FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published as doi: 10.1096/fj.08-112953.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Supplemental Data
Right arrow All Versions of this Article:
fj.08-112953v1
22/12/4327    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tohyama, D.
Right arrow Articles by Yamashita, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tohyama, D.
Right arrow Articles by Yamashita, T.
(The FASEB Journal. 2008;22:4327-4337.)
© 2008 FASEB

Inhibition of a eukaryotic initiation factor (eIF2B{delta}/F11A3.2) during adulthood extends lifespan in Caenorhabditis elegans

Daisuke Tohyama*, Atsushi Yamaguchi*,1 and Toshihide Yamashita*,{dagger}

* Department of Neurobiology, Graduate School of Medicine, Chiba University, Chiba, Japan; and

{dagger} Department of Molecular Neuroscience, Graduate School of Medicine, Osaka University, Osaka, Japan

1Correspondence: Department of Neurobiology, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670, Japan. E-mail: atsyama{at}restaff.chiba-u.jp


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The critical role of protein synthesis in regulating lifespan has been evidenced. This study shows that adult-onset RNAi inactivation of eukaryotic initiation factor 2B{delta} (eIF2B{delta}/F11A3.2), a subunit of eIF2B, extends the mean lifespan of Caenorhabditis elegans. eIF2B is a GDP-GTP exchange factor for eIF2—a rate-limiting factor for protein synthesis initiation. 35S-methionine incorporation assay showed that global protein synthesis is reduced by eIF2B{delta}/F11A3.2 RNAi. Inhibition of eIF2B{delta}/F11A3.2 during adulthood conferred thermal and oxidative stress resistance and reduced the fecundity and fat storage, suggesting the possible trade-offs of resources between reproduction and somatic maintenance. Lifespan extension by adult-onset eIF2B{delta}/F11A3.2 RNAi is suppressed in FOXO transcription factor daf-16 deletion mutants. Adult-onset eIF2B{delta}/F11A3.2 RNAi increases the expression of stress-resistant genes, including hsp-16.2, hsp-70, hsp90, and sod-3, some of which are reported to be targets of DAF-16. Adult-onset eIF2B{delta}/F11A3.2 RNAi in daf-16 mutants reduced fecundity, but did not extend lifespan. Furthermore, adult-onset eIF2B{delta}/F11A3.2 RNAi did not extend the lifespan of germline-defective glp-4 organisms. Thus, it is possible that eIF2B{delta}/F11A3.2 RNAi during adulthood prolongs lifespan via daf-16, which induces stress resistance in organisms. This might be the mechanism, at least in part, for trade-offs of resources between reproduction and somatic maintenance.—Tohyama, D., Yamaguchi, A., Yamashita, T. Inhibition of a eukaryotic initiation factor (eIF2B{delta}/F11A3.2) during adulthood extends lifespan in Caenorhabditis elegans.


Key Words: aging • daf-16


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
AGING IS A VERY COMPLEX MULTIFACETED process that is influenced by various environmental and genetic factors (1) ; however, previous studies have shown that the inhibition of certain genes or certain interventions can cause lifespan extension in Caenorhabditis elegans. These include 1) reduced insulin/insulin-like growth factor (IGF-1) pathway activity (2 3 4) ; 2) mitochondrial deficiency (5 , 6) ; 3) inhibition of the mRNA translation machinery components such as eukaryotic initiation factors (eIFs), ribosomal proteins (RPs), and nutrition sensor TOR/let-363 (7 8 9 10 11) ; 4) dietary restriction (12) ; 5) germline ablation (13 , 14) ; 6) sensory neuron ablation (15 , 16) ; and 7) low temperature (17) . Some of these lifespan-extending pathways in C. elegans converge on the insulin/IGF-1 pathway, which is involved in longevity across species (18 19 20) . The insulin/IGF-1 pathway is implicated in various signaling pathways, including those involved in development, longevity, metabolism, and reproduction, and its effect on lifespan extension can be observed even when the activity of this pathway is reduced in adulthood (2 3 4 , 21 , 22) . The FOXO transcription factor DAF-16 plays a key role in the lifespan extension mediated by the insulin/IGF-1 pathway. DAF-16, which is activated by reduction of the insulin/IGF-1 pathway activity, is translocated to the nucleus where DAF-16 can modulate the expression levels of a set of genes responsible for lifespan extension (23 24 25 26 27) .

Several lines of evidence have revealed protein synthesis to be a critical step for cellular response to environmental changes, especially under stress conditions (28 29 30) . The disposable soma theory of aging proposes that longevity is determined by the relocation of resources that are utilized for growth and reproduction to somatic maintenance and repair (31 , 32) . Approximately up to 50% of cellular energy is utilized for protein translation (29) , raising the possibility that the regulation of protein synthesis could modulate the investment of resources. Protein translation is regulated at 3 stages: initiation, elongation, and termination (33) . The initiation step is the rate-limiting process for protein translation, in which the initiator tRNA and the 40S and 60S ribosomal subunits, mediated by eIFs, assemble into an 80S ribosome at the site of the initiation codon of the mRNA. The 40S subunit, in association with eIF3 and eIF1A, is then further bound by the ternary complex (eIF2, methionine-tRNA, and GTP) to form a 43S preinitiation complex. This preinitiation complex is regulated by the eIF2B complex, which is a GDP-GTP nucleotide exchanger for eIF2 (34) . This indicates that eIF2B consists of 5 subunits ({alpha}, β, {gamma}, {delta}, and {epsilon}) and plays a pivotal role in protein synthesis initiation (35) .

In this study, we performed RNAi screening of C. elegans to identify genes that extend the lifespan when inactivated during adulthood and found that RNAi inactivation of eIF2B{delta}/F11A3.2 at the adult stage prolongs lifespan, which also depends on daf-16.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Strains
All C. elegans strains were maintained as described previously (36) . The genotypes of the organisms used were N2 (wild type), daf-16 (mgDf50), daf-16 (mgDf47);daf-2 (e1370) (GR1309), eat-2 (ad465), glp-4 (bn2), hsf-1 (sy441), and mev-1 (kn2).

RNAi experiments
RNAi bacterial strains were cultured as described previously (37) . From the L4 stage, worms were fed with Escherichia coli expressing different double-stranded RNAs. In all the RNAi experiments, E. coli expressing the empty RNAi vector L4440 was fed to the organisms as controls. Clone identity of all the RNAi bacteria was verified by DNA sequencing using the M13 forward primer. The TOR/let-363 RNAi clone was kindly provided by Dr. Xiaomeng Long (Massachusetts General Hospital, Boston, MA, USA; ref. 38 ). All other RNAi clones were obtained from the C. elegans RNAi library (Geneservice Ltd., Cambridge, UK).

Lifespan assays
Lifespan assays were performed as described previously (39) , except for the addition of 10 µg/ml (+)-5-fluorodeoxyuridine (FUdR) (WAKO, Tokyo, Japan) onto the plates during the reproductive phase. All the experiments were carried out at 20°C unless otherwise stated. The glp-4 strain was cultured at 16°C prior to the reproductive phase and transferred to a temperature of 25°C at the L4 stage (to induce sterility in the worms). The worms were transferred onto fresh plates every 3 or 4 days. In all the assays, RNAi was introduced into the L4 larvae. The first day of adulthood is indicated as day 0 in the survival curves.

Fecundity analysis
L4 larvae growing under a temperature of 20°C were transferred onto RNAi plates and then were transferred onto fresh RNAi plates every 12 h. All of the plates containing the progeny were incubated at 20°C for ~2 days and then maintained at 4°C. Progeny produced during the 12-h period were counted.

35S-methionine incorporation analysis
35S-methionine incorporation analysis was performed as described previously (8 , 10) . 35S incorporation levels were calculated by normalizing the 35S counts per minute, corrected for nonspecific background, to the total protein levels. Statistical analysis was performed by the one-sided paired t test. The relative 35S incorporation was calculated by normalizing the experimental count to that of the control, which was set to 1.0.

Real-time PCR
Total RNA was isolated from synchronized populations of ~100 worms/condition. Total RNAs were extracted using TriZOL reagent (Invitrogen, Carlsbad, CA, USA). cDNAs were created using High Capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA). Real-time polymerase chain reaction (real-time PCR) was performed with the ABI 7700 RT-PCR system (Applied Biosystems), and analyzed with the {Delta}{Delta}Ct method according to the manufacturer’s protocol. To normalize the expression levels of mRNAs between samples, we used act-1 for normalization after confirming the expression level of this transcript is stable in the experiment by semiquantitative reverse-transcriptase PCR (Supplemental Fig. 1). Real-time PCR primers: eIF2B{delta}/F11A3.2-F, TGCATCCAATCGGATCTTGTAA; eIF2B{delta}/F11A3.2-R, GATGTTGGTCCAAGGATTCGA; hsp90-F, GCTGATATTTCCATGATTGGTCAGT; hsp90-R, CGGCGACAAGGAAAGCA. The primers for act-1, hsp-16.2, hsp-70, hsp90, and sod-3 have been described previously (40 41 42 43) .

Nile red staining and morphological analysis
Nile red staining of stored fat was performed as described previously (44 , 45) . Similar areas of the worms were selected for quantification. Scion Image (Scion Corporation, Frederick, MD, USA) was used to determine the total fluorescence, which was calculated as a product of the mean fluorescence and the area selected.

Thermotolerance assay
Synchronized wild-type (N2) L4 larvae were treated with RNAi and FUdR at 20°C for 2, 4, and 7 days. The adult worms were then collected for the assays. Thermotolerance assays were performed as described previously (39) . The collected adults were shifted from temperatures of 20°C to 35°C, and 10 h after exposure to a temperature of 35°C, survival was scored by means of touch-provoked movement. The worms that did not respond to touch were scored as dead.

Oxidative stress assay
For the paraquat-resistance assays, paraquat (N,N'-dimethyl-4,4'-bipyridinium dichloride) was used to induce oxidative stress. Synchronized L4 larvae were treated with RNAi and FUdR at 20°C for 48 h and then exposed to 10 mM paraquat (Tokyo Chemical Industry, Tokyo, Japan) on agar plates with RNAi bacteria and FUdR at 20°C. Survival was scored every day by means of touch-provoked movement. The worms that did not respond to touch were scored as dead.

Western blot analysis
Approximately 100 worms/condition were harvested, washed in S-buffer (43.55 mM KH2PO4, 6.45 mM K2HPO4, and 100 mM NaCl, pH 6), and suspended in lysis buffer [1% Nonidet P-40, 50 mM Tris (pH 7.4), 150 mM NaCl, 50 mM NaF, 1 mM EDTA, Complete inhibitor cocktail (Roche, Mannheim, Germany)]. After being centrifuged at 18,000 g for 15 min, 20 µg of lysate from each condition was separated on 10% SDS-PAGE. After electrophoresis, the protein extracts were transferred onto polyvinylidene difluoride membranes (Immobilon P, Millipore, Bedford, MA, USA), blocked with 5% nonfat dry milk in PBS containing 0.05% Tween-20 (PBS-T), and incubated for 1 h with 5% nonfat dry milk in PBS-T with either 1:500 anti-DAF-16 antibody (sc-33738; Santa Cruz Biotechnology, Santa Cruz, CA, USA) or 1:1000 anti-actin antibody (A5441, Sigma, St. Louis, MO, USA). Finally, the blots were incubated with 1:1000 horseradish peroxidase-linked anti-mouse immunoglobulin G (IgG) antibody or anti-rabbit IgG antibody (Cell Signaling Technology, Beverly, MA, USA) in 5% nonfat milk in PBS-T. For detection, an enhanced chemiluminescence (ECL) system (GE Healthcare, New York, NY, USA) was used.

Statistical analysis
Statistical analyses were performed using the Prism 4 software (GraphPad Software Inc., San Diego CA, USA). Kaplan-Meier survival curves were plotted for each lifespan and compared with the use of the log-rank test.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Extension of the lifespan in C. elegans by adult-onset RNAi inactivation of eIF2B{delta}/F11A3.2
To investigate the underlying mechanisms for aging and longevity, we carried out RNAi screening to identify genes that extend the lifespan by using the C. elegans RNAi library (Geneservice Ltd.). A recent genome-wide RNAi screening, in which the RNAi treatment was performed throughout development, has shown that more than 2000 genes are essential for the development of C. elegans (46 , 47) ; this suggests that many lifespan-modulating genes are still to be identified with such screenings. The antagonistic pleiotropy theory of aging suggests that genes that enhance fitness in early life could have a deleterious effect in later life (32 , 48 , 49) . In fact, high percentages of genes that are lethal during development extend the lifespan when inactivated during adulthood (9 , 47) . In the present screening, therefore, we initiated RNAi treatment from the L4 stage to identify the lifespan-extending genes. Through this screening, we found that adult-onset eIF2B{delta}/F11A3.2 RNAi extends the mean lifespan by 14% in wild-type N2 worms [the mean lifespan; control RNAi, 17.6 ± 0.8 days (n=184); eIF2B{delta}/F11A3.2 RNAi, 20.2 ± 0.9 days (n=135); log-rank test P<0.002; Fig. 1A ; Table 1 ]. We then performed real-time PCR assay and confirmed that this adult-onset eIF2B{delta}/F11A3.2 RNAi actually reduces the expression levels of the eIF2B{delta}/F11A3.2 transcript by ~90% compared with the controls (n{approx}300 worms/condition) (Fig. 1B ). The mortality graph showed that the onset of age-dependent increase in mortality is delayed by eIF2B{delta}/F11A3.2 RNAi (Fig. 1C ). As predicted, the inhibition of eIF2B{delta}/F11A3.2 by RNAi throughout development causes larval arrest at the L2 ~ L3 stage in N2 worms (data not shown), suggesting that eIF2B{delta}/F11A3.2 could have the effect of antagonistic pleiotropy.


Figure 1
View larger version (11K):
[in this window]
[in a new window]

  		Figure 1. RNAi inactivation of eIF2B{delta}/F11A3.2 at the adult stage extends the mean lifespan of N2 worms and decreases global protein synthesis. A) Representative survival curves of wild-type (N2) organisms fed bacteria expressing either control (L4440) or eIF2B{delta}/F11A3.2 RNAi during adulthood at 20°C. Adult-onset treatment with eIF2B{delta}/F11A3.2 RNAi resulted in lifespan extension in 3 independent trials. See Table 1 for statistics and additional information. B) Expression level of the eIF2B{delta}/F11A3.2 transcript was indeed reduced by the eIF2B{delta}/F11A3.2 RNAi treatment. Real-time PCR was used to quantify the relative level of eIF2B{delta}/F11A3.2 transcripts in N2 worms at 20°C. Values are means ± SE of relative eIF2B{delta}/F11A3.2/act-1 ratios based on 2 independent trials of biological triplicate samples (n{approx}300/condition). C) Mortality of N2 worms fed bacteria expressing either control or eIF2B{delta}/F11A3.2 RNAi during adulthood at 20°C. Mortality was determined from the life table for the experiment shown in A. Data are presented as log mortality for control and eIF2B{delta}/F11A3.2 RNAi worms. D) Relative levels of 35S-methionine incorporation for 3 h in N2 worms treated with control, eIF2B{delta}/F11A3.2, or TOR/let-363 RNAi for 2 days, based on 4 independent trials (n{approx}2000 worms/condition). Values are means ± SE of relative levels. *P < 0.005, **P < 0.05 vs. control; one-sided, paired t test.


View this table:
[in this window]
[in a new window]

  		Table 1. RNAi inactivation of eIF2B{delta}/F11A3.2 causes lifespan extension in wild-type (N2),eat-2 (ad465), and hsf-1 (sy441) worms but not in daf-16 (mgDf50), daf-16 (mgDf47);daf-2 (e1370) (GR1309), and glp-4 (bn2) worms

Adult-onset eIF2B{delta}/F11A3.2 RNAi inhibits global protein synthesis
eIF2B, which consists of 5 subunits including eIF2B{delta}/F11A3.2, is a GDP-GTP exchanger for eIF2—a rate-limiting factor for global protein synthesis initiation (35) . Since we assumed that RNAi inactivation of eIF2B{delta}/F11A3.2 could inhibit the global protein synthesis initiation function of eIF2, we raised the issue of whether knockdown of eIF2B{delta}/F11A3.2 during adulthood reduces global protein synthesis. To address this question, we measured the levels of newly synthesized proteins by the 35S-methionine incorporation assay as previously reported (8 , 10) . If the rates of protein degradation are comparable among samples, the amounts of newly synthesized protein are proportional to the radioactivity levels of the incorporated 35S-methionine. The radioactivity levels were measured after incubation with 35S-methionine-labeled bacteria for 3 h. We used worms treated with TOR/let-363 RNAi as a positive control; TOR/let-363 RNAi was previously reported to reduce the levels of 35S-methionine incorporation in this assay (10) . Adult-onset eIF2B{delta}/F11A3.2 RNAi reduced the radioactivity level by ~60% compared with the control; this is almost similar to the reduction in the radioactivity level of the TOR/let-363 RNAi worms (relative radioactivity level; eIF2B{delta}/F11A3.2 RNAi, 0.44±0.08; TOR/let-363 RNAi, 0.42±0.06; n{approx}2000 worms/condition; P<0.05; Fig. 1D ). These results suggest that performing eIF2B{delta}/F11A3.2 RNAi during adulthood probably reduces global protein synthesis in N2 worms. However, we cannot rule out the possibility that protein degradation could be enhanced in organisms treated with eIF2B{delta}/F11A3.2 RNAi or TOR/let-363 RNAi, as previously mentioned (10) .

Adult-onset eIF2B{delta}/F11A3.2 RNAi reduces fecundity and confers stress resistance
The disposable soma theory proposes that aging occurs as a result of reallocation of resources that are utilized for growth and reproduction to somatic maintenance and repair, as mentioned above. To investigate whether RNAi inactivation of eIF2B{delta}/F11A3.2 modulates the lifespan by mediating such reallocation, we examined the fecundity and survival under stress conditions. We treated wild-type N2 worms from the L4 stage onward, with eIF2B{delta}/F11A3.2 RNAi for 2, 4, and 7 days, and subjected them to thermal stress at 35°C for 10 h. The inhibition of eIF2B{delta}/F11A3.2 during adulthood for 4 and 7 days conferred resistance to thermal stress [mean survival rate at 35°C for 10 h; control RNAi, 9.56% (day 4) and 5.0% (day 7); eIF2B{delta}/F11A3.2 RNAi, 32.9% (day 4) and 35.5% (day 7); n{approx}150 worms/condition; P<0.0001 (days 4, 7); Fig. 2A-C ]. We then subjected the N2 worms treated with eIF2B{delta}/F11A3.2 RNAi during adulthood to 10 mM paraquat, a source of oxidative stress, and found that adult-onset eIF2B{delta}/F11A3.2 RNAi increased the viability of N2 worms [mean lifespan on paraquat; control RNAi, 9.1±0.4 days, n=52/56 (animals that died/total); eIF2B{delta}/F11A3.2 RNAi, 13±0.4 days, n=52/55; log-rank test P<0.0001; Fig. 2D ]. This suggests that adult-onset eIF2B{delta}/F11A3.2 RNAi conferred resistance to paraquat. mev-1 encodes a subunit of the enzyme succinate dehydrogenase cytochrome b, which is a component of complex II of the mitochondrial electron transport chain, and mev-1 mutant worms show hypersensitivity to oxidative stress and premature aging (50) . Furthermore, we found that adult-onset eIF2B{delta}/F11A3.2 RNAi can increase the viability in mev-1 (kn1) worms (mean lifespan of mev-1 on paraquat; control RNAi, 4.16±0.38 days, n=46/48; eIF2B{delta}/F11A3.2 RNAi, 4.9±0.64 days, n=43/48; log-rank test P<0.0001; Fig. 2E ), suggesting that adult-onset eIF2B{delta}/F11A3.2 RNAi can confer stress resistance to paraquat in mev-1 (kn1) worms. However, adult-onset eIF2B{delta}/F11A3.2 RNAi did not extend the lifespan of mev-1 mutants (data not shown). Next, we examined the fecundity of wild-type N2 organisms by measuring the brood size in worms treated with eIF2B{delta}/F11A3.2 RNAi from the L4 stage. As predicted, the brood size was significantly reduced in worms treated with eIF2B{delta}/F11A3.2 RNAi compared with that in the controls (total eggs/worm; control RNAi, 230.9±18.8; eIF2B{delta}/F11A3.2 RNAi, 99.44±7.69; n{approx}30 worms/condition; P<0.05; Fig. 3A ), raising the possibility that inhibition of eIF2B{delta}/F11A3.2 during adulthood causes the translocation of resources between reproduction and somatic maintenance. The insulin/IGF-1 pathway, which regulates longevity, metabolism, reproduction, and development, could modulate fat storage when its activity was decreased (51) . We tested whether adult-onset eIF2B{delta}/F11A3.2 RNAi modulates fat storage as a result of reallocation of resources. After treating the worms with eIF2B{delta}/F11A3.2 RNAi for 7 days from the L4 stage onward, we performed Nile red staining to monitor fat storage. Fat storage is morphologically slightly decreased in organisms treated with eIF2B{delta}/F11A3.2 RNAi compared with the controls (the relative fluorescence level; eIF2B{delta}/F11A3.2 RNAi, 0.81±0.06; n{approx}30 worms/condition; P=0.029; Fig. 3B, C ). Taken together, these results suggest that the inhibition of eIF2B{delta}/F11A3.2 during adulthood reduced fecundity and fat storage and conferred stress resistance to thermal and oxidative stress, possibly as a result of relocation of resources.


Figure 2
View larger version (14K):
[in this window]
[in a new window]

  		Figure 2. RNAi inactivation of eIF2B{delta}/F11A3.2 in adulthood conferred protection from thermal and oxidative stress. A–C) eIF2B{delta}F11A3.2 RNAi at the adult stage conferred protection from thermal stress. Wild-type (N2) L4 stage worms were treated with control (L4440) or eIF2B{delta}/F11A3.2 RNAi for 2, 4, and 7 days at 20°C, and exposed to heat stress at 35°C for 10 h. Then, viability was scored. Similar results were obtained in 3 independent trials (n{approx}150 worms/condition). *,**P < 0.05 vs. control; two-sided paired t test. D, E) eIF2B{delta}/F11A3.2 RNAi at the adult stage conferred protection from paraquat. N2 (D) or mev-1 (E) worms at the L4 stage were treated with control or eIF2B{delta}/F11A3.2 RNAi for 2 days at 20°C, and exposed to 10 mM paraquat. Viability was then scored every day. Similar results were obtained in 2 independent trials (n{approx}100 worms/condition/trial). P < 0.0001 (D), P = 0.0011 (E) vs. control; log-rank test.


Figure 3
View larger version (23K):
[in this window]
[in a new window]

  		Figure 3. RNAi inactivation of eIF2B{delta}/F11A3.2 during adulthood reduced fecundity and fat storage. A) eIF2B{delta}/F11A3.2 RNAi reduced fecundity. Wild-type (N2) organisms were treated with control (L4440) or eIF2B{delta}/F11A3.2 RNAi from the L4 stage, and the progeny was counted every 12 h. Similar results were obtained in 2 independent trials (n{approx}30 worms/condition/trial). *P < 0.05 vs. control; two-sided paired t test. B) eIF2B{delta}/F11A3.2 RNAi treatment of worms at adult stage for 7 days reduced fat storage. Nile red staining performed in N2 worms treated with control or eIF2B{delta}/F11A3.2 RNAi during adulthood for 7 days. After staining, worms were observed under a fluorescence microscope (Rhodamine filter, x200). Similar results were obtained in 2 independent trials (n{approx}30 worms/condition). C) Quantification of the Nile red staining of fat in N2 worms treated with control or eIF2B{delta}/F11A3.2 RNAi. Mean value of fluorescence in control group was determined to be 1.00 (n{approx}30 worms/condition). Error bars indicate SE. *P = 0.0351 vs. control; two-sided paired t test.

Dependence of lifespan extension by adult-onset eIF2B{delta}/F11A3.2 RNAi on daf-16
We then performed epistasis studies to investigate the genetic mechanism for lifespan extension by adult-onset eIF2B{delta}/F11A3.2 RNAi. The mechanism for lifespan extension in the daf-2 insulin/IGF-1 receptor mutant has been the most extensively investigated mechanism and is exclusively dependent on the FOXO transcription factor DAF-16 (23 , 25) . We first examined the daf-16 dependency of lifespan extension using the daf-16 (mgDf47); daf-2 (e1370) (GR1309) strain treated with eIF2B{delta}/F11A3.2 RNAi. We found that eIF2B{delta}/F11A3.2 RNAi had no effect on the lifespan of the daf-16 (mgDf47); daf-2 (e1370) (GR1309) strain [mean lifespan; control RNAi, 13.5±0.4 days, n=131; eIF2B{delta}/F11A3.2 RNAi, 14.0±0.3 days, n=145; log-rank test P=0.3164; Fig. 4A ; Table 1 ]. We then examined the daf-16 dependency of lifespan extension using the daf-16 (mgDf50) mutant. The daf-16 (mgDf50) mutant is a null allele that deletes nearly all the daf-16 coding regions. Lifespan extension by adult-onset eIF2B{delta}/F11A3.2 RNAi was abolished in the daf-16 (mgDf50) mutant, or rather eIF2B{delta}/F11A3.2 RNAi shortened the lifespan of the daf-16 (mgDf50) mutant to a slight extent [mean lifespan; control RNAi, 11.1±1.3 days, n=160; eIF2B{delta}/F11A3.2 RNAi, 10.8±1.1 days, n=116; log-rank test P=0.803; Fig. 4B ; Table 1 ]. This implies that the mechanism of lifespan extension by adult-onset eIF2B{delta}/F11A3.2 RNAi is exclusively dependent on daf-16 and that eIF2B{delta}/F11A3.2 RNAi had some negative effect on the lifespan in the absence of daf-16 expression.


Figure 4
View larger version (11K):
[in this window]
[in a new window]

  		Figure 4. Lifespan curves in daf-16 (mgDf47); daf-2 (e1370) (GR1309), daf-16 (mgDf50), hsf-1 (sy441), and eat-2 (ad465) worms treated with control (L4440) or eIF2B{delta}/F11A3.2 RNAi during adulthood (see Table 1 ). Representative survival curve of daf-16 (mgDf47); daf-2 (e1370) (GR1309) (A), daf-16 (mgDf50) (B), hsf-1 (sy441) (C), or eat-2 (ad465) (D) worms fed bacteria expressing either control (L4440) or eIF2B{delta}/F11A3.2 RNAi during adulthood at 20°C in 2 or 3 independent trials.

Since heat shock factor-1 (HSF-1), similar to DAF-16, is necessary for reduction of the insulin/IGF-1 pathway activity for lifespan extension (24 , 52) , we examined whether lifespan extension by adult-onset eIF2B{delta}/F11A3.2 RNAi is dependent on HSF-1 using the hsf-1 (sy441) mutant. Adult-onset eIF2B{delta}/F11A3.2 RNAi extends the lifespan of the hsf-1 (sy441) mutant [mean lifespan; control RNAi, 12.0±0.8 days, n=248; eIF2B{delta}/F11A3.2 RNAi, 14.0±0.3 days, n=187; log-rank test P=0.3164; Fig. 4C ; Table 1 ]. The hsf-1 (sy441) is not a null mutant; therefore, it may be the case that residual hsf-1 activity in this mutant allows for lifespan extension.

Dietary restriction is the only intervention that is capable of extending the lifespan across species (53) . The eat-2 (ad465) mutant, which consumes less food because of defective pharyngeal movement (12) , is considered to be a genetic mimic of dietary restriction. Adult-onset eIF2B{delta}/F11A3.2 RNAi treatment extends the lifespan in the eat-2 strain [mean lifespan; control RNAi, 22.2±0.5 days, n=220; eIF2B{delta}/F11A3.2 RNAi, 27.0±1.7 days, n=203; log-rank test P<0.0001; Fig. 4D ; Table 1 ]. The change in mean lifespan extension by eIF2B{delta}/F11A3.2 RNAi is larger in eat-2 than in wild-type N2 worms [change; wild-type N2, 1.14, n=135; eIF2B{delta}/F11A3.2 RNAi, 1.21, n=203; Table 1 ], raising the possibility that eIF2B{delta}/F11A3.2 RNAi has some additive effect on lifespan extension in eat-2 worms or further optimizes the longevity promoting mechanisms of the eat-2 pathway.

Effects of adult-onset eIF2B{delta}/F11A3.2 RNAi on the daf-16 pathway
The lifespan-extending effect of mutations affecting the insulin/IGF pathway components requires the participation of the key FOXO transcriptional factor DAF-16 in C. elegans (23 , 25) . DAF-16 is translocated into the nucleus and modulates the expression levels of target genes that exert various functions, including dauer formation, reproduction, longevity, metabolism, and development when the daf-2 pathway is down-regulated (22 , 25) . DNA microarray analysis has revealed the set of target genes to be present downstream of daf-16; it includes hsp-12.6, hsp-16.2, and sod-3 (27) .

We examined whether adult-onset eIF2B{delta}/F11A3.2 RNAi enhances the expression levels of DAF-16 target genes, including hsp-16.2 and sod-3, and representative heat shock protein genes, including hsp-70 and hsp90, which reportedly act downstream of the HSF-1 pathway (24 , 54) . We treated N2 organisms with eIF2B{delta}/F11A3.2 RNAi for 7 days, from the L4 stage onward, and performed real-time PCR assays. We found remarkable up-regulation of the hsp-16.2, hsp-70, hsp90, and sod-3 transcript in N2 worms treated with eIF2B{delta}/F11A3.2 RNAi (relative mRNA level; sod-3, 3.26±1.1; hsp-70, 8.09±2.7; hsp90, 2.00±0.53; hsp-16.2, 5.16±1.80; n{approx}300 worms/condition; Fig. 5A ). To investigate whether daf-16 is required for the induction of these transcripts by eIF2B{delta}/F11A3.2 RNAi, we then treated daf-16 (mgDf50) animals with eIF2B{delta}/F11A3.2 RNAi for 7 days, from the L4 stage onward, and performed real-time PCR assays. We found slightly increased expression levels of these transcripts in the daf-16 (mgDf50) mutant treated with eIF2B{delta}/F11A3.2 RNAi (relative mRNA level; sod-3, 2.48±0.65; hsp-70, 2.38±0.95; hsp90, 0.78±0.06; hsp-16.2, 2.28±0.72; n{approx}300 worms/condition; Fig. 5B ); these results raise the possibility that inhibition of eIF2B{delta}/F11A3.2 could enhance the expression levels of the stress-resistant genes mostly downstream of daf-16 but could activate daf-16-independent pathway to induce these genes. On the basis of our results that lifespan extension by adult-onset eIF2B{delta}/F11A3.2 RNAi is possibly dependent on daf-16, it is possible that adult-onset eIF2B{delta}/F11A3.2 RNAi might up-regulate these stress-resistant genes that are present downstream of DAF-16, at least in part, to extend lifespan.


Figure 5
View larger version (15K):
[in this window]
[in a new window]

  		Figure 5. Treatment with eIF2B{delta}/F11A3.2 RNAi at the adult stage induced expression of stress-resistant genes in N2 worms, and reduced fecundity in daf-16 (mgDf50) worms. A, B) Expression levels of eIF2B{delta}/F11A3.2 (to confirm the effect of RNAi) and stress-resistant genes, including hsp-16.2, hsp-70, hsp90, and sod-3. Real-time PCR was used to quantify the relative levels of transcripts in N2 (A) and daf-16 (mgDf50) (B) worms treated with control (L4440) or eIF2B{delta}/F11A3.2 RNAi at the adult stage for 7 days. Similar results were obtained in 2 independent trials of biological triplicate samples (n{approx}300 worms/condition). Values are mean ± SE ratios of mRNA expression relative to control (control=1.0). C) Effect of eIF2B{delta}/F11A3.2 RNAi on expression level of DAF-16 protein. Lysates were prepared from N2 worms treated with control or eIF2B{delta}/F11A3.2 RNAi at adult stage for 7 days. Protein from ~100 animals in each lane was separated on 10% SDS-PAGE (lanes 1 and 2, control; lanes 3 and 4, eIF2B{delta}/F11A3.2). Expression of DAF-16 was detected by Western blot analysis (top panel). The same membrane was reprobed with anti-actin antibody (bottom panel). Intensity of bands for DAF-16 and actin from 2 independent trials (4 biologically different samples) was measured by Scion Image, and ratios were calculated. Data were analyzed using Student’s t test. D) eIF2B{delta}/F11A3.2 RNAi reduced fecundity in daf-16 (mgDf50) worms. daf-16 (mgDf50) organisms were treated with control or eIF2B{delta}/F11A3.2 RNAi beginning at the L4 stage, and progeny were counted every 12 h. Similar results were obtained in 2 independent trials (n{approx}30 worms/condition). *P < 0.05 vs. control; two-sided paired t test. E) Representative survival curve of glp-4 (bn2) organisms fed bacteria expressing either control or eIF2B{delta}/F11A3.2 RNAi during adulthood at 25°C in 2 independent trials (see Table 1 ).

It is revealed that mammalian cells can survive under stress conditions by inhibiting global protein synthesis while up-regulating selective mRNA translation of stress-resistant genes (28 , 55) . eIF2, for which eIF2B is a GDP-GTP exchange factor, plays a critical role in the selective mRNA translation under stress conditions in mammalian cells (29 , 56) . In regard to DAF-16, post-translational modification, including acetylation, phosphorylation or ubiquitination, regulates its nuclear translocation, stability, and transcriptional activity (23 , 57 58 59) ; these observations raise the possibility that eIF2B{delta}/F11A3.2 RNAi could modulate selective mRNA translation of daf-16, stability of DAF-16 protein, nuclear accumulation, and/or transcriptional activity of DAF-16. To investigate whether adult-onset eIF2B{delta}/F11A3.2 RNAi modulates the expression level of DAF-16 protein, we performed Western blot analysis using worms subjected to eIF2B{delta}/F11A3.2 RNAi treatment for 7 days. We found no noticeable difference in the level of DAF-16 protein between control RNAi and eIF2B{delta}/F11A3.2 RNAi animals (Fig. 5C ). Considering that mRNA level of daf-16 is reduced in N2 animals treated with eIF2B{delta}/F11A3.2 RNAi by real-time PCR assay (relative mRNA level of daf-16; eIF2B{delta}/F11A3.2 RNAi, 0.69±0.14; Supplemental Fig. 2), we cannot rule out the possibility that eIF2B{delta}/F11A3.2 RNAi could modulate the expression level of DAF-16 protein. Next, we investigated whether eIF2B{delta}/F11A3.2 RNAi affects the nuclear translocation of DAF-16 using worms (TJ356) carrying an integrated DAF-16::GFP transgene (41 , 60) . We treated animals (TJ356) with eIF2B{delta}/F11A3.2 RNAi for 7 days, from L4 stage onward, and examined the localization of DAF-16::GFP. Interestingly we could observe slightly enhanced nuclear accumulation of DAF-16::GFP in worms (TJ356) treated with eIF2B{delta}/F11A3.2 RNAi compared with controls (percentage of worms with nuclear localization; control RNAi, 2.5±2.5; eIF2B{delta}/F11A3.2 RNAi, 25.0±14.9; n=40/condition; Supplemental Fig. 3). These results raise the possibility that inhibition of eIF2B{delta}/F11A3.2 could enhance the nuclear accumulation of DAF-16, leading to the induction of stress-resistant genes to promote longevity.

Because daf-16 is also implicated in the regulation of reproduction (22 , 61) , we raised the question as to whether the reduced fecundity by adult-onset eIF2B{delta}/F11A3.2 RNAi is dependent on daf-16. It is reported that the action of daf-16 RNAi on the daf-2 (e1370) mutant at any time point before the L4 stage suppresses the reproductive phenotype of the daf-2 mutant. This implies that the daf-2 pathway may function late in development to affect the timing of reproduction through DAF-16 (22) . We treated the daf-16 (mgDf50) mutant with eIF2B{delta}/F11A3.2 RNAi, from the L4 stage onward, and measured the brood size. The brood size of the daf-16 (mgDf50) mutant treated with eIF2B{delta}/F11A3.2 RNAi is significantly decreased compared with that of controls (total eggs/worm; control RNAi, 225±18.9; eIF2B{delta}/F11A3.2 RNAi, 77.66±15.23; n{approx}30 worms/condition; P<0.05; Fig. 5D ), suggesting that adult-onset eIF2B{delta}/F11A3.2 RNAi reduces fecundity independent of daf-16 and/or the relocation of resources could extend lifespan through intervention by DAF-16.

Previous studies have shown that germline ablation extends the lifespan in C. elegans through daf-16 (13 , 14 , 62) . We then investigated whether adult-onset eIF2B{delta}/F11A3.2 RNAi extends lifespan through its action on germline cells. To address this, we investigated whether adult-onset eIF2B{delta}/F11A3.2 RNAi extends the lifespan of germline-defective glp-4 (bn2) worms and found that adult-onset eIF2B{delta}/F11A3.2 RNAi did not extend lifespan [mean lifespan; control RNAi, 11.6±0.03 days, n=146; eIF2B{delta}/F11A3.2 RNAi, 12.1±0.4 days, n=148; log-rank test P=0.825; Fig. 5E ; Table 1 ]. Taken together, these results suggest that longevity and reproduction could be coupled and that the relocation of resources away from reproduction could extend lifespan through daf-16 in eIF2B{delta}/F11A3.2 RNAi worms.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In the present study, we found that performing eIF2B{delta}/F11A3.2 RNAi during adulthood extends the lifespan, possibly through daf-16 in C. elegans. Adult-onset eIF2B{delta}/F11A3.2 RNAi inhibited global protein synthesis and enhanced the expression levels of stress-resistant genes, including hsp-16.2, hsp-70, hsp90, and sod-3, some of which are reported to be targets of DAF-16. Furthermore, eIF2B{delta}/F11A3.2 RNAi during adulthood conferred resistance to thermal and oxidative stress, while it reduced the brood size and fat storage. This suggests that this lifespan extension possibly through daf-16 intervention could result from the translocation of resources between reproduction and somatic maintenance.

Thus far, several studies have already reported that the inhibition of protein synthesis-related genes, including various eIFs and RPs, S6K (S6 ribosomal protein kinase), and TOR/let-363, extends the lifespan in C. elegans (7 8 9 10 11 , 63) . However, the dependency of lifespan extensions on daf-16 is not consistent among them; it appears to depend on the initiation time of RNAi or the identity of the gene that is inhibited. The state of stress resistance regardless of daf-16 dependency could be one of the mechanisms involved in lifespan extension when protein synthesis is inhibited, as reported earlier (10) ; this is consistent with our results.

One of the critical questions that need to be addressed is the mechanism by which the inhibition of eIF2B{delta}/F11A3.2 at the adult stage activates the key transcription factor DAF-16, which causes lifespan extension. From the viewpoint of the disposable soma theory, it is intriguing to hypothesize that relocation of resources away from reproduction results in the activation of DAF-16, which eventually leads to lifespan extension. In this study, adult-onset eIF2B{delta}/F11A3.2 RNAi in the daf-16 mutant reduced fecundity, but did not extend the lifespan. Furthermore, lifespan extension by eIF2B{delta}/F11A3.2 RNAi was suppressed in germline-defective glp-4 worms. If the resources are either required for reproduction (producing gametes or laying eggs), or for repairing damages in somatic processes (62 , 64 , 65) , our results raise the possibility that relocation of resources away from reproduction could activate DAF-16 by an unknown mechanism, which probably leads to lifespan extension. Previous reports have shown that several genes are critical for signaling from the germline to extend lifespan, including daf-16, daf-12 (13) , daf-9 (66) , and kri-1 (14) . glp-1, another germline-defective mutant, extends lifespan through daf-16 in the case of sterile organisms (14 , 62) . If the lifespan extension in sterile glp-4 worms is dependent on daf-16 as well as glp-1, it is possible that adult-onset eIF2B{delta}/F11A3.2 RNAi cannot further extend the lifespan of glp-4 worms, in which the lifespan-extending effect of the daf-16 pathway could be saturated. Therefore, we cannot rule out the possibility that inhibition of the proliferation of germline cells by adult-onset eIF2B{delta}/F11A3.2 RNAi leads to the state of germline ablation, which could result in daf-16-dependent lifespan extension.

Protein synthesis is one of the most energy-consuming processes, and up to 50% of cellular energy is consumed in protein translation (29) , which could modulate the investment of resources. Furthermore, reduced global protein synthesis could improve protein quality control (decrease in protein translation error and toxic protein waste or possible up-regulation of protein turnover due to enhanced ubiquitin-proteasome pathway activity or autophagy) (67 68 69) , raising the possibility that the conserved cellular energy and improved protein quality control could work cooperatively to extend lifespan. In addition, it has been revealed that cells can survive under stress conditions by inhibiting global protein synthesis while up-regulating selective mRNA translations to defy stressors (28 , 55 , 56) .

In summary, several mechanisms could be proposed, individually or in combination, for lifespan extension by adult-onset eIF2B{delta}/F11A3.2 RNAi, including the shift into the state of stress resistance through daf-16 and/or selective mRNA translations, the improvement of protein quality control, and the conservation of cellular energy due to the inhibition of global protein synthesis.


   ACKNOWLEDGMENTS
 
We are grateful to Dr. Pankaj Kapahi (Buck Institute, Novato, CA, USA) and Takekazu Kubo (Chiba University) for their critical advice, Dr. Joseph Avruch and Dr. Xiaomeng Long (Massachusetts General Hospital, Boston, MA, USA) for providing us with the RNAi vector for TOR/let-363, the Caenorhabditis Genetics Center (University of Minnesota, Minneapolis, MN, USA) for all the C. elegans strains used in this study, and Dr. Y. Iino (University of Tokyo) for the N2 strain.

Received for publication May 9, 2008. Accepted for publication July 31, 2008.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Finch, C. E., Ruvkun, G. (2001) The genetics of aging. Annu. Rev. Genomics Hum. Genet. 2,435-462[CrossRef][Medline]
  2. Friedman, D. B., Johnson, T. E. (1988) A mutation in the age-1 gene in Caenorhabditis elegans lengthens life and reduces hermaphrodite fertility. Genetics 118,75-86[Abstract/Free Full Text]
  3. Kenyon, C., Chang, J., Gensch, E., Rudner, A., Tabtiang, R. (1993) A C. elegans mutant that lives twice as long as wild type. Nature 366,461-464[CrossRef][Medline]
  4. Larsen, P. L., Albert, P. S., Riddle, D. L. (1995) Genes that regulate both development and longevity in Caenorhabditis elegans. Genetics 139,1567-1583[Abstract]
  5. Felkai, S., Ewbank, J. J., Lemieux, J., Labbe, J. C., Brown, G. G., Hekimi, S. (1999) CLK-1 controls respiration, behavior and aging in the nematode Caenorhabditis elegans. EMBO J. 18,1783-1792[CrossRef][Medline]
  6. Dillin, A., Hsu, A. L., Arantes-Oliveira, N., Lehrer-Graiwer, J., Hsin, H., Fraser, A. G., Kamath, R. S., Ahringer, J., Kenyon, C. (2002) Rates of behavior and aging specified by mitochondrial function during development. Science 298,2398-2401[Abstract/Free Full Text]
  7. Henderson, S. T., Bonafe, M., Johnson, T. E. (2006) DAF-16 protects the nematode Caenorhabditis elegans during food deprivation. J. Gerontol. A Biol. Sci. Med. Sci. 61,444-460[Abstract/Free Full Text]
  8. Pan, K. Z., Palter, J. E., Rogers, A. N., Olsen, A., Chen, D., Lithgow, G. J., Kapahi, P. (2007) Inhibition of mRNA translation extends lifespan in Caenorhabditis elegans. Aging Cell 6,111-119[CrossRef][Medline]
  9. Chen, D., Pan, K. Z., Palter, J. E., Kapahi, P. (2007) Longevity determined by developmental arrest genes in Caenorhabditis elegans. Aging Cell 6,525-533[CrossRef][Medline]
  10. Hansen, M., Taubert, S., Crawford, D., Libina, N., Lee, S. J., Kenyon, C. (2007) Lifespan extension by conditions that inhibit translation in Caenorhabditis elegans. Aging Cell 6,95-110[CrossRef][Medline]
  11. Syntichaki, P., Troulinaki, K., Tavernarakis, N. (2007) eIF4E function in somatic cells modulates ageing in Caenorhabditis elegans. Nature 445,922-926[CrossRef][Medline]
  12. Lakowski, B., Hekimi, S. (1998) The genetics of caloric restriction in Caenorhabditis elegans. Proc. Natl. Acad. Sci. U. S. A. 95,13091-13096[Abstract/Free Full Text]
  13. Hsin, H., Kenyon, C. (1999) Signals from the reproductive system regulate the lifespan of C. elegans. Nature 399,362-366[CrossRef][Medline]
  14. Berman, J. R., Kenyon, C. (2006) Germ-cell loss extends C. elegans life span through regulation of DAF-16 by kri-1 and lipophilic-hormone signaling. Cell 124,1055-1068[CrossRef][Medline]
  15. Apfeld, J., Kenyon, C. (1999) Regulation of lifespan by sensory perception in Caenorhabditis elegans. Nature 402,804-809[CrossRef][Medline]
  16. Alcedo, J., Kenyon, C. (2004) Regulation of C. elegans longevity by specific gustatory and olfactory neurons. Neuron 41,45-55[CrossRef][Medline]
  17. Van Voorhies, W. A., Ward, S. (1999) Genetic and environmental conditions that increase longevity in Caenorhabditis elegans decrease metabolic rate. Proc. Natl. Acad. Sci. U. S. A. 96,11399-11403[Abstract/Free Full Text]
  18. Hekimi, S., Guarente, L. (2003) Genetics and the specificity of the aging process. Science 299,1351-1354[Abstract/Free Full Text]
  19. Kenyon, C. (2005) The plasticity of aging: Insights from long-lived mutants. Cell 120,449-460[CrossRef][Medline]
  20. Braeckman, B. P., Vanfleteren, J. R. (2007) Genetic control of longevity in C. elegans. Exp. Gerontol. 42,90-98[CrossRef][Medline]
  21. Gems, D., Sutton, A. J., Sundermeyer, M. L., Albert, P. S., King, K. V., Edgley, M. L., Larsen, P. L., Riddle, D. L. (1998) Two pleiotropic classes of daf-2 mutation affect larval arrest, adult behavior, reproduction and longevity in Caenorhabditis elegans. Genetics 150,129-155[Abstract/Free Full Text]
  22. Dillin, A., Crawford, D. K., Kenyon, C. (2002) Timing requirements for insulin/IGF-1 signaling in C. elegans. Science 298,830-834
  23. Lin, K., Hsin, H., Libina, N., Kenyon, C. (2001) Regulation of the Caenorhabditis elegans longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nat. Genet. 28,139-145[CrossRef][Medline]
  24. Hsu, A. L., Murphy, C. T., Kenyon, C. (2003) Regulation of aging and age-related disease by DAF-16 and heat-shock factor. Science 300,1142-1145[Abstract/Free Full Text]
  25. Lee, S. S., Kennedy, S., Tolonen, A. C., Ruvkun, G. (2003) DAF-16 target genes that control C. elegans life-span and metabolism. Science 300,644-647[Abstract/Free Full Text]
  26. Libina, N., Berman, J. R., Kenyon, C. (2003) Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell 115,489-502[CrossRef][Medline]
  27. Murphy, C. T., McCarroll, S. A., Bargmann, C. I., Fraser, A., Kamath, R. S., Ahringer, J., Li, H., Kenyon, C. (2003) Genes that act downstream of DAF-16 to influence the lifespan of Caenorhabditis elegans. Nature 424,277-283[CrossRef][Medline]
  28. Harding, H. P., Zhang, Y., Zeng, H., Novoa, I., Lu, P. D., Calfon, M., Sadri, N., Yun, C., Popko, B., Paules, R., Stojdl, D. F., Bell, J. C., Hettmann, T., Leiden, J. M., Ron, D. (2003) An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol. Cell 11,619-633[CrossRef][Medline]
  29. Holcik, M., Sonenberg, N. (2005) Translational control in stress and apoptosis. Nat. Rev. Mol. Cell. Biol. 6,318-327[CrossRef][Medline]
  30. Proud, C. G. (2007) Signalling to translation: How signal transduction pathways control the protein synthetic machinery. Biochem. J. 403,217-234[CrossRef][Medline]
  31. Kirkwood, T. B., Holliday, R. (1979) The evolution of ageing and longevity. Proc. R. Soc. Lond. B Biol. Sci. 205,531-546[Abstract/Free Full Text]
  32. Kirkwood, T. B., Austad, S. N. (2000) Why do we age?. Nature 408,233-238[CrossRef][Medline]
  33. Proud, C. G. (2006) Regulation of protein synthesis by insulin. Biochem. Soc. Trans. 34,213-216[CrossRef][Medline]
  34. Pestova, T. V., Kolupaeva, V. G., Lomakin, I. B., Pilipenko, E. V., Shatsky, I. N., Agol, V. I., Hellen, C. U. (2001) Molecular mechanisms of translation initiation in eukaryotes. Proc. Natl. Acad. Sci. U. S. A. 98,7029-7036[Abstract/Free Full Text]
  35. Pavitt, G. D. (2005) eIF2B, a mediator of general and gene-specific translational control. Biochem. Soc. Trans. 33,1487-1492[CrossRef][Medline]
  36. Brenner, S. (1974) The genetics of Caenorhabditis elegans. Genetics 77,71-94[Abstract/Free Full Text]
  37. Kamath, R. S., Fraser, A. G., Dong, Y., Poulin, G., Durbin, R., Gotta, M., Kanapin, A., Le Bot, N., Moreno, S., Sohrmann, M., Welchman, D. P., Zipperlen, P., Ahringer, J. (2003) Systematic functional analysis of the Caenorhabditis elegans genome using RNAi. Nature 421,231-237[CrossRef][Medline]
  38. Long, X., Spycher, C., Han, Z. S., Rose, A. M., Muller, F., Avruch, J. (2002) TOR deficiency in C. elegans causes developmental arrest and intestinal atrophy by inhibition of mRNA translation. Curr. Biol. 12,1448-1461[CrossRef][Medline]
  39. Lithgow, G. J., White, T. M., Melov, S., Johnson, T. E. (1995) Thermotolerance and extended life-span conferred by single-gene mutations and induced by thermal stress. Proc. Natl. Acad. Sci. U. S. A. 92,7540-7544[Abstract/Free Full Text]
  40. Hajdu-Cronin, Y. M., Chen, W. J., Sternberg, P. W. (2004) The L-type cyclin CYL-1 and the heat-shock-factor HSF-1 are required for heat-shock-induced protein expression in Caenorhabditis elegans. Genetics 168,1937-1949[Abstract/Free Full Text]
  41. Wolff, S., Ma, H., Burch, D., Maciel, G. A., Hunter, T., Dillin, A. (2006) SMK-1, an essential regulator of DAF-16-mediated longevity. Cell 124,1039-1053[CrossRef][Medline]
  42. Cui, Y., McBride, S. J., Boyd, W. A., Alper, S., Freedman, J. H. (2007) Toxicogenomic analysis of Caenorhabditis elegans reveals novel genes and pathways involved in the resistance to cadmium toxicity. Genome Biol. 8,R122[CrossRef][Medline]
  43. Hoogewijs, D., Houthoofd, K., Matthijssens, F., Vandesompele, J., Vanfleteren, J. R. (2008) Selection and validation of a set of reliable reference genes for quantitative sod gene expression analysis in C. elegans. BMC Mol. Biol. 9,9[CrossRef][Medline]
  44. Ashrafi, K., Chang, F. Y., Watts, J. L., Fraser, A. G., Kamath, R. S., Ahringer, J., Ruvkun, G. (2003) Genome-wide RNAi analysis of Caenorhabditis elegans fat regulatory genes. Nature 421,268-272[CrossRef][Medline]
  45. Mukhopadhyay, A., Deplancke, B., Walhout, A. J., Tissenbaum, H. A. (2005) C. elegans tubby regulates life span and fat storage by two independent mechanisms. Cell. Metab. 2,35-42[CrossRef][Medline]
  46. Lee, S. S., Lee, R. Y., Fraser, A. G., Kamath, R. S., Ahringer, J., Ruvkun, G. (2003) A systematic RNAi screen identifies a critical role for mitochondria in C. elegans longevity. Nat. Genet. 33,40-48[CrossRef][Medline]
  47. Curran, S. P., Ruvkun, G. (2007) Lifespan regulation by evolutionarily conserved genes essential for viability. PLoS Genet 3,e56[CrossRef][Medline]
  48. Medwar, P. B. (1952) An Unsolved Problem of Biology H.K. Lewis London.
  49. Williams, G. C. (1957) Pleiotropy natural-selection, and the evolution of senescence. Evolution 11,398-411[CrossRef]
  50. Ishii, N., Fujii, M., Hartman, P. S., Tsuda, M., Yasuda, K., Senoo-Matsuda, N., Yanase, S., Ayusawa, D., Suzuki, K. (1998) A mutation in succinate dehydrogenase cytochrome b causes oxidative stress and ageing in nematodes. Nature 394,694-697[CrossRef][Medline]
  51. Kimura, K. D., Tissenbaum, H. A., Liu, Y., Ruvkun, G. (1997) daf-2, an insulin receptor-like gene that regulates longevity and diapause in Caenorhabditis elegans. Science 277,942-946[Abstract/Free Full Text]
  52. Morley, J. F., Morimoto, R. I. (2004) Regulation of longevity in Caenorhabditis elegans by heat shock factor and molecular chaperones. Mol. Biol. Cell 15,657-664[Abstract/Free Full Text]
  53. Bishop, N. A., Guarente, L. (2007) Genetic links between diet and lifespan: Shared mechanisms from yeast to humans. Nat. Rev. Genet. 8,835-844[CrossRef][Medline]
  54. Singh, V., Aballay, A. (2006) Heat-shock transcription factor (HSF)-1 pathway required for Caenorhabditis elegans immunity. Proc. Natl. Acad. Sci. U. S. A. 103,13092-13097[Abstract/Free Full Text]
  55. Lu, P. D., Jousse, C., Marciniak, S. J., Zhang, Y., Novoa, I., Scheuner, D., Kaufman, R. J., Ron, D., Harding, H. P. (2004) Cytoprotection by pre-emptive conditional phosphorylation of translation initiation factor 2. EMBO J. 23,169-179[CrossRef][Medline]
  56. Bi, M., Naczki, C., Koritzinsky, M., Fels, D., Blais, J., Hu, N., Harding, H., Novoa, I., Varia, M., Raleigh, J., Scheuner, D., Kaufman, R. J., Bell, J., Ron, D., Wouters, B. G., Koumenis, C. (2005) ER stress-regulated translation increases tolerance to extreme hypoxia and promotes tumor growth. EMBO J. 24,3470-3481[CrossRef][Medline]
  57. Oh, S. W., Mukhopadhyay, A., Svrzikapa, N., Jiang, F., Davis, R. J., Tissenbaum, H. A. (2005) JNK regulates lifespan in Caenorhabditis elegans by modulating nuclear translocation of forkhead transcription factor/DAF-16. Proc. Natl. Acad. Sci. U. S. A. 102,4494-4499[Abstract/Free Full Text]
  58. Mukhopadhyay, A., Oh, S. W., Tissenbaum, H. A. (2006) Worming pathways to and from DAF-16/FOXO. Exp. Gerontol. 41,928-934[CrossRef][Medline]
  59. Li, W., Gao, B., Lee, S. M., Bennett, K., Fang, D. (2007) RLE-1, an E3 ubiquitin ligase, regulates C. elegans aging by catalyzing DAF-16 polyubiquitination. Dev. Cell 12,235-246[CrossRef][Medline]
  60. Henderson, S. T., Johnson, T. E. (2001) daf-16 integrates developmental and environmental inputs to mediate aging in the nematode Caenorhabditis elegans. Curr. Biol. 11,1975-1980[CrossRef][Medline]
  61. Tissenbaum, H. A., Ruvkun, G. (1998) An insulin-like signaling pathway affects both longevity and reproduction in Caenorhabditis elegans. Genetics 148,703-717[Abstract/Free Full Text]
  62. Mukhopadhyay, A., Tissenbaum, H. A. (2007) Reproduction and longevity: Secrets revealed by C. elegans. Trends Cell Biol. 17,65-71[CrossRef][Medline]
  63. Hamilton, B., Dong, Y., Shindo, M., Liu, W., Odell, I., Ruvkun, G., Lee, S. S. (2005) A systematic RNAi screen for longevity genes in C. elegans. Genes Dev. 19,1544-1555[Abstract/Free Full Text]
  64. Partridge, L., Gems, D., Withers, D. J. (2005) Sex and death: What is the connection?. Cell 120,461-472[CrossRef][Medline]
  65. Barnes, A. I., Boone, J. M., Jacobson, J., Partridge, L., Chapman, T. (2006) No extension of lifespan by ablation of germ line in Drosophila. Proc. Biol. Sci. 273,939-947[Abstract/Free Full Text]
  66. Gerisch, B., Weitzel, C., Kober-Eisermann, C., Rottiers, V., Antebi, A. (2001) A hormonal signaling pathway influencing C. elegans metabolism, reproductive development, and life span. Dev. Cell 1,841-851[CrossRef][Medline]
  67. Grune, T., Merker, K., Jung, T., Sitte, N., Davies, K. J. (2005) Protein oxidation and degradation during postmitotic senescence. Free Radic. Biol. Med. 39,1208-1215[CrossRef][Medline]
  68. Terman, A., Gustafsson, B., Brunk, U. T. (2007) Autophagy, organelles and ageing. J. Pathol. 211,134-143[CrossRef][Medline]
  69. Vernace, V. A., Schmidt-Glenewinkel, T., Figueiredo-Pereira, M. E. (2007) Aging and regulated protein degradation: Who has the UPPer hand?. Aging Cell 6,599-606[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Supplemental Data
Right arrow All Versions of this Article:
fj.08-112953v1
22/12/4327    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tohyama, D.
Right arrow Articles by Yamashita, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tohyama, D.
Right arrow Articles by Yamashita, T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS