Louis, MO, USA), 200 U/mL penicillin, and 200 µg/mL streptomycin (Life Technologies, Inc.).

The murine ES cell line D3 (ATCC, Manassas, VA, USA) was used to assess the differentiation of ES cells into endodermal and hepatic lineage cells. The murine Oct4-GFP ES cell line R1 (provided by Dr. Andras Nagy, Mount Sinai Hospital, Toronto, ON, Canada) was used to monitor the early differentiation of ES cells. Undifferentiated ES cells were cultured in Knockout DMEM (Life Technologies, Inc.), supplemented with 15% replacement serum, 4 mM L-glutamine (Cambrex, Walkersville, MD, USA), 100 U/mL penicillin (Life Technologies, Inc.), 100 U/mL streptomycin (Life Technologies, Inc.), 10 µg/mL gentamicin (Life Technologies, Inc.), 1000 U/mL Leukemia Inhibitory Factor (LIF; Chemicon International, Temecula, CA, USA), and 0.1 mM 2-mercaptoethanol (Life Technologies, Inc.) on gelatin-coated T75 tissue culture flasks. Culture medium was replaced every day, and cells were passaged at dilutions that ranged from 1:5 to 1:20 at least once a week. Cells from passage numbers 18–25 for ES-D3 and 26–29 for Oct4-GFP ES cells were used in the experiments. Cells were cultured at 37°C and in a 95% air/5% CO2 atmosphere. Unless otherwise noted, ES cells were seeded at a density of 6.25 x 103 cells/cm2 and cultured as monolayers in hepatocyte culture medium, which was changed daily. ES cells were seeded either on top of collagen-sandwiched hepatocytes, liver sinusoidal endothelial cells, or murine embryonic fibroblasts. Controls were established by seeding ES cells on top of a single collagen gel.

Murine 3T3-J2 fibroblasts (purchased from Howard Green, Harvard Medical School, Boston, MA, USA) and embryonic fibroblasts (ATCC) were maintained in T175 tissue culture flasks in DMEM (Life Technologies, Inc.) plus 10% FBS and 2% penicillin and streptomycin. For coculture with ESC-derived endodermal cells, 3T3-J2 fibroblasts were growth-arrested by a 12 µg/mL mitomycin-C treatment (Sigma) for 2.5 h prior to seeding. Liver sinusoidal endothelial cells were isolated from other nonparenchymal cells using a two-step Percoll gradient separation, following the procedure of Zhang et al. (36) . The cells were cultured in hepatocyte culture medium containing 10 ng/mL VEGF (R & D Systems, Minneapolis, MN, USA).

Isolation and culture of ESC-derived cells
To separate the ESC-derived cells from the hepatocytes in coculture, the cells were treated on day 10 with 1 mg/mL dispase (Life Technologies, Inc.) for 60 min at 37°C. After the dispase treatment, the ESC-derived cells could be detached by gentle pipetting without disturbing the collagen gel. The collagen-sandwiched hepatocytes remained at the bottom of the dish, thus allowing separation of the ESC-derived cells from the primary hepatocytes. The ESC-derived cells were then treated with trypsin to achieve single-cell suspension. The purified ESC-derived cells were either analyzed for gene and protein expression or were replated in 35-mm culture dishes at a density of 50,000 cells per dish (6.25x103 ES cells/cm2). For further differentiation, isolated ESC-derived cells were plated either on collagen gels or growth-arrested 3T3-J2 fibroblast feeder layers and were cultured in hepatocyte culture medium supplemented with 100 ng/mL oncostatin-M (Sigma), 10–7 M dexamethasone (Sigma) and insulin/transferrin/selenious acid (5 µg/mL, 5 µg/mL, 5 ng/mL, respectively) (BD Biosciences, San Jose, CA, USA). To rule out the possibility of cell fusion occurring during the coculture process, we performed a simple genotype analysis of the cocultured ES cells on day 10. Since the rat hepatocytes were of female origin and the ES cells were male, we used a polymerase chain reaction (PCR)-based gender identification approach published previously (37 , 38) to analyze the DNA of the cocultured population. This technique uses primers for conserved zinc finger regions of the X and Y chromosomes of the DNA of interest. We reasoned that if appreciable cell fusion had occurred, the XY chromosome analysis of cocultured ES cells would appear similar to the male XY genotype for undifferentiated mouse ES cells rather than the XX profile for female rat hepatocytes.

Experimental animals
Male Sprague-Dawley rats (Charles River Laboratories, Boston, MA, USA), weighing 250–350 g, were used for this study. All animals were acclimated to the animal research laboratory for 5 days prior to experiments and were maintained in a light-controlled room (12-h light-dark cycle) at an ambient temperature of 25°C with chow diet and water ad libitum. These rats were maintained in accordance with National Research Council guidelines, and the experimental protocols were approved by the Subcommittee on Animal Care, Committee on Research, MA General Hospital.

Surgical procedures and induction of FHF
Surgical procedures and induction of FHF are described in detail elsewhere (39) . Briefly, male Sprague-Dawley rats (250–350 g) were anesthetized with an i.p. injection of ketamine (Abbott Laboratories, N. Chicago, IL, USA) and xylazine (Phoenix Pharmaceuticals, St. Joseph, MO, USA) at 110 and 0.4 mg/kg, respectively. The carotid artery and jugular vein were cannulated with 40 cm lengths of PE 50 polyethylene tubing (Becton Dickinson, Sparks, MD, USA) through a dorsal incision. The wound was sutured. The animal was transferred into a cage and was fasted until the first D-galactosamine (GalN; Sigma) injection. To prevent blood clotting, heparinized (20 U/mL) saline solution was continuously infused at a rate of 0.2 mL/h through the arterial line by a syringe infusion pump (Fisher Scientific, Pittsburgh, PA, USA) until the extracorporeal perfusion experiments were initiated. GalN was freshly dissolved in 0.5 mL of physiological saline and adjusted to pH 6.8 with 1 N NaOH. The first dose of GalN (1.2 g/kg i.p.) was administered 24 h after cannulation, and a second dose was given 12 h later. After the first injection, the rats had free access to food and water until sacrifice.

BAL device and cell seeding
The flat-plate BAL device consisted of two plates fabricated of polycarbonate as described previously (39) . The glass surface comprising the lower plate of the BAL was coated with 0.2 mg/mL rat tail collagen and incubated at 37°C for 1 h. ESC-derived hepatocyte-like cells (d25-d28) or fibroblasts (3T3-J2) were seeded onto the glass surface at an average density of 20 million cells per seeding. A second seeding of the hepatocyte-like cells was performed after a 1-h incubation period. The cultures were maintained in hepatocyte culture medium supplemented with oncostatin-M, dexamethasone, and insulin/transferrin/selenious acid as noted above for 2 days. On day 3 after seeding, the medium was aspirated from the lower plate and the BAL was assembled. The BAL device and perfusion circuit were primed with 6 mL of sterile, heparinized Sprague-Dawley rat plasma (Rockland, Gilbertsville, PA, USA).

Extracorporeal perfusion system
Arterial blood was pumped at 0.55–0.85 mL/min through #13 Masterflex silicone tubing (Cole-Parmer, Vernon Hills, IL, USA) using a digital peristaltic pump (Cole-Parmer). A plasma separator (mixed cellulose esters MicroKros, 0.2 µm pore size, 16 cm2 surface area; Spectrum Labs, Laguna Hills, CA, USA) was placed after the pump as an interface between the animal blood line and the BAL device line. Separated plasma was pumped through the BAL by means of two peristaltic pumps set at a flow rate of 0.1 mL/min. Separated plasma and blood were reunited before entering a bubble trap, and the reconstituted blood returned to the animal through the venous cannula. During perfusion, heparin (41.5 U/mL) with 5% dextrose solution was administered continuously through the venous line at a rate of 0.2 mL/h via a syringe infusion pump. The dead volume of the entire perfusion system was 12 mL, of which 6 mL was accounted for by the BAL device. Oxygenated gas (21% O2, 5% CO2, 74% N2) flow was established through a chamber above the internal gas permeable membrane of the BAL device.

Biochemical analysis of liver damage
Blood metabolites were measured using the Piccolo-Portable Blood Analyzer (Abaxis, Union City, CA, USA). A blood sample of 100 µl volume was collected from the BAL perfusate following the 10 h extracorporeal treatment and used to measure liver enzymes in the Piccolo cartridge.

Immunofluorescence analysis
For immunostaining, cultures were washed twice with phosphate-buffered saline (PBS), fixed in 4% paraformaldehyde in PBS at room temperature for 30 min. The fixed sample was then washed twice in PBS, permeabilized using 0.2% Triton X-100 in PBS for 10 min at room temperature. The permeabilized cells were then incubated in blocking buffer (PBS/3% BSA/5% donkey serum) for 60 min at room temperature to block nonspecific antibody binding. Following incubation, the cells were stained for 2 h at room temperature with the following primary antibodies: rabbit anti-Foxa2 (R&D Systems, Minneapolis, MN, USA), goat anti-AFP (Santa Cruz Biotechnology, Santa Cruz, CA, USA), rabbit or goat antialbumin (ICN Pharmaceuticals, Aurora, OH, USA), mouse anti-CK-18 (Sigma), or isotype-matched antibodies as controls (Santa Cruz Biotechnology). After washing twice in blocking solution, the cells were incubated with the following secondary antibodies: FITC or Cy3-conjugated rabbit IgG, goat IgG, or mouse IgG (ICN Pharmaceuticals), for 60 min at room temperature. For bromodeoxyuridine (BrdU) staining, the cells were incubated with 10 µM BrdU (Sigma) in the culture medium for 24 h at 37°C and fixed in 70% ethanol for 45 min at room temperature, then treated with 4N HCl for 20 min at room temperature to denature DNA. After incubation in blocking buffer for 30 min, the cells were stained for 60 min at 37°C with anti-BrdU-Alex594 (Invitrogen, Carlsbad, CA, USA). In some cases, cells were counterstained with 4,6-diamidino-2-phenylindole (DAPI; Invitrogen) for nuclear staining. Cells were visualized by fluorescence microscopy (Zeiss, Thornwood, NY, USA).

FACS analysis
Cocultured ES-D3 cells were isolated with dispase and trypsin treatment on day 10. Collected cell suspensions were fixed, permeabilized, and stained with antibodies as described above. The primary and secondary antibody concentrations used were the following: rabbit anti-Foxa2, 1:1000 (R&D Systems), goat anti-AFP, 1:1000 (Santa Cruz), donkey anti-rabbit IgG-FITC, 1:1000 (ICN Pharmaceuticals), and donkey anti-goat IgG-FITC, 1:1000 (ICN Pharmaceuticals). Cell suspensions were analyzed by flow cytometry (Becton Dickinson). For each analysis, 10,000 events were recorded. FACScan data were analyzed using CellQuest software (Becton Dickinson). For flow cytometric analysis of Oct4-GFP ES-R1 cells, cultured ES cells were isolated with dispase and trypsin treatment on day 5 of differentiation. Collected cell suspensions were analyzed by flow cytometry for Oct4-GFP expression. Undifferentiated Oct4-GFP ES-R1 cells were used as a positive control.

Functional analysis
The culture medium samples were collected and stored at –20°C for analysis for urea content. Urea content was determined with diacetylmonoxime with a commercially available kit (StanBio Laboratory, Boerne, TX, USA). The absorbance was measured with a Thermomax microplate reader (Molecular Devices, Sunnyvale, CA, USA).

Quantitative image analysis
To quantify the growth of differentiating ES cells, the surface area of cultured ES cells was measured and quantified by Sigmascan Pro image software. Measured surface areas were normalized to the control condition. Three to four random fields of image per sample were acquired and quantified by image analysis. Two independent experiments in duplicate were performed, and the data were represented as an average with the SD.

RNA isolation and RT-PCR analysis
RNA isolation was performed using the Nucleospin RNAII protocol (Clontech, Mountain View, CA, USA). Following the removal of genomic DNA with DNase, the column was washed and RNA was eluted with distilled water. The RNA purity was quantified using the absorbance ratio at 260 nm (nucleic acids) and 280 nm (protein) and was greater than 1.9. One-Step RT-PCR kit (Qiagen, Valencia, CA, USA) was used to analyze gene expression. Reactions were initiated using 10 ng RNA and 0.6 µM primer. RT reaction was conducted at 50°C and 95°C for 15 min. Three-step cycling was performed: denaturation at 94°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 1 min, with a final extension time of 10 min at 72°C. The number of cycles varied between 30 and 35. Following PCR, samples were run on a 2% agarose gel, stained with ethidium bromide, and imaged using the Fluor-X Multiimager (Bio-Rad, Hercules, CA, USA). Mouse liver total RNA (Ambion, Austin, TX, USA) was used as a control for hepatocyte gene expression.

PCR amplification of markers was performed using the following oligonucleotide primers:

Foxa2 (HNF3β) (5' ACACGCCAAACCTCCCTAC 3': 5' GGCACCTTGAGAAAGCA 3'), AFP (5' AACTCTGGCGATGGGTGTT 3': 5' AAACTGGAAGGGTGGGACA 3'), Sox 17 (5' ATCCAACCAGCCCACTGA 3': 5' TCGGCAACCGTCAAATG 3'), Albumin (5' CCCTGTTGCTGAGACTTGC 3': 5' TGAGGTGCTTTCTGGGTGT 3'), GATA1 (5' CACCATCAGGTTCCACAGG 3': 5' TTGAGGCAGGGTAGAGTGC 3'), Runx2 (5' TTCCAGACCAGCCAGCACT 3': 5' GCCGCCAAACAGACTCAT 3'), Foxf1 (5' CGTGTGTGATGTGAGGTGAG 3': 5' CTCCGTGGCTGGTTTCA 3'), NKx2.5 (5' CGTCCAACCCACACAAAC 3': 5' TTGTCTTCCGCTGTGTCC 3'), Tal1 (5' TTGATCCATCCAGCTTGC 3': 5' CACAGCCCAACAAAGCAT 3'), Pax 6 (5' TGCCCTTCCATCTTTGCT 3': 5' CCATCTTGCGTGGGTTG 3'), AAT (5' AACAATGGGGCTGACCTC 3': 5' CCACAAAGATGGGGCTCT 3'), CK8 (5' AAACCCGAGATGGGAAGC 3': 5' GCCAGAGGATTAGGGCTGA 3'), CK18 (5' CAAGGTGAAGAGCCTGGAAA 3': 5' AAGTCATCGGCGGCAAG 3'), TTR (5' CTTTGCCTCTGGGAAGACC 3': 5' AGGGCTGCGATGGTGTAGT 3'), CYP3A13 (5' TGGGTGAGTGGTTGCTTACA 3': 5' GAGGGAAACTGGTGAGGATG 3'), Brachyury (5' AAGAACGGCAGGATGT 3': 5' GCGAGTCTGGGTGGATGTA 3'), Goosecoid (5' GCACCGCACCATCTTCA 3': 5' GTTCCACTTCTCGGCGTTT 3'), β-actin (5' GAGGGAAATCGTGCGTGA 3': 5'CCAAGAAGGAAGGCTGGAA 3')

Statistical analysis
Data are expressed as the mean ± SD. Statistical significance of quantitative image analysis was determined by a two-tailed Student’s t test (P<0.001). Animal survival data were evaluated using the generalized Wilcoxon’s test and a P value of less than 0.05 was considered statistically significant. Statistical differences of the biochemical analysis were determined by a two-tailed Student’s t test (P<0.05).


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Primary rat hepatocytes cultured in a collagen-sandwich configuration (33 , 35) have been shown to maintain a high level of liver-specific function and to secrete numerous proteins. To determine the ability of collagen-sandwiched rat hepatocytes to induce ES cell differentiation, the cells were seeded on top of the collagen sandwich. The 400-µm-thick collagen layer did not permit direct hepatocyte-ES cell contact, as shown in Fig. 1 (Step 1).


Figure 1
View larger version (32K):
[in this window]
[in a new window]

 
Figure 1. Schematic of experimental procedures for coculturing ES cells with collagen-sandwiched primary adult hepatocytes (Step 1) and replating ESC-derived cells on collagen gel or fibroblast (3T3-J2) feeder layers (Step 2). Controls included ES cells cultured alone on collagen gel. Image shown is primary adult rat hepatocytes cultured in the collagen gel sandwich configuration (day 7).

Adult hepatocytes stimulate ES cell differentiation and proliferation in cocultures
Octamer-4 (Oct-4) is an important marker of pluripotency, expressed by primitive embryonic cells both in vivo and in vitro (40) . Oct-4 is downregulated during early differentiation. To monitor early differentiation in our system, we studied the ES-R1 mouse ES cell line in which green fluorescent protein (GFP) was knocked in to monitor Oct-4 gene expression. To assess the effect of coculture on ES cell differentiation, we monitored Oct-4 gene expression following 5 days of coculture with either rat liver parenchymal cells (adult rat hepatocytes), rat liver sinusoidal endothelial cells (LSEC), or mouse embryonic fibroblasts (MEF). Using flow cytometry analysis, we observed that Oct4-GFP expression of ES cells cultured on top of collagen-sandwiched hepatocytes was decreased significantly compared with the other three culture conditions on day 5 of culture (Fig. 2 A). ES cells cultured on top of collagen-sandwiched embryonic fibroblasts (Fig. 2B ) or liver endothelial cells (data not shown) maintained strong Oct4-GFP expression, forming Oct4-GFP positive aggregates. Similar results were observed in direct cocultures of Oct4-GFP ES cells on feeder layers of fibroblasts, endothelial cells, and hepatocytes in the absence of collagen gel layer (data not shown). These results indicate that primary rat hepatocytes, but not endothelial cells or fibroblasts, stimulate the differentiation of ES cells in collagen culture.


Figure 2
View larger version (19K):
[in this window]
[in a new window]

 
Figure 2. A) FACS analysis of Oct4-GFP expression in ES-R1 cells in various conditions on day 5 of culture. ES cells were cocultured on top of collagen-sandwiched hepatocytes, mouse embryonic fibroblasts (MEF), or liver sinusoidal endothelial cells (LSEC). As a control, ES cells were cultured on collagen gels with no hepatocytes. Results shown are representative of two independent experiments in duplicate. B) Expression of Oct-4-GFP fluorescence (top panel) and phase-contrast images (bottom panel) in ES cell-hepatocyte and ES-cell-fibroblast (MEF) cocultures on day 5 of culture. Scale bar = 100 µm. C) Dose-response of hepatocytes on the proliferation of isolated ES-D3 cells on day 6 of culture. ES cells were cultured on collagen gel with no hepatocytes (control) or cocultured on top of collagen-sandwiched hepatocytes at low (12.5x103 hepatocytes/cm2), medium (62.5x103 hepatocytes/cm2), and high (125x103 hepatocytes/cm2) seeding densities. Relative cell growth of cultured ES-D3 cells was quantified by image analysis. Data shown are means ± SD of two independent experiments in duplicate. *P < 0.001. Similar results were reproduced in more than ten independent experiments for control and coculture with high hepatocyte density.

One possible route by which coculture can induce ES cell differentiation is by altering the growth kinetics of the ES cells. When cocultured with hepatocytes the ES cells underwent rapid proliferation without forming Oct4-GFP positive aggregates (Fig. 2B ). One possibility is that a hepatocyte-secreted soluble factor is responsible for the increased proliferation. To evaluate the effect of hepatocytes on the proliferation of ES cells (ES-D3), we seeded a constant number of ES cells (6.25x103 cells/cm2) on collagen-sandwiched hepatocytes seeded at low (12.5x103), medium (62.5x103), and high (125x103 hepatocytes/cm2) seeding densities. A hepatocyte "dose-dependent" increase in the area covered by ESC-derived cells was observed on day 6 of culture (Fig. 2C ). We verified that the area per individual ESC-derived cell was constant (165±28 µm2 in area), confirming that the increasing coverage correlates directly with an increase in cell number. Similar to the Oct4-GFP ES cells (derived from ES-R1 cells), ES-D3 cells cultured on top of collagen-sandwiched hepatocytes showed a significantly higher proliferation rate when cultured with hepatocytes at medium and high densities compared to those in single culture (P<0.00001). No significant differences were observed between ES cells in single culture and ES cells cocultured with hepatocytes at low density (P=0.519). The data show that ES cell proliferation increased as a function of hepatocyte density. These results indicate that primary rat hepatocytes stimulate the proliferation of ES cells in collagen culture.

ES cells cocultured with adult hepatocytes differentiate into a homogeneous population of endoderm-like cells
To study the differentiation of ES cells in our coculture system we analyzed gene and protein expression on days 6 and 10 of coculture. Figure 3 A shows the morphology of differentiating ES cells on culture day 6 when cultured alone (control) or when cocultured with hepatocytes. Using RT-PCR we observed that the ES cells cocultured with hepatocytes clearly expressed higher levels of the endoderm markers Foxa2, Sox 17, and AFP on day 6 than the ES cells in single culture (Fig. 3B ). The mesendodermal markers Brachyury and Goosecoid (41 , 42) were upregulated on day 4 of differentiation and downregulated rapidly on days 6 and 10, indicating a transient mesendodermal population (Fig. 3C ). Figure 3D shows a phase contrast image of the proliferating ESC-derived cells in day 10 of coculture with adult hepatocytes. The image shows a uniform and homogeneous population of ESC-derived cuboidal cells with bright cell-cell borders, reminiscent of isolated endodermal cells (42 , 43) . The ESC-derived cells were labeled with BrdU, a DNA synthesis marker, demonstrating that the cells retain their ability to proliferate (Fig. 3E ).


Figure 3
View larger version (48K):
[in this window]
[in a new window]

 
Figure 3. A–C) Morphology (A) and RT-PCR gene expression (B, C) of differentiating ES cells cultured in control (ES cell only) and coculture (125x103 hepatocytes/cm2). D, E) Phase-contrast micrograph (D) and in situ analysis (E) for BrdU (DNA synthesis marker) of differentiating ES cells in coculture on day 10. Scale bars = 100 µm.

Further characterization of the ESC-derived cells on day 10 by immunostaining demonstrated high level of Foxa2 and AFP protein expression (Fig. 4 A). In addition, flow cytometry analysis of the ESC-derived population demonstrated that 94.2 ± 0.3% of the cells were Foxa2-positive, and 95.9 ± 0.8% of the cells were AFP-positive, demonstrating the formation of a homogenous endoderm-like population (Fig. 4B ). Since ectoderm, endoderm, and mesoderm may all be present in early ES cell differentiation schemes, we determined whether key markers for these cell types were expressed in our culture conditions. We chose a combination of early transient markers and markers for ectoderm, endoderm, and mesoderm. Using RT-PCR, we examined the expression of the liver transcription factors Foxa2 (HNF-3β, required for endoderm specification; 44 , 45 ) and Sox 17 (an endoderm marker), alpha-fetoprotein (AFP, an endoderm and early hepatocyte marker), albumin (a hepatocyte marker), GATA1 (hematopoietic cells), Runx2 (mesenchymal cells), Foxf1 (mesenchymal cells), Nkx2.5 (cardiac cells), Tal1 (endothelial cells), and Pax6 (an ectoderm marker) of the ES cells cultured on top of collagen-sandwiched adult hepatocytes for 6 and 10 days. We found that the differentiating ES cells cultured on top of collagen-sandwiched adult hepatocytes expressed Foxa2, Sox17, and AFP on days 6 and 10, but not albumin, suggesting that the cells differentiated into early endodermal cells (Fig. 4C ). The mesodermal and ectodermal markers were not expressed on culture days 6 and 10, suggesting that the cells in this culture condition were endoderm-derived.


Figure 4
View larger version (95K):
[in this window]
[in a new window]

 
Figure 4. Characterization of differentiating ES-D3 cells cultured on top of collagen-sandwiched adult hepatocytes. A) Expression of Foxa2 (HNF-3β; endoderm and hepatocyte marker) and alpha-fetoprotein (AFP; endoderm and early hepatocyte marker) by ESC-derived cells after dispase isolation on day 10 and replating into tissue culture dishes. Scale bars = 100 µm (panels); 20 µm (insets). B) FACS analysis of isolated ESC-derived cells on day 10. C) RT-PCR gene expression of isolated ESC-derived cells on days 6 and 10.

To rule out the possibility of cell fusion between the differentiating mouse ES cells and the female rat hepatocytes, we performed a simple genotype analysis using gender determination of the cells. Our analysis demonstrated that the undifferentiated ES cells (day 0) and the cocultured ES cells after 10 days of differentiation had double bands (XY genotype) with identical magnitude indicating that they were from male animals (data not shown). Rat hepatocytes used for ES cell coculture displayed a single band indicating that the animal was female. These results show that the differentiating ES cells in coculture were not fusing with rat hepatocytes.

ESC-derived endoderm-like cells can differentiate into hepatic lineage cells
During development, endoderm-derived hepatic precursors associate with mesenchymal cells of the septum transversum before fully maturing into functional hepatocytes. Therefore, in order to differentiate the ESC-derived endoderm-like cells, we reseeded the cells on top of growth arrested fibroblast (3T3-J2) feeder layers at a density of 6.25 x 103 ES cells/cm2 (Fig. 1 , Step 2). Figure 5 A shows a series of phase contrast images of the proliferating and differentiating ESC-derived endoderm-like cells. Following 28 days in culture, the cells formed epithelial-type clusters and appear as a uniform population with morphology that is very similar to that of adult hepatocytes. Some binucleated cells were observed in the colony clusters at late stage of culture (see inset). Although similar morphology was seen when the cells were cultured alone on collagen gel, cellular proliferation was significantly retarded (data not shown). To further characterize the phenotype of these ESC-derived hepatocyte-like cells, we studied gene and protein expression using immunofluorescence and RT-PCR. The ESC-derived hepatocyte-like cells were positive for the mature hepatic markers, albumin and CK-18, on the protein level (day 28) (Fig. 5B ). Hepatocyte gene expression of the ESC-derived hepatocyte-like cells was upregulated on days 18 and 28 (Fig. 5C ). The ESC-derived hepatocyte-like cells were positive for hepatocyte markers, including albumin, alpha-1-antitrypsin (AAT), CK-8, CK-18, transthyretin (TTR), and cytochrome P450 3A13 (CYP3A13). Foxa2 was weakly expressed on days 18 and 28, similar to gene expression of mature hepatocytes. However, AFP, an endodermal and early hepatic marker, was upregulated on day 28, suggesting that some of the cells may still be in early stages of hepatic lineage. In addition, the high level of AFP expression on day 28 might be due to the proliferation of hepatic progenitors. No expression of mesodermal or ectodermal markers was detected in any of these cultures (Fig. 5D ). We also investigated urea synthetic ability of differentiating ESC-derived cells to assess hepatocyte-specific function. The activity of urea synthesis on day 18 was 6.1 µg/48 h/35 mm dish. The level of urea production increased to 17.9 µg/48 h/35 mm dish in late stage of culture (day 28) (Fig. 5D ). These results indicate that the ESC-derived endoderm-like cell population could be further differentiated to hepatocyte-like cells.


Figure 5
View larger version (58K):
[in this window]
[in a new window]

 
Figure 5. Morphology, marker distribution, and gene expression of ESC-derived cells replated onto growth-arrested 3T3-J2 fibroblasts feeder layers. Cocultured ES-D3 cells on top of collagen-sandwiched hepatocytes were isolated by dispase and trypsin treatment on day 10, replated in 35 mm culture dishes at a density of 50,000 cells per dish (6.25x103 ES cells/cm2) onto growth-arrested 3T3-J2 fibroblast feeder layers, and cultured for up to 20 days (days 10–30 of culture). A) Morphology of ESC-derived cells on day 18 after initiation of ES cell culture (i.e., day 8 after replating on fibroblast feeder layer), day 26, and day 30. Primary adult rat hepatocytes cultured in the collagen gel sandwich configuration 7 days after seeding, shown for comparison (bottom right panel). Scale bar = 100 µm (panels); 50 µm (inset). B) Albumin and CK-18 immunofluorescence staining on day 28. Scale bar = 100 µm. C, D) RT-PCR analysis of hepatocyte gene expression (C) and mesodermal and ectodermal gene expressions (D) on days 18 and 28. Mouse liver RNA was used as a control. E) Urea synthesis on days 12, 18, and 28. Data shown are means ± SD (n=3).

Biochemical analysis and animal survival from liver failure
To evaluate the therapeutic efficacy of the ESC-derived hepatocyte-like cells, we attempted to rescue rats undergoing GalN-induced FHF by incorporating the hepatocyte-like cells in a BAL device and treating for 10 h. We measured changes in liver enzymes [aspartate transaminase (AST), alanine transaminase (ALT)], total bilirubin (TBIL), and blood urea nitrogen (BUN) immediately following the 10 h extracorporeal perfusion. Significant reductions were found in the plasma levels of TBIL and BUN (P=0.025, P=0.009, respectively), and trends were noted for decreased AST and ALT levels (P=0.149, P=0.057, respectively) in the animals treated with the BAL device containing ESC-derived hepatocytes compared to the control group (Fig. 6 A).


Figure 6
View larger version (10K):
[in this window]
[in a new window]

 
Figure 6. A, B) Biochemical analysis (A) and animal survival curve (B) of GalN-induced FHF rats connected to the BAL device for 10 h either with fibroblasts (3T3-J2) as a control or with ESC-derived hepatocyte-like cells. The first dose of GalN (1.2 g/kg i.p.) was administered 24 h after cannulation, and the second dose was given 12 h later. The BAL perfusion started 24 h after the first GalN injection. Total bilirubin (TBIL), blood urea nitrogen (BUN), aspartate transaminase (AST), and alanine transaminase (ALT). *P < 0.05. Animal survival data using BAL device with primary porcine hepatocytes are from our previously published study (39) .

Animal survival was evaluated up to 120 h (5 days) after the first GalN injection (Fig. 6B ). In the animal group treated with the BAL device seeded with the hepatocyte-like cells, 5 out of 6 animals (83.3%) survived at 48 h compared to 3 out of 8 (37.5%) rats that were treated with a BAL device seeded with fibroblasts (control group). On day 5, 3 out of 6 (50.0%) rats survived in the ESC-derived hepatocyte seeded BAL group compared to 1 out of 8 (12.5%) rats in the control group. The differences between the two groups were significant on day 5 (P=0.034) using the generalized Wilcoxon’s test. Animal survival from the ESC-derived cell seeded BAL group was also compared to our previously published results in which rats with GalN-induced FHF receiving treatment with a BAL device containing primary porcine hepatocytes had 58.3% survival on day 5 (39) . Similar results in animal survival were observed in both groups through day 5.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The results of our studies indicate that the culture of mouse ES cell on top of collagen-sandwiched primary rat hepatocytes stimulates their differentiation and proliferation into a homogeneous population of endoderm-like cells. The endoderm-like cell population, which emerged within the first week of culture, had cubical cell morphology and bright cell borders and maintained a high level of gene and protein expression for the endoderm specific genes Foxa2, Sox17, and AFP (30 , 31) . This cell population was also negative for major mesoderm and ectoderm markers suggesting our system induced an endoderm-specific differentiation. To our knowledge, this is the first demonstration of ES cell differentiation into endoderm-like cells with a yield approaching 95%. This endoderm-like cell population could be further differentiated to hepatocyte-like cells, by subculturing the cells on a feeder layer of 3T3-J2 fibroblasts. The hepatocyte-like cell population that emerged had a hepatocyte morphology, expressed hepatocyte markers on the gene level, stained positive for albumin and CK-18 filaments, and secreted urea. In addition, these hepatocyte-like cells were shown to be efficacious in treating a rat model of GalN-induced FHF when seeded in an extracorporeal BAL device.

During development, the first sign of liver morphogenesis is a thickening of the ventral endoderm, which occurs around embryonic day 8 in the mouse (46) . Little is known about the signals involved in initial endoderm formation and subsequent endoderm specification, but recent studies suggest a role for FGF, BMP, and activin. FGF, both acidic and basic, produced by the cardiac mesoderm was shown to induce the foregut endoderm to the hepatic lineage (46) , while BMP produced by the transversum mesenchyme was shown to increase levels of GATA4 (47) . Activin was also shown to participate in the early induction of endoderm through smad2 signaling (48) . By embryonic day 8.5 in the mouse, definitive endoderm has formed the gut tube and expresses Foxa2. As liver morphogenesis progresses, Foxa2 positive cells proliferate to form the hepatic diverticulum while expressing AFP. Final maturation of these hepatic progenitors occurs when hepatic cords associate with the mesenchymal cells of the septum transversum, forming the liver sinusoids while expressing albumin and urea (46) .

A similar path of differentiation occurs during culture of embryoid bodies (EB), which is the most common method of ES cell differentiation (22) . Normally the early cell populations that arise during initial ES cell differentiation consist of neuroectoderm, mesoderm, definitive endoderm, and extraembryonic endoderm. The bipotent mesendoderm may also be present (41 , 42) . Although this mixed cell population does give rise to hepatocyte-like cells, usually in close proximity to cardiac-like tissue, the low yield makes it essential to purify the cell population to further explore their potential. In an effort to create a homogeneous cell population, several groups have studied endoderm differentiation in monolayer culture thereby exposing the ES cells to uniform cues from their microenvironment. Tada et al. (42) have shown the presence of mesendodermal precursors in these cultures as well as the importance of collagen type IV to induce endoderm with a yield of up to 50%. Both this group and Hisatomi et al. (43) have shown a characteristic epithelial morphology of Foxa2-positive endodermal cells in culture. In addition to in vitro culture of ES cells, several groups have shown that liver cells and regenerating livers can induce hepatocyte-like gene expression in stem cells. Lange et al. (27) and Jang et al. (12) have shown that liver cells can induce hepatic gene expression in cultures of mesenchymal and hematopoietic stem cells. Similarly, Imamura et al. (28) has shown that the regenerative liver can drive ES cell differentiation into a hepatic phenotype.

Several groups have shown the importance of collagen in the differentiation of ES cells toward the hepatic phenotype. However, the differentiation of ES cells on three-dimensional collagen gels has not been previously investigated. The ability of three-dimensional collagen gels to induce and maintain epithelial morphology and function is well established, suggesting a similar enhancement of epithelial differentiation might occur during ES culture. Therefore, to create an environment conducive for hepatic differentiation we cultured ES cells on top of collagen-sandwiched hepatocytes. The uniform microenvironment, three-dimensional collagen gel, and cues from isolated hepatocytes contributed to the formation of a homogeneous cell population, which was 94.2% positive for Foxa2 and 95.9% positive for AFP.

Our group has previously shown that primary hepatocyte trapped between two layers of collagen gel (sandwich) maintain a high level of liver-specific function (33 , 35) . One explanation for the uniform differentiation observed in our coculture is activin secretion. Hepatocytes have been shown to secrete activin and other TGF-β family mitogens (49) , which have been shown in numerous studies to promote endoderm induction (41 , 50) . Our results demonstrate that ES cells cocultured with hepatocytes rapidly lose the Oct-4 gene, which is important for the maintenance of pluripotency. However, coculture with isolated liver endothelial cells has failed to induce ES cell differentiation. This result is in agreement with in vivo studies suggesting that endothelial cells are important for the later stage of differentiation but not for the initial induction. Similarly, embryonic fibroblasts failed to cause a decrease in Oct-4 expression in ES cells. Mouse embryonic fibroblast feeders have been used to support the maintenance of undifferentiated ES cells. Conditioned media from the fibroblasts was also known to support the ES cell growth in undifferentiated state (51) . Similar results were observed in this study.

In addition to differentiation, hepatocytes have also been shown to enhance the proliferation of various cell types (52 53 54) . In a similar fashion, our results demonstrate that hepatocytes stimulate ES cell proliferation in a dose-dependent fashion due to secreted factors. Similar increase in ES cell proliferation was also seen when the cells were separated by transwells, although the proliferation rate was decreased (data not shown). In both cases of differentiation or proliferation in coculture the ES cells were separated by more than 400 µm from the hepatocytes and were never in contact, therefore cell fusion and cell-cell contact could be ruled out. Genetic characterization of cocultured ES cells for gender-specific DNA sequences demonstrated that the differentiating male ES cells were not fusing with female rat hepatocytes.

The endoderm-like population that emerged in our studies had the characteristic epithelial morphology of Foxa2-positive endodermal cells, which was previously demonstrated (42 , 43) . Spindle-like, elongated, or elliptical cells were not observed, and the gene expression data demonstrated endodermal but not mesodermal (Gata-1, Runx2, Foxf1, Nkx2.5, Tal1) or neuroectodermal (Pax6) markers. These findings suggest that the enhanced proliferation and differentiation observed in our system was lineage-restricted to endoderm. The gene expression panel and cellular morphology were similar on day 6 and day 10 of coculture, suggesting that the proliferation was symmetric, and not asymmetric. This, however, needs to be carefully studied using single cell lineage tracing and mapping techniques.

Previous studies by Hamazaki et al. (22) demonstrated the importance of FGF, HGF, oncostatin-M, and cortisone on the differentiation of ES cells into hepatocyte-like cells. These factors are commonly secreted by the cardiac mesoderm and the mesenchymal cells. To induce the late-stage hepatic differentiation we chose to culture the endoderm-like cells on growth-arrested 3T3-J2 fibroblasts. Fibroblasts are known to produce a variety of soluble growth factors and ECM components, including FGF, HGF, and proteoglycans (55 56 57) . We found that this system provided the best survival and proliferation of the hepatocyte-like cells, when compared to cultures of these cells on single gel, double gel, and matrigel (data not shown). The ESC-derived endoderm-like cells continued to proliferate and differentiate into a uniform population of hepatocyte-like cells, which form epithelium-like clusters. Some binucleated cells were observed in the colony clusters. Previous reports have shown that endodermal cells alone fail to differentiate and mature (42 , 58) , suggesting that significant mesenchymal/mesodermal cues are necessary for the maturation of the early endodermal cells (59) . Taken together, these studies suggest that direct cell-cell contact with mesenchymal or mesodermal cells provides a suitable environment for endoderm proliferation and differentiation, consistent with our studies.

We have previously shown that 3T3-J2 fibroblasts promote a high level of hepatic gene expression, protein expression, and function in isolated hepatocytes (60) . Similarly, our results demonstrate a strong activation of the hepatic genes by day 28 of culture, stained positive for albumin and CK-18, and secreted urea. Morphologically the cells appear hepatocyte-like, including many binucleated cells, dense cytoplasm, and bile canaliculi. Optimization of the culture conditions for terminally differentiating the hepatocyte progenitor cells into mature hepatocytes resulted in albumin and urea secretion levels similar to those seen with rat primary hepatocytes (unpublished data). Although urea production and albumin expression are characteristic of hepatocyte activity, kidney tubular epithelium also produces urea (61) , while extraembryonic cells express albumin. To our knowledge only hepatocytes do both, which suggests that the cells attain a hepatic phenotype. Further studies are needed to characterize these cells at a molecular level.

A means of further evaluating the functional capacity of the ESC-derived hepatocyte-like cells is to determine their therapeutic efficacy in treating FHF. Rats with GalN-induced FHF received a 10 h perfusion with a BAL device seeded with the ESC-derived hepatocyte-like cells. Plasma levels of liver enzymes were reduced in the animals treated with the device containing the hepatocyte-like cells compared to the animals treated with the device containing fibroblasts. Animal survival on day 5 was significantly increased compared to the animals receiving treatment with a BAL device seeded with fibroblasts. Comparing these results to those from our prior study using primary porcine hepatocytes in the BAL device to treat FHF in the same rat model revealed similar survival trends. This suggests that the ESC-derived hepatocyte-like cells were providing biochemical support to the animals that was similar to primary hepatocytes, and resulted in increased animal survival. Also, it may be possible to increase the liver-specific functions of the ESC-derived hepatocyte-like cells in the BAL device by coculturing them with nonparenchymal cells, such as fibroblasts or endothelial cells, as seen with primary hepatocytes. Future studies are ongoing to describe the in vivo therapeutic efficacy of the ESC-derived hepatocyte-like cells.

The production of a hepatic progenitor cell population could lead to a variety of new products. In theory, a committed progenitor, such as a hepatic progenitor cell could be generated from the endoderm and used for cell therapies to treat acute or chronic liver failure as well as for further maturation and confinement within a tissue-engineered extracorporeal BAL device. Similarly, new generations of other cellular products and tissue-engineered products could be designed using an ESC-derived endodermal cell. We speculate that a reproducible culture system described in this study could be useful to obtain a unique and homogeneous population of endoderm-like cells that can be further differentiated into hepatic lineages without losing their characteristics. These populations derived from ES cells have the potential to become a reliable source of cells for cell transplantation, toxicology screens, and the development of BAL devices.


   ACKNOWLEDGMENTS
 
We thank Dr. Andras Nagy (Toronto, ON, Canada) for the gift of Oct4-GFP ES-R1 cells and Mara Macdonald for technical assistance. We also thank Ginger Clark (Genetic Analysis Laboratory, Interdisciplinary Center for Biotechnology Research, University of Florida) for DNA analysis. This study was supported by the National Institutes of Health (Grant numbers R01 DK43371, K18 DK076819, and K08 DK066040) and the Shriners Hospitals for Children.

Received for publication November 17, 2006. Accepted for publication August 30, 2007.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Popovic, J. R., Kozak, L. J. (2000) National hospital discharge survey: annual summary, 1998. Vital Health Stat. 13,1-194
  2. Yarmush, M. L., Dunn, J. C., Tompkins, R. G. (1992) Assessment of artificial liver support technology. Cell Transplant. 1,323-341[Medline]
  3. Fox, I. J., Chowdhury, J. R., Kaufman, S. S., Goertzen, T. C., Chowdhury, N. R., Warkentin, P. I., Dorko, K., Sauter, B. V., Strom, S. C. (1998) Treatment of the Crigler-Najjar syndrome type I with hepatocyte transplantation. N. Engl. J. Med. 338,1422-1426[Free Full Text]
  4. Strom, S. C., Fisher, R. A., Thompson, M. T., Sanyal, A. J., Cole, P. E., Ham, J. M., Posner, M. P. (1997) Hepatocyte transplantation as a bridge to orthotopic liver transplantation in terminal liver failure. Transplantation 63,559-569[Medline]
  5. Demetriou, A. A., Levenson, S. M., Novikoff, P. M., Novikoff, A. B., Chowdhury, N. R., Whiting, J., Reisner, A., Chowdhury, J. R. (1986) Survival, organization, and function of microcarrier-attached hepatocytes transplanted in rats. Proc. Natl. Acad. Sci. U. S. A. 83,7475-7479[Abstract/Free Full Text]
  6. Fontaine, M., Schloo, B., Jenkins, R., Uyama, S., Hansen, L., Vacanti, J. P. (1995) Human hepatocyte isolation and transplantation into an athymic rat, using prevascularized cell polymer constructs. J. Pediatr. Surg. 30,56-60[CrossRef][Medline]
  7. Chan, C., Berthiaume, F., Nath, B. D., Tilles, A. W., Toner, M., Yarmush, M. L. (2004) Hepatic tissue engineering for adjunct and temporary liver support: critical technologies. Liver Transpl. 10,1331-1342[CrossRef][Medline]
  8. Demetriou, A. A., Brown, R. S., Jr, Busuttil, R. W., Fair, J., McGuire, B. M., Rosenthal, P., Am Esch, J. S., 2nd, Lerut, J., Nyberg, S. L., Salizzoni, M., Fagan, E. A., de Hemptinne, B., Broelsch, C. E., Muraca, M., Salmeron, J. M., Rabkin, J. M., Metselaar, H. J., Pratt, D., De La Mata, M., McChesney, L. P., Everson, G. T., Lavin, P. T., Stevens, A. C., Pitkin, Z., Solomon, B. A. (2004) Prospective, randomized, multicenter, controlled trial of a bioartificial liver in treating acute liver failure. Ann. Surg. 239,660-667discussion 667–670[CrossRef][Medline]
  9. Wang, X., Foster, M., Al-Dhalimy, M., Lagasse, E., Finegold, M., Grompe, M. (2003) The origin and liver repopulating capacity of murine oval cells. Proc. Natl. Acad. Sci. U. S. A. 100(Suppl 1),11881-11888[Abstract/Free Full Text]
  10. Jiang, Y., Jahagirdar, B. N., Reinhardt, R. L., Schwartz, R. E., Keene, C. D., Ortiz-Gonzalez, X. R., Reyes, M., Lenvik, T., Lund, T., Blackstad, M., Du, J., Aldrich, S., Lisberg, A., Low, W. C., Largaespada, D. A., Verfaillie, C. M. (2002) Pluripotency of mesenchymal stem cells derived from adult marrow. Nature 418,41-49[CrossRef][Medline]
  11. Schwartz, R. E., Reyes, M., Koodie, L., Jiang, Y., Blackstad, M., Lund, T., Lenvik, T., Johnson, S., Hu, W. S., Verfaillie, C. M. (2002) Multipotent adult progenitor cells from bone marrow differentiate into functional hepatocyte-like cells. J. Clin. Invest. 109,1291-1302[CrossRef][Medline]
  12. Jang, Y. Y., Collector, M. I., Baylin, S. B., Diehl, A. M., Sharkis, S. J. (2004) Hematopoietic stem cells convert into liver cells within days without fusion. Nat. Cell Biol. 6,532-539[CrossRef][Medline]
  13. Keller, G. M. (1995) In vitro differentiation of embryonic stem cells. Curr. Opin. Cell Biol. 7,862-869[CrossRef][Medline]
  14. Odorico, J. S., Kaufman, D. S., Thomson, J. A. (2001) Multilineage differentiation from human embryonic stem cell lines. Stem Cells 19,193-204[CrossRef][Medline]
  15. Park, J., Cho, C. H., Parashurama, N., Li, Y., Berthiaume, F., Toner, M., Tilles, A. W., Yarmush, M. L. (2007) Microfabrication-based modulation of embryonic stem cell differentation. Lab Chip 7,1018-1028[CrossRef][Medline]
  16. Chinzei, R., Tanaka, Y., Shimizu-Saito, K., Hara, Y., Kakinuma, S., Watanabe, M., Teramoto, K., Arii, S., Takase, K., Sato, C., Terada, N., Teraoka, H. (2002) Embryoid-body cells derived from a mouse embryonic stem cell line show differentiation into functional hepatocytes. Hepatology 36,22-29[CrossRef][Medline]
  17. Asahina, K., Fujimori, H., Shimizu-Saito, K., Kumashiro, Y., Okamura, K., Tanaka, Y., Teramoto, K., Arii, S., Teraoka, H. (2004) Expression of the liver-specific gene Cyp7a1 reveals hepatic differentiation in embryoid bodies derived from mouse embryonic stem cells. Genes Cells 9,1297-1308[Abstract/Free Full Text]
  18. Jones, E. A., Tosh, D., Wilson, D. I., Lindsay, S., Forrester, L. M. (2002) Hepatic differentiation of murine embryonic stem cells. Exp. Cell Res. 272,15-22[CrossRef][Medline]
  19. Miyashita, H., Suzuki, A., Fukao, K., Nakauchi, H., Taniguchi, H. (2002) Evidence for hepatocyte differentiation from embryonic stem cells in vitro. Cell Transplant. 11,429-434[Medline]
  20. Novik, E. I., Maguire, T. J., Orlova, K., Schloss, R. S., Yarmush, M. L. (2006) Embryoid body-mediated differentiation of mouse embryonic stem cells along a hepatocyte lineage: insights from gene expression profiles. Tissue Eng. 12,1515-1525[CrossRef][Medline]
  21. Shirahashi, H., Wu, J., Yamamoto, N., Catana, A., Wege, H., Wager, B., Okita, K., Zern, M. A. (2004) Differentiation of human and mouse embryonic stem cells along a hepatocyte lineage. Cell Transplant. 13,197-211[Medline]
  22. Hamazaki, T., Iiboshi, Y., Oka, M., Papst, P. J., Meacham, A. M., Zon, L. I., Terada, N. (2001) Hepatic maturation in differentiating embryonic stem cells in vitro. FEBS Lett. 497,15-19[CrossRef][Medline]
  23. Rambhatla, L., Chiu, C. P., Kundu, P., Peng, Y., Carpenter, M. K. (2003) Generation of hepatocyte-like cells from human embryonic stem cells. Cell Transplant. 12,1-11[Medline]
  24. Sharma, N. S., Shikhanovich, R., Schloss, R., Yarmush, M. L. (2006) Sodium butyrate-treated embryonic stem cells yield hepatocyte-like cells expressing a glycolytic phenotype. Biotechnol. Bioeng. 94,1053-1063[CrossRef][Medline]
  25. Maguire, T., Novik, E., Schloss, R., Yarmush, M. (2006) Alginate-PLL microencapsulation: effect on the differentiation of embryonic stem cells into hepatocytes. Biotechnol. Bioeng. 93,581-591[CrossRef][Medline]
  26. Maguire, T., Davidovich, A. E., Wallenstein, E. J., Novik, E., Sharma, N., Pedersen, H., Androulakis, I. P., Schloss, R., Yarmush, M. (2007) Control of hepatic differentiation via cellular aggregation in an alginate microenvironment. Biotechnol. Bioeng. 98,631-644[CrossRef][Medline]
  27. Lange, C., Bassler, P., Lioznov, M. V., Bruns, H., Kluth, D., Zander, A. R., Fiegel, H. C. (2005) Liver-specific gene expression in mesenchymal stem cells is induced by liver cells. World J. Gastroenterol. 11,4497-4504[Medline]
  28. Imamura, T., Cui, L., Teng, R., Johkura, K., Okouchi, Y., Asanuma, K., Ogiwara, N., Sasaki, K. (2004) Embryonic stem cell-derived embryoid bodies in three-dimensional culture system form hepatocyte-like cells in vitro and in vivo. Tissue Eng. 10,1716-1724[CrossRef][Medline]
  29. Fair, J. H., Cairns, B. A., Lapaglia, M. A., Caballero, M., Pleasant, W. A., Hatada, S., Kim, H. S., Gui, T., Pevny, L., Meyer, A. A., Stafford, D. W., Smithies, O., Frelinger, J. A. (2005) Correction of factor IX deficiency in mice by embryonic stem cells differentiated in vitro. Proc. Natl. Acad. Sci. U. S. A. 102,2958-2963[Abstract/Free Full Text]
  30. Zaret, K. (1999) Developmental competence of the gut endoderm: genetic potentiation by GATA and HNF3/fork head proteins. Dev. Biol. 209,1-10[CrossRef][Medline]
  31. Zaret, K. S. (2002) Regulatory phases of early liver development: paradigms of organogenesis. Nat. Rev. Genet. 3,499-512[CrossRef][Medline]
  32. Seglen, P. O. (1976) Preparation of isolated rat liver cells. Methods Cell Biol. 13,29-83[Medline]
  33. Dunn, J. C., Yarmush, M. L., Koebe, H. G., Tompkins, R. G. (1989) Hepatocyte function and extracellular matrix geometry: long-term culture in a sandwich configuration. FASEB J. 3,174-177[Abstract]
  34. Berthiaume, F., Moghe, P. V., Toner, M., Yarmush, M. L. (1996) Effect of extracellular matrix topology on cell structure, function, and physiological responsiveness: hepatocytes cultured in a sandwich configuration. FASEB J. 10,1471-1484[Abstract]
  35. Dunn, J. C., Tompkins, R. G., Yarmush, M. L. (1992) Hepatocytes in collagen sandwich: evidence for transcriptional and translational regulation. J. Cell Biol. 116,1043-1053[Abstract/Free Full Text]
  36. Zhang, B., Borderie, D., Sogni, P., Soubrane, O., Houssin, D., Calmus, Y. (1997) NO-mediated vasodilation in the rat liver. Role of hepatocytes and liver endothelial cells. J. Hepatol. 26,1348-1355[CrossRef][Medline]
  37. Cathey, J., Bickham, J., Patton, J. (1998) Introgressive hybridization and on concordant evolutionary history of maternal and paternal lineages in North American deer. Evolution 52,1224-1229[CrossRef]
  38. Shaw, C., Wilson, P., White, B. (2003) A reliable molecular method of gender determination for mammals. J. Mammal. 84,123-128[CrossRef]
  39. Shito, M., Tilles, A. W., Tompkins, R. G., Yarmush, M. L., Toner, M. (2003) Efficacy of an extracorporeal flat-plate bioartificial liver in treating fulminant hepatic failure. J. Surg. Res. 111,53-62[CrossRef][Medline]
  40. Niwa, H., Miyazaki, J., Smith, A. G. (2000) Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat. Genet. 24,372-376[CrossRef][Medline]
  41. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. (2004) Development of definitive endoderm from embryonic stem cells in culture. Development 131,1651-1662[Abstract/Free Full Text]
  42. Tada, S., Era, T., Furusawa, C., Sakurai, H., Nishikawa, S., Kinoshita, M., Nakao, K., Chiba, T. (2005) Characterization of mesendoderm: a diverging point of the definitive endoderm and mesoderm in embryonic stem cell differentiation culture. Development 132,4363-4374[Abstract/Free Full Text]
  43. Hisatomi, Y., Okumura, K., Nakamura, K., Matsumoto, S., Satoh, A., Nagano, K., Yamamoto, T., Endo, F. (2004) Flow cytometric isolation of endodermal progenitors from mouse salivary gland differentiate into hepatic and pancreatic lineages. Hepatology 39,667-675[CrossRef][Medline]
  44. Ang, S. L., Wierda, A., Wong, D., Stevens, K. A., Cascio, S., Rossant, J., Zaret, K. S. (1993) The formation and maintenance of the definitive endoderm lineage in the mouse: involvement of HNF3/forkhead proteins. Development 119,1301-1315[Abstract]
  45. Nagy, P., Bisgaard, H. C., Thorgeirsson, S. S. (1994) Expression of hepatic transcription factors during liver development and oval cell differentiation. J. Cell Biol. 126,223-233[Abstract/Free Full Text]
  46. Zaret, K. S. (2001) Hepatocyte differentiation: from the endoderm and beyond. Curr. Opin. Genet. Dev. 11,568-574[CrossRef][Medline]
  47. Wells, J. M., Melton, D. A. (1999) Vertebrate endoderm development. Annu. Rev. Cell Dev. Biol. 15,393-410[CrossRef][Medline]
  48. Ball, E. M., Risbridger, G. P. (2001) Activins as regulators of branching morphogenesis. Dev. Biol. 238,1-12[CrossRef][Medline]
  49. Yasuda, H., Mine, T., Shibata, H., Eto, Y., Hasegawa, Y., Takeuchi, T., Asano, S., Kojima, I. (1993) Activin A: an autocrine inhibitor of initiation of DNA synthesis in rat hepatocytes. J. Clin. Invest. 92,1491-1496[Medline]
  50. D'Amour, K. A., Agulnick, A. D., Eliazer, S., Kelly, O. G., Kroon, E., Baetge, E. E. (2005) Efficient differentiation of human embryonic stem cells to definitive endoderm. Nat. Biotechnol. 23,1534-1541[CrossRef][Medline]
  51. Xu, C., Inokuma, M. S., Denham, J., Golds, K., Kundu, P., Gold, J. D., Carpenter, M. K. (2001) Feeder-free growth of undifferentiated human embryonic stem cells. Nat. Biotechnol. 19,971-974[CrossRef][Medline]
  52. Endo, D., Kogure, K., Hasegawa, Y., Maku-uchi, M., Kojima, I. (2004) Activin A augments vascular endothelial growth factor activity in promoting branching tubulogenesis in hepatic sinusoidal endothelial cells. J. Hepatol. 40,399-404[CrossRef][Medline]
  53. Skrtic, S., Wallenius, K., Gressner, A. M., Jansson, J. O. (2000) Characterization of hepatocyte-derived mitogenic activity on hepatic stellate cells. Liver 20,157-164[CrossRef][Medline]
  54. Gressner, A. M., Brenzel, A., Vossmeyer, T. (1993) Hepatocyte-conditioned medium potentiates insulin-like growth factor (IGF) 1 and 2 stimulated DNA synthesis of cultured fat storing cells. Liver 13,86-94[Medline]
  55. Story, M. T. (1989) Cultured human foreskin fibroblasts produce a factor that stimulates their growth with properties similar to basic fibroblast growth factor. In Vitro Cell Dev. Biol. 25,402-408[Medline]
  56. Matsumoto, K., Okazaki, H., Nakamura, T. (1992) Up-regulation of hepatocyte growth factor gene expression by interleukin-1 in human skin fibroblasts. Biochem. Biophys. Res. Commun. 188,235-243[CrossRef][Medline]
  57. Schmidtchen, A., Carlstedt, I., Malmstrom, A., Fransson, L. A. (1990) Inventory of human skin fibroblast proteoglycans. Identification of multiple heparan and chondroitin/dermatan sulphate proteoglycans. Biochem. J. 265,289-300[Medline]
  58. Ishii, T., Yasuchika, K., Fujii, H., Hoppo, T., Baba, S., Naito, M., Machimoto, T., Kamo, N., Suemori, H., Nakatsuji, N., Ikai, I. (2005) In vitro differentiation and maturation of mouse embryonic stem cells into hepatocytes. Exp. Cell Res. 309,68-77[CrossRef][Medline]
  59. Wells, J. M., Melton, D. A. (2000) Early mouse endoderm is patterned by soluble factors from adjacent germ layers. Development 127,1563-1572[Abstract]
  60. Bhatia, S. N., Balis, U. J., Yarmush, M. L., Toner, M. (1999) Effect of cell-cell interactions in preservation of cellular phenotype: cocultivation of hepatocytes and nonparenchymal cells. FASEB J. 13,1883-1900[Abstract/Free Full Text]
  61. Dunn, J. C., Tompkins, R. G., Yarmush, M. L. (1991) Long-term in vitro function of adult hepatocytes in a collagen sandwich configuration. Biotechnol. Prog. 7,237-245[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.06-7764comv1
22/3/898    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cho, C. H.
Right arrow Articles by Yarmush, M. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cho, C. H.
Right arrow Articles by Yarmush, M. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS