| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,1
* Department of Physiology,
Department of Biochemistry,
Division of Cancer Biology and Genetics, Cancer Research Institute, and
Department of Anatomy and Cell Biology, Queen’s University, Kingston, Ontario, Canada;
|| Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Tokyo, Tokyo, Japan;
¶ Precursory Research for Embryonic Science and Technology (PRESTO), Japan Science and Technology Agency, Tokyo, Japan; and
# Department of Cellular Neurobiology, Brain Research Institute, Niigata University, Niigata City, Japan
1Correspondence: Department of Physiology, 433 Botterell Hall, Stuart St., Queen’s University, Kingston, ON K7L 3N6, Canada. E-mail: funkc{at}queensu.ca
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: inflammation • intravital microscopy • transgenic mice • caveolae
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. The local increase in microvascular permeability due to disruption of endothelial integrity after surgery can contribute to death by multiple organ dysfunction syndrome (2)
. Chronic inflammation that causes protracted vascular hyperpermeability and consequent plasma leakage may be responsible for some of the pathophysiological sequelae in atherosclerosis, arthritis, asthma, and proliferative vitreoretinopathy (3)
.
Cysteinyl leukotrienes (CysLTs) are among the most active known inflammatory mediators (4)
. The key enzyme for the synthesis of leukotrienes is 5-lipoxygenase (5-LO), which in combination with the 5-LO-activating protein (FLAP) transforms arachidonic acid into leukotriene A4, which is further modified by leukotriene C4 synthase (LTC4S) to leukotriene (LT) C4. LTC4 can be further metabolized to LTD4 and LTE4. CysLTs bind to 3 different receptors of the G protein-coupled receptor superfamily: cysteinyl leukotriene receptor subtype 1 (CysLT1R), cysteinyl leukotriene receptor subtype 2 (CysLT2R), and the recently characterized GPR17 (4
, 5)
. The distinct expression patterns of the receptors reveal that they are likely to play separate functions and perhaps be implicated in different aspects of the inflammatory response and cardiovascular disease. There has been recent widespread, heightened interest in the 5-LO/leukotriene pathway with respect to cardiovascular inflammation in atherosclerosis, myocardial infarction, and stroke (6
7
8
9)
. Whereas CysLT1R has been studied in great detail in relation to asthma and other inflammatory disorders (6)
, our knowledge of CysLT2R functions is still rather limited, which is in part due to the lack of a specific receptor antagonist.
Recent data from our laboratory and others have implicated CysLT2R in vascular inflammatory and permeability events in response to leukotriene administration in acute inflammation and in myocardial ischemia/reperfusion injury (10
11
12)
. These studies were carried out with CysLT2R deficient mice (12)
, as well as with mice overexpressing human CysLT2R in vascular endothelium (10)
, a site where CysLT2R expression has been observed (11
, 13)
. However, much remains to be learned about the mechanism of these events.
The semipermeable characteristic of the endothelium is crucial for establishing the transendothelial protein gradient (the colloid osmotic gradient) that is required for tissue fluid homeostasis (14)
. Disruption of the endothelial cell barrier results in increased permeability and vascular leak, and endothelial cells are able to dynamically regulate so-called paracellular and transcellular pathways for transport of plasma proteins, solutes, and liquid (14)
. Interendothelial junctions consist of a complex array of proteins in series with extracellular matrix constituents that serve to limit the transport of albumin and other plasma proteins by paracellular mechanisms. Transcellular regulation can take place at the level of caveolae, the vesicular carriers filled with receptor-bound and unbound free solutes, or via transendothelial channels, fluid phase vesicle, and receptor-mediated transport. Here, we have studied the vascular bed-specific expression pattern of CysLT2R using a novel CysLT2R knockout mouse strain in which the reporter LacZ gene has been integrated, as well as the impact of CysLT2R stimulation on the mechanism of vascular permeability using intravital microscopy.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. These mice express 7 copies of the human CysLT2R coding region under control of the Tie2 promoter/enhancer, integrated in a gene-sparse region of chromosome 6. Hemizygous mice were continuously backcrossed with C57BL/6 mice to obtain equal numbers of transgenic (TG) and wild-type (WT) littermates. CysLT2R deficient-LacZ mice (KO) were generated by standard gene targeting procedures using C57BL/6 embryonic stem cells (unpublished results). Embryos heterozygous for the genetic modification were transferred from Japan and revived at Queen’s University. Littermates of heterozygous offspring (all on a C57BL/6 genetic background) were used in these studies. Sequencing of the Cysltr2 gene verified that the LacZ coding region was in frame with the start codon of a truncated CysLT2R open-reading frame that yields a genetic Cysltr2 disruption and allows use of X-Gal staining as a reporter for native sites of CysLT2R expression.
Investigation of CysLT2R expression using the reporter LacZ
Tissues were dissected and fixed in 2% paraformaldehyde/0.2% glutaraldehyde on ice for 30 min. LacZ staining was carried out overnight at 37°C in phosphate-buffered saline (PBS) containing 2 mM MgCl2, 5 mM potassium ferrocyanide trihydrate, 5 mM potassium ferricyanide crystalline, 1 mg/ml X-Gal, and 2.5% dimethyl sulfoxide (DMSO).
Experimental intravital microscopy procedures
Mice were anesthetized with ketamine (150 mg/kg) and xylazine (10 mg/kg), and a catheter was placed in the right jugular vein. The cremaster muscle covering the right testicle was prepared as described in detail elsewhere (15)
. For Ca2+ signaling-related experiments, the cremaster muscle was superfused with Ca2+-free PBS. Microscopic evaluation of postcapillary venules (
17 µm diameter) was recorded throughout the experiment on S-VHS video tape for subsequent data analysis. Initially, bright field images were recorded for 5 min, and blood velocity in the vessel was measured. Fluorescein isothiocyanate (FITC) -labeled albumin (25 mg/kg body weight) was injected via the catheter, and fluorescence in the preparation was recorded for at least 5 min. CysLTs (LTC4 and LTD4, both at 5 µM) or BAY-u9773 (1 µM) were administered to the superfused vessel. After 5 min, a second treatment with CysLTs or BAY-u9773 was carried out, followed by recording for at least 5 min.
The vessel diameter and blood velocity were measured for each experiment prior to and after treatments but were not modified by any of the different experimental parameters.
To block Ca2+ signaling, we added the acetoxymethyl form of the Ca2+-chelator BAPTA (BAPTA-AM; 10 µM) (16)
to the suffusion medium and preincubated the cremaster muscle for 15 min before injecting FITC-labeled albumin and prior to CysLT stimulation. In separate experiments, thapsigargin (30 µM final concentration), an inhibitor of the sarco/endoplasmic reticulum Ca2+-ATPase (SERCA), was applied to discharge intracellular Ca2+ stores to generate a steady Ca2+ signal (17
, 18)
.
To block caveolae/lipid rafts and thereby transcellular vesicle transport, 20 mM methyl-beta-cyclodextrin (MBCD) was added to the suffusate. The cremaster muscle was preincubated for 15 min, followed by CysLT and BAY-u9773 treatment, as described above.
Quantification of vascular permeability
To quantify vascular permeability of postcapillary venules in the cremaster muscle, digital images were stored every 20 s throughout fluorescence recording. The mean fluorescence intensity for each image was measured (gray level range from 0 (black) to 255 (white)).
We calculated a linear function f(x) = mx + n describing the change in fluorescence intensity m over time x for every stage of the experiment (pretreatment and posttreatment). The parameter LIFT (leakage intensity factor for tissues) was calculated as the first equation of this linear function. This LIFT parameter describes the slope of a linear function representing the changes in fluorescence intensity in the tissue over time and is therefore a measure for vascular permeability.
Quantification of FITC-albumin accumulation sites
Sites of FITC-labeled albumin accumulation were initially recorded with a SonyDXC-390m3 CCD color video camera (Sony, Tokyo, Japan). Subsequently, we used a digital camera (ORCA-ER C4742-80-12AG, Hamamatsu Photonics K.K., Hamamatsu City, Japan) to determine the number of accumulating sites at greater resolution and sensitivity. Sites of accumulation of FITC-labeled albumin were determined based on the histogram of the entire image and were counted with Image Pro software (Media Cybernetics, Bethesda, MD, USA).
To allay concern that FITC-labeled albumin accumulation within cells (see Results) does not influence vascular permeability measurements that are based on total brightness of the recorded images, we modeled the effect by using a total black picture (gray level 0) on which 15 white spots (gray level 255 U) sized at 100 pixels were added to represent FITC-albumin accumulation. The change in total brightness (0.28 U) represented by this procedure is comparable to a 12 s measurement from unstimulated WT cremaster muscle preparations. To exaggerate this process we marked the periphery of a typical venule outline white, which caused a brightness change (1.36 U) that resembles only 11 s of recorded leakage from CysLT-stimulated WT preparations. Since the permeability measurements and LIFT parameter were calculated based on a 5 min observation, the contribution of FITC-albumin accumulation sites to LIFT represents less than 3.6% and was therefore regarded as negligible.
Confocal microscopy
Cremaster muscles were collected after intravital microscopy experiments and immediately fixed in 2% paraformaldehyde/0.2% glutaraldehyde on ice for 30 min. The tissue was embedded in Tissue-Tek (Sakura Finetek, Torrance, CA, USA). Cryosections (10 µm) were cut and labeled with pan-endothelial cell antigen antibody MECA-32 (BD Pharmingen, San Diego, CA) and Texas Red conjugated goat anti-rat immunoglobulin G (IgG). Sections were examined using a Leica TCS SP2 multi photon confocal laser scanning microscope (Leica Microsystems, Wetzlar, Germany).
Electron microscopy
For electron microscopic examination of transcytotic vesicles in blood vessels of the cremaster muscle, we followed intravital microscopy procedures as described above. The cremaster muscle was excised and fixed immediately by immersion in 2.5% glutaraldehyde in 0.1 M cacodylate buffer, pH 7.4. After 2 h at 4°C, the tissue samples were washed 3 times with PBS and then trimmed into small pieces for Epon embedding (Epon 812), as described previously (19)
. One-micrometer-thick sections were first examined by light microscopy in order to locate the area of interest, after which Epon thin sections were cut with a diamond knife on a LKB ultramicrotome and mounted on copper grids. After counterstaining with uranyl acetate and lead citrate solutions, the sections were examined on a Hitachi 7000 electron microscope operated at 75 kV. In randomly taken pictures of postcapillary venules, the area of endothelial cells was measured and the vesicles inside were counted.
Cell culture
Murine b-end.3 endothelial cells were kindly provided by Dr. Yves St. Pierre (University of Quebec, Quebec, QC, Canada). Cells were tested for CysLT1R (CAGGAGCCCTGTGAATGGAG, GTGGCCACTGTTCTTATGTTG) and CysLT2R (CGTTCACCAGAAGCAGGGC, CTGAGTGTGGTGCGTTTCCTG) expression by polymerase chain reaction. Cells were subsequently transfected with pcDNA3-huCysLT2R vector (13)
and selected with Geneticin (Invitrogen, Carlsbad, CA, USA) to generate stable huCysLT2R overexpressing cells. Prior to experiments, cells were incubated for 5 min in PBS, followed by addition of FITC-albumin (1.33 µg/ml in PBS), LTC4/LTD4 (5 µM in FITC-albumin/PBS), or BAY-u9773 (1 µM in FITC-albumin/PBS). Cells were washed with PBS and fixed in 2% paraformaldehyde/0.2% glutaraldehyde and examined by fluorescence microscopy.
Statistical analysis
For each experimental group, the mean and SE were calculated. To compare groups, we performed 2-sided t tests for independent samples. P < 0.05 was considered a statistically significant difference.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and data not shown). However, in organs including the bladder, brain/spinal cord, skin, ear, and the cremaster muscle surrounding the testis, strong staining in small vessels was evident, whereas the larger blood vessels were negative (Fig. 1
). Section analysis revealed staining in the microvasculature within endothelial cells. These results indicate that CysLT2R expression in the vasculature occurs within the endothelium and is dependent on the organ and vessel size.
|
Intravital microscopy to assess role of CysLT2R in vascular permeability
We have recently shown that CysLTs evoke CysLT2R-mediated vascular permeability responses in the ear and in the heart after ischemia/reperfusion injury of TG mice that overexpress human CysLT2R in vascular endothelium (10
, 11)
. To visualize this process and to assess the importance of endogenous CysLT2R and CysLTs, we undertook an intravital microscopy study with KO mice as well as with TG and WT C57BL/6 mice using the well-established cremaster muscle preparation. We observed strong endogenous small-vessel CysLT2R expression (Fig. 1)
. Fluorescence intensity measurements in vascular preparations from WT and KO mice after administration of FITC-labeled albumin revealed a stable pattern, indicating minimal vascular permeability (Figs. 2
and 3
) that did not change within 20 min in control experiments. Superfusion of the tissue with CysLTs (5 µM each LTC4/LTD4) evoked a strong and rapid increase in vascular permeability over 5–15 min, as measured by increasing extravascular fluorescence intensity in WT mice. However, no effect was observed in KO mouse preparations (Figs. 2
and 3)
. In contrast, TG mice showed evidence, even without exogenous CysLT administration, of increased vascular permeability shortly after FITC-albumin injection, attaining greater than 50% the level observed in CysLT-stimulated WT mice (Figs. 2
and 3)
. The vessels visualized in these experiments had the same diameter range (WT, 16.9±4.4 µm, n=21; TG, 17.2±2.3 µm, n=22).
|
|
Vascular leakage of FITC-albumin by CysLTs could be quenched rapidly to a level where changes in fluorescence intensity are no longer detectable by application of the dual CysLT1R/CysLT2R antagonist BAY-u9773 (1 µM; Fig. 3
). This effect was observed in vascular preparations from TG and WT mice with and without preceding CysLT stimulation (Fig. 3)
. BAY-u9773 treatment, on the other hand, had no visible effect on vascular permeability as measured by fluorescence intensity in the vasculature of KO mice (Fig. 3)
.
In contrast to the high permeability observed in the right cremaster muscle vascular preparation of live TG mice, no signs of immediate vascular permeability (FITC-albumin leakage or FITC-albumin accumulating sites; see below) could be seen in the left cremaster muscle, which was prepared after euthanization to eliminate blood flow- or blood pressure-related effects. This suggests that one possibility for the observed strong vascular permeability response in TG mice in the absence of exogenous ligands was caused by endogenous CysLTs released during the initial surgical intervention interacting with enhanced numbers of CysLT2R in the endothelium.
CysLT2R challenge with BAY-u9773 subsequent to vascular permeability elevation leads to endothelial cell accumulation of FITC-albumin
Besides the obvious vascular leakage of FITC-albumin into the extravascular tissue of TG and WT mice, there was evidence for distinct FITC-albumin accumulating bright fluorescent sites (Figs. 2
and 4A
). These sites are most evident where the leakage of FITC-albumin into the surrounding tissue was initiated and can be used as a marker for number of leakage sites (20)
. The number of these bright fluorescent sites per unit area was significantly higher in vascular preparations from TG mice compared to WT mice in the absence of exogenous CysLT administration (Fig. 2
and data not shown). CysLT stimulation evoked not only an increase in vascular leakage in WT mice (Figs. 3
and 5
), but also caused a significant increase in the number of these bright accumulation sites. Challenge with BAY-u9773 led to a further significantly increased number of FITC-albumin accumulation sites in both WT and TG mice. These sites are localized in distinct regions on the inner vessel wall, where they can cover almost the whole vessel after BAY-u9773 treatment, as shown in Fig. 4A
. The location and pattern of the FITC-albumin bright sites implies that endothelial cells after CysLT2R stimulation initiate vascular permeability by a transcellular pathway rather than at interendothelial gap junctions. These results also indicate that CysLT2R challenge with BAY-u9773 restores the barrier function of the endothelium by blocking exocytosis at the abluminal site of the endothelium which is shown by an increase in accumulation of albumin at sites of prior high vascular permeability (Fig. 5)
. This hypothesis is supported by the fact that when vascular preparations from WT and TG mice were first pretreated with BAY-u9773, followed by subsequent stimulation with CysLTs, there was a sudden increase in fluorescence intensity. Therefore, after CysLT treatment, stored fluorescent albumin within endothelial cells was suddenly released. This reaction was quite unique and could not be reproduced by CysLT treatment alone or by a second BAY-u9773 addition (data not shown).
|
|
Examining this in further detail, confocal laser scanning images revealed accumulation of FITC-albumin within endothelial cells (positive for the pan-endothelial cell marker Meca-32) of blood vessels after CysLT stimulation (Fig. 4B
), indicating transcellular transport. Moreover, electron microscopy analysis of CysLT- and BAY-u9773-treated postcapillary venules revealed a significantly increased number of vesicles inside the endothelium compared to unstimulated venules (Fig. 6
), suggesting an increase in vesicle formation and/or transport in response to CysLT stimulation.
|
To mimic the in vivo setting within endothelial cells of TG mice in a tissue culture model, b-end.3 mouse endothelial cells were permanently transfected with human CysLT2R (CysLT2R b-end.3) and tested for fluorescent albumin accumulation (Fig. 4C
). We determined that native endothelial cell line b-end.3 expresses neither CysLT1R nor CysLT2R, and these cells do not accumulate FITC-albumin even after stimulation with CysLTs or BAY-u9773. CysLT2R b-end.3 cells, on the other hand, showed a significant number of labeled-albumin accumulating cells after treatment with CysLTs or BAY-u9773. Together, these data indicate that CysLT2R modulation leads to endothelial cell albumin uptake.
CysLT2R-induced vascular permeability is mediated by Ca2+ signaling
CysLT2R stimulation in endothelial cells has been linked to oscillating calcium signals of unknown functional significance (21)
. The inhibition of intracellular Ca2+ signals by BAPTA prevented enhanced vascular permeability elicited by CysLT stimulation in WT cremaster muscle preparations (Fig. 5)
. This indicates that intracellular Ca2+ signals are essential for CysLT2R-regulated vascular permeability.
Thapsigargin causes the release of Ca2+ from intracellular stores by blocking SERCA, thereby creating a steady Ca2+ signal. However, in these experiments (Fig. 5)
, treatment with thapsigargin did not lead to an increase of vascular permeability, indicating that a steady Ca2+ signal is not sufficient to provoke vascular leakage. While thapsigargin did not elevate vascular permeability, its application led to an increased number of FITC-labeled albumin accumulation sites in the absence of CysLT administration. This signifies that thapsigargin may induce endothelial luminal endocytosis, but not abluminal exocytosis. The fact that BAPTA blocked vascular permeability but only marginally influenced the number of CysLT-stimulated FITC-albumin accumulation sites (Fig. 5)
reveals that the Ca2+-buffering capacity of BAPTA is important for setting weaker oscillating Ca2+ signals, as described previously in Xenopus melanotropes (22)
, which might influence exocytosis of labeled-albumin from the vascular endothelial cells into the extravascular space.
Blockade of caveolae and subsequent vesicle formation with MBCD attenuates transcytosis of albumin in response to CysLT stimulation
Caveolae are known to transport albumin and other plasma proteins across the endothelium, and it is at these sites that vesicles are derived for transcytosis (14)
. Inhibition of caveolae/lipid rafts by application of MBCD resulted in significantly decreased baseline vascular permeability (LIFT=0.002±0.002; n=8; P<0.01, +MBCD vs. –MBCD) and a significantly delayed response to CysLT stimulation (Fig. 7B
). The CysLT-induced increase of vascular permeability (LIFT=0.121±0.018; n=8) could not be inhibited by application of BAY-u9773 (LIFT=0.110±0.027; n=4), as observed in cremaster muscle preparations not treated with MBCD (Fig. 7A
; compare Fig. 3
). However, the bright fluorescent accumulation of albumin within endothelial cells was blocked by MBCD (Fig. 7C
). These results indicate that blockade of caveolae inhibits transcytosis but may activate a compensatory paracellular transport mechanism, as recognized in caveolin-1 null mice (23)
.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
and TG mice overexpressing human CysLT2R in vascular endothelium (10)
indicated a potential role for CysLT2R activation to increase vascular permeability. In the present study, we explored this facet in greater detail by means of intravital/confocal/electron microscopy imaging combined with a determination of vascular sites of CysLT2R expression. Our findings indicate an organ and blood vessel specificity of CysLT2R expression and that in cremaster muscle postcapillary venules, CysLT2R is the major leukotriene receptor subtype involved in the control of vascular permeability through a transcellular transport pathway. The fact that the permeability response in this vascular bed was absent in CysLT2R KO mice indicates that neither CysLT1R nor the newly discovered CysLT receptor known as GPR17 (5)
participate in this activity. These results reveal a key role for CysLT2R in vascular responses to injury, such as that observed after myocardial infarction/reperfusion, as we have reported recently (11)
.
In the cremaster muscle preparation, TG mice displayed enhanced vascular permeability without exogenous ligand administration, whereas in WT mice this could only be observed after stimulation with CysLTs. These observations suggest that TG mice would develop massive edema, which has not been observed previously. In ear inflammation models, either exogenous CysLT administration was required (direct model) or an induction of CysLT synthesis was necessary (passive cutaneous anaphylaxis model) (10)
. No signs of enhanced vascular permeability/FITC-albumin leakage or FITC-albumin accumulating leakage sites could be observed in the contralateral (left) cremaster muscle of WT or TG mice immediately after euthanization. This leads us to surmise that in TG mice the observed hyperpermeability vascular response might be due to the surgical intervention; presumably, low levels of CysLT are produced by resident tissue macrophages and/or mast cells during preparation of the cremaster muscle on the microscope stage. Because of the enhanced numbers of CysLT2R binding sites within the vascular endothelium of TG mice, they are likely more sensitive to CysLTs and therefore respond to endogenous CysLTs to a much greater degree than WT mice. An alternative, albeit less likely, interpretation is that the overexpressed CysLT2R is constitutively active in some vascular beds, although the ligand-independent activation of GPCRs and constitutive activity in vivo have been difficult to verify (24)
.
FITC-albumin extravasation from the venules is initiated and takes place at certain "hot spots" of fluorescence accumulation called "leaky sites" by Huang et al. (20)
. In our studies, these sites were observed in discrete regions throughout the endothelium. They have been observed by intravital microscopy in response to burns (20)
, platelet-activating factor/leukotriene B4 (25)
, and CysLTs (herein), but not in response to many other stimuli, such as histamine (26)
, tumor necrosis factor 
(27)
, and homocysteine (28)
. Electron microscopy observations of albumin extravasation have revealed that it is mediated mainly by transcellular vesicle transport (14
, 29
and Fig. 6
). Furthermore, pinocytotic vesicular transport appears to be a primary means by which luminal to abluminal transport occurs in response to bradykinin/LTC4 stimulation to enhance vascular permeability in certain vessels in rat brain (30)
. BAY-u9773, an antagonist of both CysLT1R and CysLT2R, functions at lower concentrations as a partial agonist of CysLT2R (31)
. In our study, BAY-u9773 superfusion of the tissue may elicit an initial stimulation of CysLT2R (transcellular vesicle transport mechanism initiation), followed by antagonist activity (FITC-albumin accumulation; Fig. 8
). In line with this reasoning, after inhibition of CysLT2R with BAY-u9773 followed by subsequent stimulation with CysLTs, a very strong, immediate abluminal release of FITC-albumin into the extravascular compartment is observed. Interestingly, the absence of FITC-albumin accumulation in the vessel wall of MBCD-pretreated vessels after CysLT stimulation (Fig. 7C
) further supports that blockade of caveolae, and subsequent vesicle formation attenuates CysLT-induced transcytosis and perhaps initiates a compensatory switch to paracellular transport, as has been described previously for caveolin-1 null mice (23)
. This point will have to be verified in future experiments.
|
Calcium signaling in acute vascular hyperpermeability responses (e.g., histamine) is well-recognized via Ca2+-calmodulin initiation of a cascade leading to contraction of endothelial cells and opening of intercellular junctions (14)
. Prolonged signaling (e.g., thrombin) generates similar cellular events, as well as protein tyrosine phosphorylation and RhoA activation (32)
. Ca2+ signaling in transcellular vesicle transport-mediated vascular hyperpermeability has been postulated but never rigorously proven (14)
. Nevertheless, some clues have been collected. For example, vascular endothelial growth factor (VEGF) has been shown to stimulate enhanced vascular permeability via transcellular vesicles, and Ca2+ signals seem to be involved in forming, joining, and releasing the vesicles (33)
. Recent studies have demonstrated that CysLT stimulation of human umbilical vein endothelial cells predominantly expressing the CysLT2R, as opposed to CysLT1R, causes a potent Ca2+ spike followed by an oscillating Ca2+ signal (21)
. Taking into account the increased number of FITC-albumin accumulating sites after CysLT + BAY-u9773 treatment, thapsigargin addition, or CysLT stimulation in BAPTA-pretreated vessels, we speculate that an initial Ca2+ signal evoked by CysLT stimulation of CysLT2R leads to vesicle formation and endocytosis at luminal sites of endothelial cells (Fig. 8)
similar to the VEGF model described by Bates (33)
. The CysLT2R-triggered oscillating Ca2+ signal described previously (21)
, on the other hand, could be the key to exocytosis at the abluminal side. The importance of Ca2+ signaling for exocytosis has been studied in detail for nerve cells (34)
and has also been shown in astrocytes (35)
and adrenal chromaffin cells (36)
. There has been speculation that it might be a more general mechanism also found in endothelial cells (14
, 37)
, and our results contribute to and support this hypothesis.
In summary, our studies provide evidence for CysLT-mediated vascular permeability alterations exclusively via CysLT2R by means of transcellular endothelial vesicle transport, which is likely mediated by oscillatory Ca2+ signaling. Understanding and controlling this vascular hyperpermeability response is likely to be of importance for managing the clinical response to vascular injury and perhaps for preventing post-traumatic injury edema formation. However, since there are some differences in CysLT2R expression patterns between mice and humans (13
, 38
, 39)
, caution will have to be exercised before translating this work to human vascular disorders.
|
ACKNOWLEDGMENTS |
|---|
Received for publication May 9, 2008. Accepted for publication August 14, 2008.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  A. Y. Meliton, N. M. Munoz, C. M. Osan, L. N. Meliton, and A. R. Leff Leukotriene D4 activates {beta}2-integrin adhesion in human polymorphonuclear leukocytes Eur. Respir. J., February 1, 2010; 35(2): 402 - 409. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
8). Leftmost panels show brightfield images; other panels in each row show fluorescence recordings at indicated time points after administration of FITC-labeled albumin via a jugular vein catheter. Asterisks indicate period of CysLT superfusion of WT and KO preparations. Scale bars = 50 µm.
