FASEB J. Uncover Your Biological Pathway
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published as doi: 10.1096/fj.07-9244com.
 (The FASEB Journal. 2008;22:538-547.)
© 2008 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
fj.07-9244comv1
22/2/538    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kalsotra, A.
Right arrow Articles by Strobel, H. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kalsotra, A.
Right arrow Articles by Strobel, H. W.
(The FASEB Journal. 2008;22:538-547.)
© 2008 FASEB

Inflammation resolved by retinoid X receptor-mediated inactivation of leukotriene signaling pathways

Auinash Kalsotra*, Liping Du{dagger}, Ying Wang*, Patricia A. Ladd{ddagger}, Yasushi Kikuta§, Madeleine Duvic||, Alan S. Boyd{ddagger}, Diane S. Keeney{dagger},{ddagger} and Henry W. Strobel*,1

* Department of Biochemistry and Molecular Biology, University of Texas-Houston Medical School, Houston, Texas, USA; Departments of

{dagger} Biochemistry and

{ddagger} Medicine/Dermatology, Vanderbilt University School of Medicine, Nashville, Tennessee, USA;

§ Department of Applied Biological Science, Fukuyama University, Fukuyama, Hiroshima, Japan; and

|| Department of Dermatology, University of Texas M.D. Anderson Cancer Center, Houston, Texas, USA

1 Correspondence: University of Texas Health Science Center at Houston, 6431 Fannin St., Medical School Bldg. 6, Room 200, Houston, TX 77030, USA. E-mail: henry.w.strobel{at}uth.tmc.edu


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Leukotrienes are implicated in the pathogenesis of diverse, inflammation-driven diseases. Metabolic inactivation of leukotriene signaling is an innate response to resolve inflammation, yet little is known of mechanisms regulating disposition of leukotrienes in peripheral tissues afflicted in common inflammatory diseases. We studied leukotriene hydroxylases (CYP4F gene products) in human skin, a common target of inflammation and adverse drug reactions. Epidermal keratinocytes express at least six CYP4F enzymes; the most highly expressed and highly regulated is CYP4F3A—the main neutrophil leukotriene hydroxylase. Differentiation-specific factors and retinoids are positive CYP4F regulators in vitro, effecting increased leukotriene B4 hydroxylation (inactivation). CYP4F expression is up-regulated in situ in hyperproliferative dermatoses—an innate mechanism to repair and restore epidermal barrier competency—and after retinoid therapy. Enhanced CYP4F-mediated inactivation of leukotriene signaling is a previously unrecognized antiinflammatory property of therapeutic retinoids mediated by preferential interactions between retinoid X receptors and CYP4F promoter elements in epidermal cells.—Kalsotra, A., Du, L., Wang, Y., Ladd, P. A., Kikuta, Y., Duvic, M., Boyd, A. S., Keeney, D. S., Strobel, H. W. Inflammation resolved by retinoid X receptor-mediated inactivation of leukotriene signaling pathways.


Key Words: cytochromes P450 4F • epidermal inflammation • resolution signals


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
LEUKOTRIENES ARE PROINFLAMMATORY lipids implicated in the pathogenesis of inflammation-driven diseases, including asthma, atopic dermatitis, reperfusion injury, immediate hypersensitivity reactions, adaptive immune responses, rheumatoid arthritis, inflammatory bowel disease, and psoriasis (1 , 2) . Leukotriene B4 (LTB4) mediates innate immune responses by modulating leukocyte effector functions and production of chemokines and cytokines that amplify inflammation (3) . The amplification phase of inflammation is microbiocidal and tissue damaging but normally self-limiting (1) . Resolution is effected by innate mechanisms: catabolism of proinflammatory mediators and biosynthesis of proresolving mediators (1 , 4) . Switching from the tissue-damaging, amplification phase to the tissue-repair and epithelial closure phase is characterized temporally by a switch in production of proinflammatory lipids (e.g., leukotrienes, prostaglandin E2) to proresolving lipids (e.g., lipoxins, resolvins) (1 , 4 , 5) .

Metabolic inactivation of leukotriene signaling has been ignored as a proresolving mechanism due to the dearth of knowledge concerning how catabolic pathways are regulated, especially in peripheral tissues afflicted in common inflammatory diseases. The potent chemoattractant LTB4 is inactivated mainly by hydroxylation at the {omega}-terminus, catalyzed by cytochromes P450 CYP4F3A and CYP4F2 (CYP gene products) in human neutrophils and liver, respectively (2 , 6 , 7) . Proresolving actions of CYP4F enzymes are further supported by their increased expression in various organ systems following traumatic brain injury or challenge with proinflammatory mediators (6 , 8 , 9) .

Skin is a common target in inflammation-driven diseases (e.g., atopic dermatitis, psoriasis, pemphigus, Goodpasture’s syndrome) and adverse drug reactions (4 , 10 , 11) . Epidermal keratinocytes initiate antigen-independent cutaneous inflammation in response to direct trauma and foreign agents that compromise the epidermal barrier (12) . They express pathogen recognition receptors and have important recognized functions in immune surveillance and response, including release of preformed interleukin-1{alpha} on injury and production of chemokines and immunoregulatory cytokines that can recruit and activate diverse immune cells (11 , 13 14 15) .

Epidermal keratinocytes inactivate LTB4, evidence that their repertoire of expressed CYP genes likely includes CYP4F subfamily members (16 17 18 19) . The large CYP superfamily is responsible for oxidative metabolism and disposition of numerous small molecular substrates originating endogenously and exogenously (e.g., vitamins, fatty acids, sterols, steroids, environmental toxins, natural products, drugs). The CYP4F subfamily accounts for six of the 57 functional CYP genes in humans and at least seven functional transcripts (CYP4F2, 4F3A, 4F3B, 4F8, 4F11, 4F12, 4F22) (6 , 20) . In skin, only CYP4F8 and 4F12 have been studied (21 22 23) ; neither are logical candidates for LTB4 disposition in vivo (7 , 24) .

CYP4F substrates include drugs, natural compounds, and a plethora of endogenous ligands, including LTB4, long-chain and very-long-chain fatty acids (25) , eicosatetraenoic acids, prostaglandins (6 , 7) , epoxyeicosatrienoic acids, other fatty acid epoxides and epoxy alcohols (26) , tocopherol (27) , and phytanic acid (28) . Besides inactivating leukotriene signaling, CYP4F enzymes likely function in the biosynthesis and catabolism of other immunomodulatory lipids. As CYP4F substrates and products are of considerable medical importance, we investigated factors regulating CYP4F expression and LTB4 inactivation in human skin, a recognized immune organ for which facile in vitro models exist.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Tissue and cell culture
Epidermal keratinocytes isolated from discarded, human newborn foreskins were cultured as described (29) . Cellular differentiation was initiated when proliferating cultures achieved {approx}80% confluence (day 0), by adjusting media calcium to 1.4 mM. Differentiating cultures were fed daily with media containing vehicle (0.1% dimethyl sulfoxide) or drugs: 1 nM 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD); 0.1 µM all trans-retinoic acid, unless another concentration is specified; 10 µM dexamethasone; 30 µM β-naphthoflavone; 10 µM rifampicin; 10 µg/ml dapsone; and 0.5 µM miconazole. All drugs were from Sigma-Aldrich (St. Louis, MO, USA) except TCDD (AccuStandard Inc., New Haven, CT, USA). Retinoid nuclear receptor ligands LG268 and TTNPB [4-(2-(5,6,7,8-tetrahydro-5,5,8,8-tetramethyl-2-naphthalenyl)-1-propenyl) benzoic acid] were gifts from Peter J. A. Davies (University of Texas-Houston). Biopsy specimens were obtained via Institutional Review Board approved protocols at the University of Texas and Vanderbilt University Dermatology/Dermatopathology. Unaffected and lesional human skin biopsies were taken before and after daily topical application of tazarotene (0.1% gel; Allergan, Irvine, CA, USA); all other therapies were discontinued 4 wk before and during this study. Other skin biopsies were from individual adult patients (aged 30–75 years) on retinoid therapy; other medications were not documented in their available medical histories.

Gene expression
Total RNA template was prepared as described (29) . Primer Express software (Applied Biosystems, Foster City, CA, USA) aided the design of transcript-specific CYP4F primers and fluorescent probes (Supplemental Table 1). Standard curves were generated with known mass (50 ag to 5 pg) of synthetic, transcript-specific CYP4F amplicons, which enable comparisons of mRNA abundance across CYP4F quantitative real-time PCR (qPCR) assays after normalizing data for 18S rRNA content. IDT DNA Technology synthesized all oligonucleotides. Template (200 ng RNA or known mass of amplicon) was subjected to reverse transcription in quadruplicate (10 µl) reactions containing 1x SSII buffer, 300 nM reverse primer, 500 µM dNTPs, and 10 U Superscript II (Invitrogen, Carlsbad, CA, USA). This cDNA was used neat for all qPCR assays except 18S rRNA (diluted 1:50). Reverse transcriptase was omitted for the negative controls. Reverse-transcription conditions were 50°C for 30 min and 72°C for 5 min. We then added 40 µl of PCR mix (1x PCR buffer, 300 nM forward primer, 300 nM reverse primer, 4 mM MgCl2, 2.5 U Taq polymerase, and 100 nM fluorogenic probe). Cycle threshold (Ct) values for fresh epidermis were <30; those >36 were considered nonspecific.

Cytokeratin 10, transglutaminase 1, and loricrin assays utilized Taqman Assays-on-Demand qPCR kits and Universal PCR Master Mix containing AmpErase UNG (Applied Biosystems). These three assays have been described, and validation statistics have been reported for keratinocyte RNA (29) . Transcripts encoding retinoid X receptor (RXR) and retinoid A receptor (RAR) isoforms were amplified using Superscript One Step RT-PCR kits (Invitrogen) and transcript-specific oligonucleotides (Supplemental Table 2). β-Actin transcripts were amplified as an internal control. Ethidium bromide visualized products generated after 20, 25, 30, and 35 amplification cycles, resolved on 1.5% agarose gels.

Histology
Dewaxed tissue sections were subjected to in situ hybridization. Digoxigenin-labeled cRNA probes (25 ng/ml hybridization buffer) encoding 517–802 bp of CYP4F11 (NM_021187) were prepared using a DIG RNA Labeling Kit, DIG Wash and Block Buffer Set, and digoxigenin antibody (1:500) conjugated to alkaline phosphatase (Roche Applied Science, Indianapolis, IN, USA). Specific hybridization was visualized colorimetrically. Other sections subjected to immunocytochemistry were incubated for 1 h with 5% goat serum in phosphate buffered saline containing 0.25% Triton X-100 and then for 48 h with rabbit antisera (1:500, 4°C) raised against residues 70–79 of CYP4F2 or residues 260–269 of CYP4F3 (30) . Rabbit IgG conjugated to Alexafluor-488 visualized specific binding (Molecular Probes, Eugene, OR, USA). Other sections were incubated for 30 min with 0.6% hydrogen peroxide and then for 48 h with antisera specific for neutrophil elastase (EMD Biosciences, San Diego, CA, USA; 1:100, 4°C) or a mixture of both CYP4F antibodies (1:100, 4°C). Vectastain-Elite ABC reagent kit and biotinylated goat anti-rabbit antibody (1:500) were used to visualize specific binding (Vector Laboratories, Burlingame, CA, USA).

Protein and enzyme activity
Microsomes were prepared from keratinocytes cultures as described (31) , with modifications. A Polytron disrupted the cell pellets (PT3100 with PT-DA3007/2 7 mm generator, Brinkmann Instruments, Westbury, NY, USA), which had been scraped in PBS (three 1-min pulses, {approx}14,000 rpm). Homogenates were transferred to 1.5 ml tubes and centrifuged for 30 min at 10,000 g in a Sorvall Micro-Ultracentrifuge at 4°C (SA100-AT4 rotor; Kendro Laboratory Products, Waltham, MA, USA). The 10,000 g supernatant fractions were centrifuged for 90 min at 100,000 g. The 100,000 g microsomal pellets were stored briefly at –30°C and subjected to LTB4 metabolism assays (100 µg protein/0.1 ml reaction). Metabolites were resolved by reversed-phase HPLC as described (32) . Authentic 20-OH-LTB4 detected at 270 nm was used to estimate the mass of LTB4 metabolites formed. Microsomal proteins (10–40 µg) were also resolved on 4–15% gradient Tris-glycine gels (Bio-Rad, Hercules, CA, USA) and transferred to nitrocellulose membranes, which were blocked overnight and incubated for 3 h with anti-CYP4F2 or anti-CYP4F3A sera (1:500). Chemiluminescence visualized specific complexes formed by antibody-horseradish peroxidase conjugates. Whole cell lysates were subjected to immunoblotting using antiloricrin as described (Covance Research Products, Princeton, NJ, USA; PRB-145P, 1:500) (33) .

DNA binding
CYP4F2 promoter elements were identified using TRANSFAC version 4.0 (34) . ChIP-IT Chromatin Immunoprecipitation and Enzymatic Shearing kits were used according to the manufacturer’s instructions (Active Motif, Carlsbad, CA, USA). Chromatin was sheared enzymatically (10 min, 37°C) into 200–1000 bp fragments and then immunoprecipitated for 4 h with control mouse IgG, anti-RXR, or anti-RAR IgG (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 2 µg IgG/50 µl sheared chromatin). Immunoprecipitated fractions were amplified using sense (GGGCCAAAGAGTAAATCA) and antisense (TTTGTGACATGGGAACTAGG G) oligonucleotides (5'-3') corresponding to sequences flanking DR-4 promoter elements in CYP4F2. Amplification conditions were 94°C for 2 min, and then 35 cycles at 94°C for 1 min, 58°C for 1 min, and 72°C for 1 min. Ethidium bromide visualized products resolved on 2% agarose gels.

In vitro binding assays utilized a LightShift Chemiluminescent Electrophoretic Mobility Shift Assay kit and a Biotin 3' End DNA Labeling kit (Pierce Biotechnology, Rockford, IL, USA). Nuclear extracts were prepared from keratinocytes cultures (NucBuster Protein Extraction kit 71183; Novagen, Madison, WI, USA). Protein yield from 1.5 x 107 cells was 1.4 mg (225 µl). Binding reactions (25°C, 20 min) contained 10 µg of nuclear protein, buffer (10 mM Tris pH 7.5, 50 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 0.05% Nonidet P-40, 2.5% glycerol), 1 µg poly(dI-dC), and 2 nM of biotinylated CYP4F2 probe (5'-3': GAATTATTTGCCCTCCTGTGACCTCCCTTGGATTAAT). Biotinylation efficiency was estimated by dot blot analyses of control oligonucleotides. Protein-DNA complexes were resolved on 5% Tris borate-EDTA gels (Bio-Rad), transferred to nylon membranes, and visualized by chemiluminescence. Some reactions were preincubated for 10 min with 200-fold excess of unlabeled CYP4F2 probe before adding biotinylated CYP4F2. For supershift assays, reactions were preincubated for 10 min with 2 µg RXR-specific or RAR-specific IgG (Santa Cruz Biotechnology) before adding biotinylated CYP4F2.

Statistics
Statistical significance was determined using two-tailed, unpaired Student’s t tests. Probability (P) values <0.05 were considered statistically different.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Differentiation-specific factors regulate epidermal CYP4F expression
We identified transcripts arising from the CYP4F2, 4F3, 4F8, 4F11, and 4F12 genes in human epidermal keratinocytes and studied factors regulating CYP4F expression using a well-characterized in vitro differentiation system (29) . In this model, proliferating day 0 cultures represent predominantly a basal cell phenotype. Differentiating day 6 cultures represent predominantly a spinous cell phenotype, evidenced by up-regulated expression of differentiation-specific genes (Supplemental Fig. 1). Cellular differentiation induced mRNA expression levels for CYP4F2 (7-fold), 4F3A (88.5-fold), 4F3B (14-fold), and 4F12 (65.5-fold), compared with levels in proliferating keratinocytes (Fig. 1 A). CYP4F3A was the most abundant and most highly regulated transcript (day 6 vs. day 0). Cellular differentiation had no influence on levels of CYP4F11 mRNA; CYP4F8 mRNA was too low to measure.


Figure 1
View larger version (37K):
[in this window]
[in a new window]

  		Figure 1. Human epidermis expresses CYP4F mRNA and protein. Cellular mRNA levels (mean±SD) are expressed as the ratio [CYP4F mRNA/18S rRNAx100]. A) CYP4F mRNA levels in epidermal cell cultures (n=6). *P < 0.05 (day 6 vs. day 0). N.D., not detectable. B) CYP4F mRNA levels in epidermal tissues (n=4). *P < 0.05 (neonatal foreskin vs. adult breast). C) CYP4F mRNA and protein localize preferentially to differentiated epidermal cell layers in situ. Rows 1 and 3 show normal skin; results are representative for neonatal foreskin, adult breast, and adult abdominal skin (n=4 donors). Rows 2 and 4 show hyperproliferative skin (n=2 donors). Blue reaction product visualizes specific hybridization of antisense cRNA sequence common to all CYP4F transcripts (a–d); nuclear-red is the counter stain. Hybridization with sense cRNA is non-specific (q, r). Blue fluorescence visualizes nuclear DNA binding with 4'-6-diamidino-2-phenylindole (e–h). Green fluorescence visualizes specific interactions with anti-CYP4F2 (i–l) or anti-CYP4F3A sera (m–p). Primary antibody was omitted (s, t). Scale bars = 100 µm (a–f, i–j, m–n, q–r); 50 µm (g–h, k–l, o–p, s–t).

Fresh epidermal tissue exhibits remarkably similar CYP4F expression profiles (Fig. 1B ), demonstrating physiological relevance of the in vitro model. Some differences were expected since epidermis contains four cellular layers corresponding to four differentiation states—basal, spinous, and granular keratinocytes, and anucleated corneocytes. Whereas epidermal cultures are "synchronized" to express one predominant differentiation state. Other factors may influence tissue CYP4F mRNA levels: donor age, site sampled, genetics, and environmental exposures.

CYP4F transcripts and protein immunoreactivity (CYP4F2, CYP4F3A) localize specifically to the cytoplasm of suprabasal keratinocytes in human skin (Fig. 1C ). Highest expression localizes to the outer, differentiated cell layers, which is further evidence that differentiation-specific factors regulate epidermal CYP4F expression. We detected little dermal CYP4F expression in fibroblasts, sebocytes, or follicular keratinocytes beneath the level of the sebaceous ducts. Hyperproliferative human skin appeared to express higher CYP4F mRNA and protein levels likely due to an expanded spinous cell layer (increased numbers of CYP4F-expressing keratinocytes vs. normal skin). Another possibility is increased CYP4F protein content per keratinocyte. Concordant results from qPCR, in situ hybridization, and immunofluorescence studies support several conclusions. Human epidermal cells express CYP4F enzymes. The main LTB4 hydroxylase in neutrophils CYP4F3A is also the most highly expressed CYP4F in keratinocytes. The outer, differentiated keratinocytes express the highest CYP4F levels, which are increased further in hyperproliferative (vs. normal) human skin.

Retinoic acid up-regulates epidermal CYP4F expression and LTB4 inactivation
To further study CYP4F transcriptional regulation, keratinocytes were exposed during in vitro differentiation to known hepatic CYP inducers and clinically relevant drug compounds, including nuclear receptor ligands recognized as master regulators of CYP gene expression (35) . Transcripts were measured after 6 treatment days, sufficient time for the cultures to form stratified, squamous "epithelia" resembling differentiating spinous cells in vivo (29) . Keratinocytes differentiated in the presence of all trans-retinoic acid (0.1 µM) had greater CYP4F2, 4F3A, 4F3B, and 4F11 mRNA levels (Fig. 2 A) and greater microsomal CYP4F3A and 4F2 protein content detected by Western blot analyses (vs. vehicle) (Fig. 2D ). None of the other tested compounds—2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), dexamethasone, dapsone, β-naphthoflavone, miconazole, or rifampicin—altered significantly the differentiation-induced expression of CYP4F mRNA (all data not shown). However, early transient changes in mRNA expression would not be detected in these studies. CYP4F12 mRNA levels were unaffected by all treatments, and CYP4F8 was undetectable (data not shown).


Figure 2
View larger version (33K):
[in this window]
[in a new window]

  		Figure 2. Retinoic acid induces epidermal CYP4F enzymes and inhibits in vitro differentiation. Human keratinocyte cultures were differentiated for 6 d in the presence of vehicle or drug: TCDD, 2,3,7,8-tetrachlorodibenzo-p-dioxin; ATRA, all trans-retinoic acid; Dex, dexamethasone; b-NF, β-naphthoflavone; Micon, miconazole. Cellular mRNA levels (mean±SD; n=3) were normalized for 18S rRNA content and expressed as the ratio [drug÷vehicle], where vehicle = 1. A) CYP4F mRNA. B) Cytokeratin 10 (K10), transglutaminase 1 (TGM1), and loricrin mRNA. *P < 0.05 (drug vs. vehicle). C) Retinoic acid inhibits loricrin protein expression in differentiating keratinocyte cultures (media Ca2+=1.4 mM). Loricrin is undetectable on Western blots when the medium does not support terminal differentiation (Ca2+=0.06 mM). D) Retinoic acid induces microsomal CYP4F3A and CYP4F2 content. Antisera interact specifically with keratinocyte protein species (55 kDa) on Western blots. E) Retinoic acid induces NADPH-dependent LTB4 metabolism by keratinocyte microsomes (60 µM LTB4, 20 min, 37°C). Rates are shown for products coeluting with 20-OH LTB4 (mean±SD; n=3 independent determinations from pooled microsomes). Values for vehicle treatment were near the lower assay limit. *P < 0.005 (retinoic acid vs. vehicle).

Retinoic acid is a negative regulator of epidermal differentiation in vitro (36) . In these studies, it blocked the expected increase in cytokeratin 10, transglutaminase 1, and loricrin mRNA and protein at day 6 (Fig. 2B, C ). These keratinocyte cultures had stratified, indicating differentiation was not blocked completely by retinoid exposure (17) . That retinoic acid can induce CYP4F genes that are preferentially expressed in differentiating cells and at the same time inhibit expression of differentiation-specific gene markers suggests that factors regulating these two sets of genes involve different and possibly independent transcriptional mechanisms.

In human neutrophils and hepatocytes CYP4F3A and CYP4F2 inactivate LTB4 signaling via catalytic hydroxylation at the LTB4 {omega}-terminus (7) . In differentiating keratinocytes, retinoic acid exposure induced significantly greater rates of NADPH-dependent, microsomal LTB4 hydroxylation (vs. vehicle) (Fig. 2E and Supplemental Fig. 2). This is evidence that retinoid-inducible CYP4F proteins (Fig. 2D ) are catalytically active LTB4 hydroxylases.

Retinoid X receptors mediate retinoid-inducible CYP4F expression
Compared with all trans-retinoic acid, 9-cis-retinoic was equally or more efficacious at inducing retinoid-responsive CYP4F transcripts in differentiating keratinocytes. This was observed using submicromolar retinoid concentrations, which are relevant therapeutically (Fig. 3 A, B). The precursor retinol was ineffective below 1 µM. Data are shown only for the two most highly regulated transcripts CYP4F2 and 4F3A. These results point to RXR as a critical regulatory factor since 9-cis-retinoic acid is ligand for RXR but not RAR (37) . Further supporting this hypothesis, the RXR-specific ligand LG268 (0.1–1.0 µM) induced CYP4F mRNA expression, but the RAR-specific ligand TTNPB at the same concentrations tended to suppress CYP4F expression in differentiating epidermal keratinocytes (Fig. 3C, D ). Results obtained with both natural and synthetic retinoid nuclear receptor ligands point to RXR as a key factor mediating retinoid-inducible CYP4F expression and function in epidermal keratinocytes.


Figure 3
View larger version (8K):
[in this window]
[in a new window]

  		Figure 3. RXR mediates retinoid-inducible epidermal CYP4F expression. Human keratinocyte cultures were differentiated for 6 days in the presence of vehicle or drug: all trans-retinoic acid (ATRA), 9-cis-retinoic acid (9-cis RA), retinol, RAR-specific ligand (TTNPB), or RXR-specific ligand (LG268). CYP4F mRNA are normalized for 18S rRNA and expressed as the ratio [drug÷vehicle], where vehicle = 1. Points represent mean values (n=2) for each compound at three concentrations.

Chromatin immunoprecipitation assays show that retinoid nuclear receptor proteins interact specifically with endogenous CYP4F2 promoter elements in differentiating epidermal keratinocytes (Fig. 4 A). For the end point, we amplified sequences flanking the putative direct repeat (DR-4) elements in CYP4F2. CYP4F2-specific genomic DNA was amplified preferentially when chromatin from retinoic acid-treated keratinocytes was immunoprecipitated with RXR-specific antibody (vs. vehicle). In contrast, CYP4F2 genomic DNA was amplified nonpreferentially (regardless of treatment) when the immunoprecipitating antibody was RAR-specific. No products were amplified when the precipitating IgG was nonspecific. These results suggest retinoic acid exposure promotes specific and preferential binding interactions between endogenous RXR and DR-4 elements in the proximal CYP4F2 promoter in differentiating epidermal keratinocytes. Binding interactions involving endogenous RAR were not responsive to retinoic acid treatment, although we did not use a quantitative PCR method in this substudy.


Figure 4
View larger version (18K):
[in this window]
[in a new window]

  		Figure 4. Retinoic acid induces RXR binding interactions with endogenous CYP4F2 promoter elements. Human keratinocyte cultures were differentiated for 6 d in the presence of vehicle or all trans-retinoic acid (ATRA). A) Nuclear chromatin was immunoprecipitated with RXR- and RAR-specific antibodies (Ab) or nonspecific IgG. Genomic DNA fragments in the immunocomplexes were amplified by PCR using primers flanking the CYP4F2 promoter DR-4 site (Supplemental Fig. 2 ). Ethidium bromide visualized products resolved on 2% agarose gels. Input DNA represents template before immunoprecipitation. B) RXR-{alpha} and RAR-{gamma} transcripts predominate in human epidermal cells, detected by reverse-transcription PCR. Positive control (+ve) RNA template was from liver, except for RAR-{alpha} where we used brain RNA. Epidermal RNA templates: E, human neonatal epidermis; d0, proliferating keratinocyte cultures; d6, vehicle-treated differentiating cultures; d6-ATRA, retinoic acid-treated (0.1 µM) differentiating cultures.

Electrophoretic mobility shift assays generated concordant results using cDNA probe encoding CYP4F2 DR-4 promoter elements (Supplemental Fig. 3 ). Specific protein-DNA complexes were visualized only when nuclear extracts were from retinoic acid exposed keratinocytes. Addition of excess unlabeled probe or RXR-/RAR-specific antibodies disrupted complex formation; these results are consistent with functional RXR-RAR heterodimers in the retinoid treated keratinocytes.

Human epidermis and derived cell cultures express mainly RXR-{alpha} and RAR-{gamma} transcripts, regardless of the cultures’ differentiation state (Fig. 4B ). Other RXR isoforms (-β and -{gamma}) appeared more abundant in cultured keratinocytes than in epidermal tissue. Other RAR isoforms (-{alpha} and -β) were low or undetectable in both epidermal tissue and cultured cells. Only RXR transcripts appeared to be modulated by retinoic acid in the differentiating (day 6) cultures: RXR-β levels tended to increase, and those for RXR-{gamma} tended to decrease (vs. vehicle). Hence, RXR-{alpha} and -β are the isoforms most likely involved in mediating retinoid-inducible CYP4F transcription in human epidermal keratinocytes, via functional heterodimers with RAR-{gamma} or another nuclear receptor.

Enhanced CYP4F-mediated inactivation of LTB4 signaling is an antiinflammatory action of therapeutic retinoids
Results of immunocytochemical analyses (Fig. 5 A) suggest retinoid therapy further augments the increased CYP4F expression levels observed in hyperproliferative human skin (Fig. 1C ). CYP4F expression tends to be greater in all epidermal layers in retinoid treated (vs. untreated) patients, but the most striking effect of retinoid therapy is demonstrable CYP4F immunoreactivity in basal keratinocytes. This contrasts with negligible CYP4F immunoreactivity in basal keratinocytes in untreated diseased skin.


Figure 5
View larger version (127K):
[in this window]
[in a new window]

  		Figure 5. In hyperproliferative dermatoses, retinoid therapy is associated with higher CYP4F protein expression in the basal and suprabasal cell layers, loss of neutrophils, and substantial normalization of epidermal differentiation. A) Epidermal CYP4F protein detected in biopsy sections using pooled CYP4F antisera. Panels represent individual patients having the following diagnoses: LDR, lichenoid drug eruption; LDR Rx, patient taking isotretinoin; PR, pityriasis rosea-like drug reaction; PR Rx, patient taking bexarotene; Ps, psoriasis; Ps Rx, patient taking etretinate. Specificity is demonstrated by omitting antisera (–). Row 1: scale bar = 100 µm. Rows 2–4: scale bar = 100 µm. B) Topical retinoid therapy in patients (n=2) with longstanding plaque psoriasis results in loss of neutrophils in skin lesions, visualized by neutrophil elastase-specific antisera. Patients had biopsies analyzed for unaffected and lesional skin before treatment and then after 14-d treatment with the RAR-selective retinoid tazarotene (Lesional Rx). Arrows indicate elastase-positive neutrophils localized to Munro’s microabscess in lesional skin. Immunoreactivity also localizes to epidermal keratinocytes, which express elastase 1 (64) . Scale bars = 100 µm.

Up-regulated CYP4F expression in situ and in vitro represents increased capacity to inactivate the potent neutrophil chemoattractant LTB4. A physiological consequence in inflamed skin is to mitigate or reverse the tissue-damaging effects of persistent leukocyte infiltration. In patients with longstanding plaque psoriasis, neutrophils are prominent in the parakeratotic layer forming Munro’s microabscess (Fig. 5B ). The RAR-β/-{gamma} selective retinoid tazarotene effected substantial normalization of epidermal differentiation and loss of neutrophils in psoriatic lesions. These results point toward enhanced CYP4F-mediated inactivation of LTB4 signaling as a previously unrecognized antiinflammatory property of therapeutic retinoids.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Retinoids affect numerous signaling pathways in human skin (36) . Their antiinflammatory, prodifferentiating, and chemopreventative properties are efficacious toward diverse disorders including psoriasis, acne, ichthyosis, photoaging, cancer, emphysema, and bronchopulmonary dysplasia in newborns (38 39 40 41) . We present evidence that retinoids up-regulate a proresolving pathway in human epidermal keratinocytes by mechanisms involving RXR-mediated CYP4F transcriptional activation (Fig. 6 ). One result is increased epithelial capacity to metabolically inactivate leukotrienes produced by infiltrating neutrophils, thereby antagonizing LTB4 signaling and further neutrophil recruitment. This CYP4F-dependent pathway functions as a physiological stop signal for epithelial inflammation, facilitating the switch to tissue repair and wound healing. Interventions that enhance CYP4F function may augment the therapeutic efficacy of drugs targeting specific etiological factors in inflammation-driven disorders.


Figure 6
View larger version (30K):
[in this window]
[in a new window]

  		Figure 6. Schematic depicts the novel antiinflammatory actions of retinoid ligands to induce CYP4F expression and function. Neutrophils infiltrate inflamed skin and produce LTB4 via the 5-lipoxygenase pathway. LTB4 amplifies inflammation by recruiting leukocytes and stimulating cytokine and chemokine production. Therapeutic retinoids resolve inflammation in part by promoting specific interactions between RXR and CYP4F promoter elements, activating CYP4F transcription in epidermal cells. The heterodimeric RXR partner might be RAR or another nuclear receptor. This leads to increased epidermal CYP4F protein expression, catalytic hydroxylation at the LTB4 omega-terminus and inactivation of LTB4 signaling. This antagonizes leukocyte recruitment. This RXR-mediated pathway serves as a braking mechanism for the tissue damaging effects of inflammation, facilitating tissue repair and restoration of homeostasis.

Hyperproliferative skin lesions exhibit enhanced CYP4F enzyme levels: CYP4F2 and 4F3A in our studies, CYP4F8 in others (23) . This increased capacity to inactivate LTB4 signaling is an innate response to restore tissue homeostasis and epidermal barrier competency. Therapeutic retinoids mimic or augment this innate repair mechanism in diseased skin. CYP4F up-regulation may be a generalized self-defense mechanism effectuated in response to environmentally induced cell damage and chronic inflammatory diseases in genetically predisposed individuals.

This hypothesis is supported by animal studies modeling trauma-induced brain injury (6 , 8 , 9 , 42 , 43) . Specifically, CYP4F enzymes levels are down-regulated at sites of brain injury during the first 24 h when LTB4 signaling has essential roles in self-defense (acute inflammation), and then they are up-regulated 24 h postinjury. This switch in CYP4F enzyme levels coincides temporally with the expected switch from biosynthesis of proinflammatory lipids (amplification phase) to catabolism of proinflammatory lipids and biosynthesis of proresolving lipids (resolution and tissue repair phase). In this context, CYP4F-expressing keratinocytes in inflamed skin have greatest potential to limit the tissue-damaging effects of inflammatory eicosanoids, owing to their long life span in vivo (weeks vs. hours for short-lived CYP4F-expressing neutrophils). Direct proof of this hypothesis awaits future studies utilizing genetic mouse models.

CYP4F catalysis generates 20-OH and 20-COOH LTB4 via an aldehyde intermediate; the dicarboxylic acid is then subject to β-oxidation (44 45 46) . Although {omega}-oxidation is generally accepted as a degradation pathway, 20-OH LTB4 has been shown to bind BLT1 receptor with similar affinities as LTB4 (47 , 48) . It should be also be noted that while {omega}-OH LTB4 is relatively unstable and is rapidly oxidized to 20-COOH LTB4 by either CYP4F3A or alcohol dehydrogenase (49) , {omega}-oxidation itself does not inactivate LTB4, certainly with respect to chemotaxis (50) . CYP4F3A, the most efficient LTB4 hydroxylase, was discovered in neutrophils (51) and thought to be myeloid cell-restricted (7) . We now know CYP4F3A is the most abundant and highly regulated CYP4F in epidermal keratinocytes. These studies are the first to identify specific CYP4F gene products responsible for LTB4 hydroxylation reported in human epidermal cells by Mukhtar and colleagues (19) . Further, they explain why Wheelan and colleagues failed to detect 20-OH-LTB4 in human keratinocytes but rather LTB4 glutathione conjugates and metabolites from the 12-hydroxyeicosanoid dehydrogenase pathway (52) . Mukhtar and colleagues used culture conditions that promote cellular differentiation and induce CYP4F expression and LTB4 hydroxylase activities. In fact, the majority of epidermal CYP4F transcripts are up-regulated by differentiation-specific factors, corroborating the recent localization of CYP4F8 and CYP4F12 to the outer, differentiated layers of human skin (21 , 22) .

Retinoid-inducible CYP4F2 expression was first studied in hepatic and myeloid cells (30 , 53) . Recently, CYP4F8 was detected at higher levels in retinoic acid-treated human skin (23) . We show retinoid ligands up-regulate several CYP4F transcripts in keratinocytes, and we present the first mechanistic evidence that pharmacological retinoic acid exposure promotes preferentially binding interactions between RXR (presumably -{alpha}/-β isoforms) and the proximal CYP4F2 promoter in human epidermal cells. Gel shift assays also implicate RAR binding interactions, presumably RAR-RXR heterodimers. If RXR heterodimers mediate retinoid-inducible CYP4F transcription in vivo, other heterodimeric partners must be considered as well (e.g., thyroid hormone nuclear receptors) (54) . Several CYP4F genes may be subject to RXR-mediated transcriptional activation, in keratinocytes and in other epithelial cells, since RXR-{alpha} has been implicated in retinoid-induced CYP4F2 transcription in hepatic HepG2 cells (53) . Other evidences point to RXR as the critical transcription factor. First, retinoic acid exposure modulated RXR but not RAR mRNA levels in keratinocytes. Second, the RXR-selective ligands 9-cis-retinoic acid and LG268 induced greater CYP4F mRNA levels than all trans-retinoic acid. The dominance of RXR-{alpha} and RAR-{gamma} isoforms in human epidermis and derived cell cultures is concordant with other human skin studies (36) , indicating the in vitro differentiation system is useful and physiologically relevant.

It seems contradictory that retinoic acid up-regulates CYP4F genes, since this epithelial morphogen inhibits other CYPs also expressed preferentially in differentiating keratinocytes (e.g., CYP2C18, 2C19, 2C9, 2W1, 3A4, 4B1) (17) . Presently, no information is available on whether endogenous retinoid ligands regulate CYP4F genes. Inferences from pharmacological studies are tenuous because 9-cis-retinoic acid isomerizes to all trans-retinoic acid (36) and because retinoid exposure induces retinoid-metabolizing CYPs and other enzymes that modulate the cellular levels and molecular entities of biologically active retinoids (37 , 55 , 56) . The physiological relevance of 9-cis-retinoic acid remains controversial, and other eicosanoid or fatty acid ligands might activate RXR in vivo (37) .

Mutations in two human genes provide compelling evidence that normal epidermal barrier function requires CYP4F catalysis to inactivate eicosanoids arising from the 5-lipoxygenase/LTB4 pathway and the 12(R)-lipoxygenase/hepoxilin pathway (57 , 58) . First, mutations in ALDH3A2 in Sjogren-Larsson syndrome are responsible for a spectrum of mild to serious neural and cutaneous defects (10) . The fatty aldehyde dehydrogenase encoded by ALDH3A2 converts the LTB4 aldehyde intermediate to 20-COOH LTB4, a catalytic step also attributed to CYP4F leukotriene hydroxylases. Phenotypes of Sjogren-Larsson patients demonstrate the importance of efficient leukotriene inactivation. Second, type 3 lamellar ichthyosis patients have mutations in CYP4F22 (59) . Since CYP4F2 and CYP4F3B can hydroxylate long-chain and very-long chain fatty acids (25) , these genetic studies raise the question whether one or more CYP4F enzymes are required to catalyze {omega}-hydroxylation of very long chain fatty acids that are critical structural components of the cornified cell envelope in keratinizing epithelia.

Recent studies also implicate CYP4F enzymes in biosynthesis of the novel proresolving lipid resolvin ReV1 (5S,12R,18R-trihydroxy eicosapentaenoic acid). The proposed biosynthetic pathway generating ReV1 from eicosapentaenoic acid (C20:5n-3) involves an unidentified cytochrome P450 (1 , 4 , 5 , 60 61 62) . In vitro studies now establish that CYP4F8 and 4F12 catalyze {omega}3-hydroxylation and (or) epoxidation of long-chain fatty acids (C20:4n-6, 22:5n-3, and 22:6n-3) (24) . These results are important because they imply CYP4F enzymes may be responsible for generating ReV1 intermediates in humans (18R-hydroxy and 5,6-epoxy-18R-hydroxy eicosapentaenoic acid).

In addition to being the most common target affected by inflammation (4) , skin provides physiologically relevant and facile models for further studies to elucidate pathways regulating the synthesis and disposition of immunomodulating eicosanoids. Genetic studies now show linkage between CYP4F2 and CYP4F3A gene variants and celiac disease, a chronic inflammatory disorder of the gastrointestinal tract (63) . We surmise that induction of CYP4F enzymes may be a general mechanism of how diverse epithelial cells influence the course of inflammatory disease and recovery from environmentally induced cell damage.


   ACKNOWLEDGMENTS
 
We thank Dr. Lloyd E. King Jr. for guidance and critical comments. This work was supported in part by National Institutes of Health (NIH) R01 MH070054 and R01 NS044174, U.S. Department of the Army T5 0004268 for Texas Training and Technology against Trauma and Terrorism (H.W.S.), NIH K24-CA86815 (M.D.), NIH R01 AR45603 and AR47357 and resources in the Department of Veterans Affairs (D.S.K.) and President’s Research Scholarship (A.K.). We thank Dr. Reddy P. Kommaddi and Dr. Sayeepriyadarshini Anakk for technical assistance.

Received for publication June 15, 2007. Accepted for publication August 16, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gilroy, D. W., Lawrence, T., Perretti, M., Rossi, A. G. (2004) Inflammatory resolution: new opportunities for drug discovery. Nat. Rev. Drug Discov. 3,401-416[CrossRef][Medline]
  2. Smith, K. J., Skelton, H. (2002) Arachidonic acid-derived bioactive lipids: their role and the role for their inhibitors in dermatology. J. Cutan. Med. Surg. 6,241-256[Medline]
  3. Peters-Golden, M., Canetti, C., Mancuso, P., Coffey, M. J. (2005) Leukotrienes: underappreciated mediators of innate immune responses. J. Immunol. 174,589-594[Abstract/Free Full Text]
  4. Nathan, C. (2002) Points of control in inflammation. Nature 420,846-852[CrossRef][Medline]
  5. Levy, B. D., Clish, C. B., Schmidt, B., Gronert, K., Serhan, C. N. (2001) Lipid mediator class switching during acute inflammation: signals in resolution. Nat. Immunol. 2,612-619[CrossRef][Medline]
  6. Kalsotra, A., Strobel, H. W. (2006) Cytochrome P450 4F subfamily: At the crossroads of eicosanoid and drug metabolism. Pharmacol. Ther. 112,589-611[CrossRef][Medline]
  7. Kikuta, Y., Kusunose, E., Kusunose, M. (2002) Prostaglandin and leukotriene omega-hydroxylases. Prostag. Other Lipid Mediat. 68–69,345-362
  8. Cui, X., Kalsotra, A., Robida, A. M., Matzilevich, D., Moore, A. N., Boehme, C. L., Morgan, E. T., Dash, P. K., Strobel, H. W. (2003) Expression of cytochromes P450 4F4 and 4F5 in infection and injury models of inflammation. Biochim. Biophys. Acta 1619,325-331[Medline]
  9. Kalsotra, A., Cui, X., Antonovic, L., Robida, A. M., Morgan, E. T., Strobel, H. W. (2003) Inflammatory prompts produce isoform-specific changes in the expression of leukotriene B(4) omega-hydroxylases in rat liver and kidney. FEBS Lett. 555,236-242[CrossRef][Medline]
  10. Rizzo, W. B., Carney, G. (2005) Sjogren-Larsson syndrome: diversity of mutations and polymorphisms in the fatty aldehyde dehydrogenase gene (ALDH3A2). Hum. Mutat. 26,1-10[CrossRef][Medline]
  11. Salmon, J. K., Armstrong, C. A., Ansel, J. C. (1994) The skin as an immune organ. West. J. Med. 160,146-152[Medline]
  12. Barker, J. N., Mitra, R. S., Griffiths, C. E., Dixit, V. M., Nickoloff, B. J. (1991) Keratinocytes as initiators of inflammation. Lancet 337,211-214[CrossRef][Medline]
  13. Kupper, T. S. (1990) Immune and inflammatory processes in cutaneous tissues. Mechanisms and speculations. J. Clin. Invest. 86,1783-1789[Medline]
  14. Kupper, T. S., Fuhlbrigge, R. C. (2004) Immune surveillance in the skin: mechanisms and clinical consequences. Nat. Rev. Immunol. 4,211-222[CrossRef][Medline]
  15. Steinhoff, M., Brzoska, T., Luger, T. A. (2001) Keratinocytes in epidermal immune responses. Curr. Opin. Allergy Clin. Immunol. 1,469-476[CrossRef][Medline]
  16. Ahmad, N., Mukhtar, H. (2004) Cytochrome P450: a target for drug development for skin diseases. J. Invest. Dermatol. 123,417-425[CrossRef][Medline]
  17. Du, L., Neis, M. M., Ladd, P. A., Keeney, D. S. (2006) Differentiation-specific factors modulate epidermal CYP1–4 gene expression in human skin in response to retinoic acid and classical aryl hydrocarbon receptor ligands. J. Pharmacol. Exp. Ther. 319,1162-1171[Abstract/Free Full Text]
  18. Merk, H. F., Abel, J., Baron, J. M., Krutmann, J. (2004) Molecular pathways in dermatotoxicology. Toxicol. Appl. Pharmacol. 195,267-277[CrossRef][Medline]
  19. Mukhtar, H., Bik, D. P., Ruzicka, T., Merk, H. F., Bickers, D. R. (1989) Cytochrome P-450-dependent omega-oxidation of leukotriene B4 in rodent and human epidermis. J. Invest. Dermatol. 93,231-235[CrossRef][Medline]
  20. Nelson, D. R., Zeldin, D. C., Hoffman, S. M. G., Maltais, L. J., Wain, H. M., Nebert, D. W. (2004) Comparison of cytochrome P450 (CYP) genes from the mouse and human genomes, including nomenclature recommendations for genes, pseudogenes and alternative-splice variants. Pharmacogenetics 14,1-18[CrossRef][Medline]
  21. Stark, K., Schauer, L., Sahlen, G. E., Ronquist, G., Oliw, E. H. (2004) Expression of CYP4F12 in gastrointestinal and urogenital epithelia. Basic Clin. Pharmacol. Toxicol. 94,177-183[Medline]
  22. Stark, K., Torma, H., Cristea, M., Oliw, E. H. (2003) Expression of CYP4F8 (prostaglandin H 19-hydroxylase) in human epithelia and prominent induction in epidermis of psoriatic lesions. Arch. Biochem. Biophys. 409,188-196[CrossRef][Medline]
  23. Stark, K., Torma, H., Oliw, E. H. (2006) Co-localization of COX-2, CYP4F8, and mPGES-1 in epidermis with prominent expression of CYP4F8 mRNA in psoriatic lesions. Prostag. Other Lipid Mediat. 79,114-125[CrossRef]
  24. Stark, K., Wongsud, B., Burman, R., Oliw, E. H. (2005) Oxygenation of polyunsaturated long chain fatty acids by recombinant CYP4F8 and CYP4F12 and catalytic importance of Tyr-125 and Gly-328 of CYP4F8. Arch. Biochem. Biophys. 441,174-181[CrossRef][Medline]
  25. Sanders, R. J., Ofman, R., Duran, M., Kemp, S., Wanders, R. J. (2006) Omega-oxidation of very long-chain fatty acids in human liver microsomes. Implications for X-linked adrenoleukodystrophy. J. Biol. Chem. 281,13180-13187[Abstract/Free Full Text]
  26. Le Quere, V., Plee-Gautier, E., Potin, P., Madec, S., Salaun, J. P. (2004) Human CYP4F3s are the main catalysts in the oxidation of fatty acid epoxides. J. Lipid Res. 45,1446-1458[Abstract/Free Full Text]
  27. Sontag, T. J., Parker, R. S. (2002) Cytochrome P450 omega-hydroxylase pathway of tocopherol catabolism. Novel mechanism of regulation of vitamin E status. J. Biol. Chem. 277,25290-25296[Abstract/Free Full Text]
  28. Xu, F., Ng, V. Y., Kroetz, D. L., de Montellano, P. R. (2006) CYP4 isoform specificity in the omega-hydroxylation of phytanic acid, a potential route to elimination of the causative agent of Refsum’s disease. J. Pharmacol. Exp. Ther. 318,835-839[Abstract/Free Full Text]
  29. Du, L., Neis, M. M., Ladd, P. A., Lanza, D. L., Yost, G. S., Keeney, D. S. (2006) Effects of the differentiated keratinocyte phenotype on expression levels of CYP1–4 family genes in human skin cells. Toxicol. Appl. Pharmacol. 213,135-144[CrossRef][Medline]
  30. Kikuta, Y., Yamashita, Y., Kashiwagi, S., Tani, K., Okada, K., Nakata, K. (2004) Expression and induction of CYP4F subfamily in human leukocytes and HL60 cells. Biochim. Biophys. Acta 1683,7-15[Medline]
  31. Du, L., Yermalitsky, V., Hachey, D. L., Jagadeesh, S. G., Falck, J. R., Keeney, D. S. (2006) A biosynthetic pathway generating 12-hydroxy-5,8,14-eicosatrienoic acid from arachidonic acid is active in mouse skin microsomes. J. Pharmacol. Exp. Ther. 316,371-379[Abstract/Free Full Text]
  32. Kalsotra, A., Turman, C. M., Kikuta, Y., Strobel, H. W. (2004) Expression and characterization of human cytochrome P450 4F11: Putative role in the metabolism of therapeutic drugs and eicosanoids. Toxicol. Appl. Pharmacol. 199,295-304[CrossRef][Medline]
  33. Ladd, P. A., Du, L., Capdevila, J. H., Mernaugh, R., Keeney, D. S. (2003) Epoxyeicosatrienoic acids activate transglutaminases in situ and induce cornification of epidermal keratinocytes. J. Biol. Chem. 278,35184-35192[Abstract/Free Full Text]
  34. Heinemeyer, T., Wingender, E., Reuter, I., Hermjakob, H., Kel, A. E., Kel, O. V., Ignatieva, E. V., Ananko, E. A., Podkolodnaya, O. A., Kolpakov, F. A., Podkolodny, N. L., Kolchanov, N. A. (1998) Databases on transcriptional regulation: TRANSFAC, TRRD, and COMPEL. Nucleic Acids Res. 26,362-367[Abstract/Free Full Text]
  35. Honkakoski, P., Negishi, M. (2000) Regulation of cytochrome P450 (CYP) genes by nuclear receptors. Biochem. J. 347,321-337[CrossRef][Medline]
  36. Fisher, G. J., Voorhees, J. J. (1996) Molecular mechanisms of retinoid actions in skin. FASEB J. 10,1002-1013[Abstract]
  37. Blomhoff, R., Blomhoff, H. K. (2006) Overview of retinoid metabolism and function. J. Neurobiol. 66,606-630[CrossRef][Medline]
  38. Duvic, M., Nagpal, S., Asano, A. T., Chandraratna, R. A. (1997) Molecular mechanisms of tazarotene action in psoriasis. J. Am. Acad. Dermatol. 37,S18-24[Medline]
  39. Thacher, S. M., Vasudevan, J., Chandraratna, R. A. (2000) Therapeutic applications for ligands of retinoid receptors. Curr. Pharm. Des. 6,25-58[CrossRef][Medline]
  40. Winterfield, L., Cather, J., Cather, J., Menter, A. (2003) Changing paradigms in dermatology: nuclear hormone receptors. Clin. Dermatol. 21,447-454[CrossRef][Medline]
  41. Zouboulis, C. C. (2001) Retinoids—which dermatological indications will benefit in the near future?. Skin. Pharmacol. Appl. Skin. Physiol. 14,303-315[CrossRef][Medline]
  42. Kalsotra, A., Zhao, J., Anakk, S., Dash, P. K., Strobel, H. W. (2007) Brain trauma leads to enhanced lung inflammation and injury: evidence for role of P4504Fs in resolution. J. Cereb. Blood. Flow. Metab. 27,963-974[Medline]
  43. Kalsotra, A., Anakk, S., Brommer, C. L., Kikuta, Y., Morgan, E. T., Strobel, H. W. (2007) Catalytic characterization and cytokine mediated regulation of cytochrome P450 4Fs in rat hepatocytes. Arch. Biochem. Biophys. 461,104-112[CrossRef][Medline]
  44. Berry, K. A., Borgeat, P., Gosselin, J., Flamand, L., Murphy, R. C. (2003) Urinary metabolites of leukotriene B4 in the human subject. J. Biol. Chem. 278,24449-24460[Abstract/Free Full Text]
  45. Wheelan, P., Hankin, J. A., Bilir, B., Guenette, D., Murphy, R. C. (1999) Metabolic transformations of leukotriene B4 in primary cultures of human hepatocytes. J. Pharmacol. Exp. Ther. 288,326-334[Abstract/Free Full Text]
  46. Yokomizo, T., Izumi, T., Shimizu, T. (2001) Leukotriene B4: metabolism and signal transduction. Arch. Biochem. Biophys. 385,231-241[CrossRef][Medline]
  47. Wang, S., Gustafson, E., Pang, L., Qiao, X., Behan, J., Maguire, M., Bayne, M., Laz, T. (2000) A novel hepatointestinal leukotriene B4 receptor. Cloning and functional characterization. J. Biol. Chem. 275,40686-40694[Abstract/Free Full Text]
  48. Yokomizo, T., Kato, K., Hagiya, H., Izumi, T., Shimizu, T. (2001) Hydroxyeicosanoids bind to and activate the low affinity leukotriene B4 receptor, BLT2. J. Biol. Chem. 276,12454-12459[Abstract/Free Full Text]
  49. Soberman, R. J., Sutyak, J. P., Okita, R. T., Wendelborn, D. F., Roberts, L. J., 2nd, Austen, K. F. (1988) The identification and formation of 20-aldehyde leukotriene B4. J. Biol. Chem. 263,7996-8002[Abstract/Free Full Text]
  50. Murphy, R. C., Gijon, M. A. (2007) Biosynthesis and metabolism of leukotrienes. Biochem. J. 405,379-395[CrossRef][Medline]
  51. Christmas, P., Jones, J. P., Patten, C. J., Rock, D. A., Zheng, Y., Cheng, S. M., Weber, B. M., Carlesso, N., Scadden, D. T., Rettie, A. E., Soberman, R. J. (2001) Alternative splicing determines the function of CYP4F3 by switching substrate specificity. J. Biol. Chem. 276,38166-38172[Abstract/Free Full Text]
  52. Wheelan, P., Zirrolli, J. A., Morelli, J. G., Murphy, R. C. (1993) Metabolism of leukotriene B4 by cultured human keratinocytes. Formation of glutathione conjugates and dihydro metabolites. J. Biol. Chem. 268,25439-25448[Abstract/Free Full Text]
  53. Zhang, X., Hardwick, J. P. (2000) Regulation of CYP4F2 leukotriene B4 omega-hydroxylase by retinoic acids in HepG2 cells. Biochem. Biophys. Res. Commun. 279,864-871[CrossRef][Medline]
  54. Quack, M., Frank, C., Carlberg, C. (2002) Differential nuclear receptor signalling from DR4-type response elements. J. Cell. Biochem. 86,601-612[CrossRef][Medline]
  55. Baron, J. M., Heise, R., Blaner, W. S., Neis, M., Joussen, S., Dreuw, A., Marquardt, Y., Saurat, J. H., Merk, H. F., Bickers, D. R., Jugert, F. K. (2005) Retinoic acid and its 4-oxo metabolites are functionally active in human skin cells in vitro. J. Invest. Dermatol. 125,143-153[CrossRef][Medline]
  56. Heise, R., Mey, J., Neis, M. M., Marquardt, Y., Joussen, S., Ott, H., Wiederholt, T., Kurschat, P., Megahed, M., Bickers, D. R., Merk, H. F., Baron, J. M. (2006) Skin retinoid concentrations are modulated by CYP26AI expression restricted to basal keratinocytes in normal human skin and differentiated 3D skin models. J. Invest. Dermatol. 126,2473-2480[CrossRef][Medline]
  57. Fogh, K., Kragballe, K. (2000) Eicosanoids in inflammatory skin diseases. Prostag. Other Lipid Mediat. 63,43-54[CrossRef]
  58. Nigam, S., Zafiriou, M. P. (2005) Hepoxilin A3 synthase. Biochem. Biophys. Res. Commun. 338,161-168[CrossRef][Medline]
  59. Lefevre, C., Bouadjar, B., Ferrand, V., Tadini, G., Megarbane, A., Lathrop, M., Prud’homme, J. F., Fischer, J. (2006) Mutations in a new cytochrome P450 gene in lamellar ichthyosis type 3. Hum. Mol. Genet. 15,767-776[Abstract/Free Full Text]
  60. Arita, M., Clish, C. B., Serhan, C. N. (2005) The contributions of aspirin and microbial oxygenase to the biosynthesis of anti-inflammatory resolvins: novel oxygenase products from omega-3 polyunsaturated fatty acids. Biochem. Biophys. Res. Commun. 338,149-157[CrossRef][Medline]
  61. Arita, M., Bianchini, F., Aliberti, J., Sher, A., Chiang, N., Hong, S., Yang, R., Petasis, N. A., Serhan, C. N. (2005) Stereochemical assignment, antiinflammatory properties, and receptor for the omega-3 lipid mediator resolvin E1. J. Exp. Med. 201,713-722[Abstract/Free Full Text]
  62. Serhan, C. N., Clish, C. B., Brannon, J., Colgan, S. P., Chiang, N., Gronert, K. (2000) Novel functional sets of lipid-derived mediators with antiinflammatory actions generated from omega-3 fatty acids via cyclooxygenase 2-nonsteroidal antiinflammatory drugs and transcellular processing. J. Exp. Med. 192,1197-1204[Abstract/Free Full Text]
  63. Curley, C. R., Monsuur, A. J., Wapenaar, M. C., Rioux, J. D., Wijmenga, C. (2006) A functional candidate screen for coeliac disease genes. Eur. J. Hum. Genet. 14,1215-1222[CrossRef][Medline]
  64. Talas, U., Dunlop, J., Khalaf, S., Leigh, I. M., Kelsell, D. P. (2000) Human elastase 1: evidence for expression in the skin and the identification of a frequent frameshift polymorphism. J. Invest. Dermatol. 114,165-170[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
fj.07-9244comv1
22/2/538    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kalsotra, A.
Right arrow Articles by Strobel, H. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kalsotra, A.
Right arrow Articles by Strobel, H. W.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS