FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.07-104877.
(The FASEB Journal. 2008;22:3685-3695.)
© 2008 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.07-104877v1
22/10/3685    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dobrosi, N.
Right arrow Articles by Bíró, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dobrosi, N.
Right arrow Articles by Bíró, T.

Endocannabinoids enhance lipid synthesis and apoptosis of human sebocytes via cannabinoid receptor-2-mediated signaling

Nóra Dobrosi*, Balázs I. Tóth*, Georgina Nagy{dagger}, Anikó Dózsa{ddagger}, Tamás Géczy*, László Nagy{ddagger}, Christos C. Zouboulis§,||, Ralf Paus,#, László Kovács* and Tamás Bíró*,1

* Department of Physiology,

{dagger} Department of Dermatology, and

{ddagger} Department of Biochemistry and Molecular Biology, University of Debrecen, Medical and Health Science Center, Research Center for Molecular Medicine, Debrecen, Hungary;

§ Departments of Dermatology, Venereology, Allergology, and Immunology, Dessau Medical Center, Dessau, Germany;

|| Laboratory of Biogerontology, Dermato-Pharmacology, and Dermato-Endocrinology, Institute of Clinical Pharmacology and Toxicology, Charité, Universitaetsmedizin Berlin, Campus Benjamin Franklin, Berlin, Germany;

Department of Dermatology, University Hospital Schleswig-Holstein, University of Lübeck, Lübeck, Germany; and

# School of Translational Medicine, University of Manchester, Manchester, UK

1Correspondence: Department of Physiology, University of Debrecen, Medical and Health Science Center, Research Center for Molecular Medicine, 4032 Debrecen, Nagyerdei krt. 98. PO Box 22, Hungary. E-mail: biro{at}phys.dote.hu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
We had previously shown that both locally produced endocannabinoids and exocannabinoids, via cannabinoid receptor-1 (CB1), are powerful inhibitors of human hair growth. To further investigate the role of the cannabinoid system in pilosebaceous unit biology, we have explored in the current study whether and how endocannabinoids have an impact on human sebaceous gland biology, using human SZ95 sebocytes as cell culture model. Here, we provide the first evidence that SZ95 sebocytes express CB2 but not CB1. Also, prototypic endocannabinoids (arachidonoyl ethanolamide/anandamide, 2-arachidonoyl glycerol) are present in SZ95 sebocytes and dose-dependently induce lipid production and (chiefly apoptosis-driven) cell death. Endocannabinoids also up-regulate the expression of key genes involved in lipid synthesis (e.g., PPAR transcription factors and some of their target genes). These actions are selectively mediated by CB2-coupled signaling involving the MAPK pathway, as revealed by specific agonists/antagonists and by RNA interference. Because cells with "silenced" CB2 exhibited significantly suppressed basal lipid production, our results collectively suggest that human sebocytes utilize a paracrine-autocrine, endogenously active, CB2-mediated endocannabinoid signaling system for positively regulating lipid production and cell death. CB2 antagonists or agonists therefore deserve to be explored in the management of skin disorders characterized by sebaceous gland dysfunctions (e.g., acne vulgaris, seborrhea, dry skin).—Dobrosi, N., Tóth, B. I., Nagy, G., Dózsa, A., Géczy, T., Nagy, L., Zouboulis, C. C., Paus, R., Kovács, L., Bíró, T. Endocannabinoids enhance lipid synthesis and apoptosis of human sebocytes via cannabinoid receptor-2-mediated signaling.


Key Words: cannabinoid receptor subtypes • human sebaceous gland-derived SZ95 sebocytes • acne vulgaris • signal transduction • peroxisome proliferator-activated receptor • gene expression


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
THE ENDOCANNABINOID SYSTEM (ECS), that is, endocannabinoids (such as arachidonoyl ethanolamide, AEA, and 2-arachidonoyl glycerol, 2-AG), specific cannabinoid receptors (CB1 and CB2), and enzymes involved in the synthesis and degradation of endocannabinoids, has emerged as a versatile modulatory system, implicated in a plethora of physiological and pathophysiological regulatory mechanisms (1 2 3) . Classically, CB1-mediated effects were mostly described in the central nervous system and were shown to involve regulating e.g., synaptic functions, memory, and motor learning (3 4 5 6) . Peripherally, the ECS has become implicated in regulation of e.g., immune and cardiovascular processes, apparently chiefly via CB2-coupled signaling (7 8 9) .

Recent intriguing findings, however, have also identified the functional existence of various members of the ECS on numerous other, previously unappreciated cell and tissue types. Among these, we have been particularly interested in human and murine skin and related cutaneous phenomena. Elements of the ECS were extensively documented in epidermal keratinocytes (10 11 12) . Moreover, cannabinoids were shown to suppress in vitro proliferation (and differentiation) of cultured epidermal keratinocytes (11 , 13) , similar to the effects of selective CB2 agonists on human coronary artery smooth muscle cells (14) , as well as the in vivo growth of murine skin tumors (15) and human melanomas (16) . In addition, using double CB1/CB2 gene-deficient mice, Karsak et al. (17) have elegantly demonstrated that endocannabinoids attenuate allergic contact dermatitis.

We have recently identified a CB1-mediated mechanism for nonclassical, peripheral tissue activities of endocannabinoids and exocannabinoids in the human system (18) . Namely, using organ-cultured human scalp hair follicles, we have shown that locally produced endocannabinoids (via CB1 that is expressed mainly on outer root sheath keratinocytes of the follicle) inhibit human hair growth and induce premature apoptosis-driven involution of this complex miniorgan (catagen).

Hair follicles most commonly are arranged in pilosebaceous units, which display another characteristic adnexal structure of mammalian skin, i.e., the sebaceous gland (reviewed in refs. 19 , 20 ). It is extensively documented that epithelial cells of the sebaceous gland, i.e., sebocytes, play a central role in the regulation of cutaneous lipid homeostasis and that pathological malfunctions of these cells may result in such common cutaneous diseases as acne vulgaris (21 22 23 24) .

Of importance, sebaceous gland cells reportedly also show CB receptor immunoreactivity in situ (12) . However, apart from anecdotes about marijuana users often developing acne, direct evidence for the presence of functional ECS in sebaceous glands and a description of the potential effects of endocannabinoids on various biological processes of human sebocytes are lacking.

In the current study, we have therefore analyzed the presence and function of the ECS and related signaling mechanisms in human sebaceous gland-derived cells, using the SZ95 sebocyte cell line, one of the best-established human sebocyte cell culture models (25 26 27) . Specifically, we intended to clarify which CB receptors are expressed by human sebocytes, and whether prototypic endocannabinoids (AEA, 2-AG) can be detected in SZ95 sebocytes. Furthermore, we have evaluated the effects of endocannabinoids on defined sebocyte functions (e.g., lipid synthesis, cell growth and death, gene expression), using an array of cellular and molecular assays, and have defined the involvement of various intracellular signaling pathways in mediating the effects of endocannabinoids (by employing specific agonists, antagonists, and RNA interference).

Collectively, these studies provide the first evidence that human sebocytes selectively express functional CB2, contain key endocannabinoids, and utilize this endogenous cannabinoid signaling system for the autocrine and paracrine control of human sebocyte lipid production and death.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Materials
AEA, 2-AG, arachidonyl-2-chloroethylamide (ACEA), AM-251, iodo-resiniferatoxin (I-RTX), and GF10203X were purchased from Sigma-Aldrich (Taufkirchen, Germany). JWH-015 and GW9662 were obtained from Cayman Chemical Company (Ann Arbor, MI, USA). PD098059 and wortmannin were obtained from Calbiochem (Nottingham, UK), and AM630 was from Tocris Bioscience (Ellisville, MO, USA).

Cell culturing
Human immortalized SZ95 sebocytes (25 26 27) , were cultured in Sebomed® basal medium (Biochrom, Berlin, Germany) supplemented with 10% fetal bovine serum (Invitrogen, Paisley, UK), 1 mM CaCl2, 5 ng/ml human recombinant epidermal growth factor (Sigma-Aldrich), 50 U/ml penicillin, and 50 µg/ml streptomycin (both from Biogal, Debrecen, Hungary).

Determination of endocannabinoid levels
The levels of endocannabinoids (AEA, 2-AG) were determined by liquid chromatography/in line mass spectrometry as described in our earlier reports (18 , 28) .

Immunocytochemistry
SZ95 sebocytes were fixed in acetone, permeabilized by 0.1% Triton-X-100 (Sigma-Aldrich) in phosphate-buffered saline (PBS), and then incubated with rabbit anti-CB1 or anti-CB2 primary antibodies (Cayman) for 60 min (dilution 1:200). Slides were then incubated with a goat anti-rabbit fluorescein-isothiocyanate (FITC) -conjugated secondary antibody (Vector Laboratories, Burlingame, CA, USA) (dilution 1:200), and nuclei were visualized using DAPI (Vector). Cells were examined on a Nikon Eclipse E600 fluorescent microscope (Nikon, Tokyo, Japan) (29) .

Immunohistochemistry
The study was approved by the Institutional Research Ethics Committee and adhered to Declaration of Helsinki guidelines. Normal female trunk skin samples, obtained during plastic surgery, were fixed in 4% formalin and embedded in paraffin, and 4-µm-thick sections were obtained. After antigen retrieval and blocking of the endogenous peroxidase activity, tissue sections were incubated with the above CB1 and CB2 primary antibodies (Cayman) (dilution 1:150 for CB1, 1:200 for CB2). Sections were then incubated with the EnVision+ System Labeled polymer-HRP Anti-Rabbit (Dako, Glostrup, Denmark) with 3,3'-diaminobenzidine (DAB) visualization techniques. Tissue samples were finally counterstained with hematoxylin (Sigma-Aldrich) and mounted in aqueous mounting medium (Dako) (18 , 29 , 30) .

In the course of the immunohistochemistry, numerous control experiments were performed. As "staining-negative" controls, the appropriate primary antibodies were either omitted from the procedure or were preabsorbed with synthetic blocking peptides (Cayman) (see Fig. 1 ). As "tissue-negative" controls, CB-labeling was performed on tissues not expressing CB1 (human mast cell line HMC-1) (31) or CB2 (HMC-1, human hair follicle) (18 , 31) . In addition, the specificity of CB receptor staining was also measured 1) on tissues recognized to be CB1 (HaCaT epidermal keratinocytes, hair follicle) (10 , 13 , 18) or CB2 (HaCaT keratinocytes, human peripheral monocytes, spleen) positive (11 , 18 , 32) (data not shown); or 2) by employing another set of antibodies against CB1 and CB2 (Santa Cruz Biotechnology, Santa Cruz, CA, USA). The application of these latter primary antibodies resulted in identical staining patterns (data not shown).


Figure 1
View larger version (27K):
[in this window]
[in a new window]

 
Figure 1. Expression of CB receptors on human sebaceous gland in situ and on cultured SZ95 sebocytes. A, B) CB1 (A) and CB2 (B) specific immunoreactivity (ir), as revealed by EnVision technique (brown staining), on human sebaceous gland epithelial cells in situ. NC, negative control. C, D) Immunofluorescence identification (FITC labeling, green fluorescence) of CB1 (C) and CB2 (D) in SZ95 sebocytes. Nuclei were counterstained by DAPI (blue fluorescence). Note the lack of CB1-ir. NC, preabsorption negative control. E) Western blot analysis. CB1 and CB2 expression was determined on cell lysates of SZ95 sebocytes at low (L) and high (H) confluences. Equal loading was assessed by determining expression of cytochrome C (Cyt-C). F) RT-PCR analysis of CB1 and CB2 mRNA transcripts. As an endogenous control, GAPDH expression was determined. NTC, nontemplate control. E, F) For positive controls (PC), human HaCaT keratinocytes (for CB1) and human monocytes (for CB2) were employed. In all cases, 3–5 additional experiments yielded similar results.

Western blot analysis
Western immunoblotting was performed as described in our earlier reports (29 , 30 , 33) . In brief, cell lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis, transferred to BioBond nitrocellulose membranes (Whatman, Maidstone, England), and then probed with anti-CB1 or anti-CB2 receptor antibodies (1:200, Cayman); with a rabbit antibody against the mitogen-activated protein kinase (MAPK) Erk-1/2 (Santa Cruz); or a mouse antibody recognizing the phosphorylated form of Erk-1/2 (pErk-1/2, Santa Cruz) (1:1500 dilution in both cases). Horseradish peroxidase–polymer-conjugated, respective anti-rabbit or anti-mouse IgG antibodies (Envision labeling, DAKO) were used as secondary antibodies, and the immunoreactive bands were visualized by SuperSignal West Pico Chemiluminescent Substrate-enhanced chemiluminescence (Pierce, Rockford, IL, USA). Immunoblots were then subjected to densitometric analysis using an Intelligent Dark Box (Fuji, Tokyo, Japan) and the Image Pro Plus 4.5.0 software (Media Cybernetics, Silver Spring, MD, USA). To assess equal loading, membranes were stripped and then reprobed with a rabbit cytochrome-C (Cyt-C) antibody (Santa Cruz) followed by a similar visualization procedure as described above.

Reverse transcriptase-polymerase chain reaction (RT-PCR)
The expression of CB1 and CB2 receptor mRNA was determined by semiquantitative RT-PCR, as we have described before (18 , 29 , 30) . In brief, isolated total RNA was reverse-transcribed into cDNA and then amplified on a GeneAmp PCR System 2400 DNA Thermal Cycler (Applied Biosystems, Foster City, CA, USA) using optimized thermal protocols. Primers were synthesized by Invitrogen (CB1, forward: CAAGCCCGCATGGACATTAGGTTA, CB1, reverse: TCCGAGTCCCCCATGCTGTTATC; CB2, forward: TCCCACTGATCCCCAATGACTACC, CB2, reverse: AGGATCTCGGGGCTTCTTCTTTTG; glyceraldehyde 3-phosphate dehydrogenase (GAPDH), forward: ATGGTGAAGGTCGGTGTGAAC, GAPDH, reverse: GCTGACAATCTTGAGGGAGT). PCR products were visualized on 1.5% agarose gel with ethidium bromide (0.5 mg/ml, Sigma-Aldrich) under UV, and the photographed bands were quantified by Image Pro Plus 4.5.0 software.

Quantitative real-time PCR
Quantitative PCR (Q-PCR) was performed on an ABI Prism 7000 sequence detection system (Applied Biosystems) using the 5' nuclease assay, as detailed in our previous report (18 , 29) . To detect the expression of genes involved in the regulation of lipid synthesis (see also Table 1 ), the following TaqMan primers and probes were used: peroxisome proliferator-activated receptor (PPAR){alpha}, forward: CATTACGGAGTCCACGCGT, PPAR{alpha}, reverse: ACCAGCTTGAGTCGAATCGTT; PPAR{alpha}, probe FAM-AGGCTGCAAGGGCTTCTTTCGGCG-TAMRA; PPAR{delta}, forward: AGCATCCTCACCGGCAAAG, PPAR{delta}, reverse: CCACAATGTCTCGATGTCGTG; PPAR{delta}, probe FAM-CAGCCACACGGCGCCCTTTG-TAMRA; PPAR{gamma}, forward: GATGACAGCGACTTGGCAA, PPAR{gamma}, reverse: CTTCAATGGGCTTCACATTCA; PPAR{gamma}, probe FAM-CAAACCTGGGCGGTCTCCACTGAG-TAMRA; adipose differentiation-related protein (ADRP), forward: TGACTGGCAGTGTGGAGAAGA, ADRP, reverse: ATCATCCGACTCCCCAAGA; ADRP, probe FAM-TCTGTGGTCAGTGGCAGCATTAACACA-TAMRA; PPAR{gamma}-regulated angiopoietin-related protein (PGAR), forward: TCCGCAGGGACAAGAACTG, PGAR, reverse: CGGAAGTACTGGCCGTTGA; PGAR, probe FAM-TTGGAATGGCTGCAGGTGCCA-TAMRA; and a predesigned assay for cyclooxygenase-2 (COX-2) (Applied Biosystems, assay ID: Hs00153133_m1). As internal controls, transcripts of human cyclophilin-A (forward: ACGGCGAGCCCTTGG, reverse: TTTCTGCTGTCTTTGGGACCT; probe FAM-CGCGTCTCCTTTGAGCTGTTTGCA-TAMRA) were determined.


View this table:
[in this window]
[in a new window]

 
Table 1. Effect of endocannabinoid treatment on expression of selected genes in SZ95 sebocytes

RNA interference (RNAi)
SZ95 sebocytes were seeded in 6-well culture plates in SeboMed medium lacking antibiotics. At 50–70% confluence, medium was replaced by serum-free OptiMEM (Invitrogen), and cells were transfected with various CB2-specific Stealth RNAi oligonucleotides (ID: HSS102085, HSS102086, HSS102087, Invitrogen) (40 nM) using Lipofectamine 2000 transfection reagent (Invitrogen). For controls, RNAi Negative Control Duplexes (Scrambled RNAi, Invitrogen) and CB1-specific Stealth RNAi oligonucleotides (ID: HSS102082) were employed. Three hours after transfection, medium was replaced by complete Sebomed® medium, and cells were allowed to recover for 24 h. The efficacy of siRNA-driven knockdown was daily evaluated by RT-PCR and Western blot analysis for 4 days (34) .

Determination of intracellular lipids
For semiquantitative detection of sebaceous lipids, SZ95 sebocytes were cultured on glass coverslips and treated with several compounds (AEA, 2-AG) for 24–48 h. Cells were fixed in 4% paraformaldehyde (Sigma-Aldrich), washed in 60% isopropanol, and stained in Oil Red O solution (0.3% in isopropanol) (Sigma-Aldrich). Cells were counterstained with hematoxylin (Sigma-Aldrich) and were mounted in aqueous mounting medium (Dako) (35 , 36) .

For quantitative measurement, SZ95 sebocytes (15,000 cells/well) were cultured in 96-well black-well/clear-bottom plates (Greiner Bio One, Frickenhausen, Germany) in quadruplicates and were treated with compounds for 24–48 h. Supernatants were then discarded, and 100 µl of 1 µg/ml Nile red (Sigma-Aldrich) solution was added to each well. The emitted fluorescence was measured on a Molecular Devices FlexStation 384II Fluorescence Image Microplate Reader (FLIPR, Molecular Devices, San Francisco, CA, USA). Results are presented as percentages of the relative fluorescence units (RFU) in comparison with the controls, using 485-nm excitation and 565-nm emission wavelengths for neutral lipids, and 540-nm excitation and 620-nm emission wavelengths for polar lipids (35 36 37) .

Determination of viable cell number
The number of viable cells was determined by measuring the conversion of the tetrazolium salt MTT (Sigma-Aldrich) to formazan by mitochondrial dehydrogenases. Cells were plated in 96-well plates (15,000 cells/well) in quadruplicates and were cultured for 24–48 h. Cells were then incubated with 0.5 mg/ml MTT, and the concentration of formazan crystals (as an indicator of the viable cell number) was determined colorimetrically (A550), according to our previous reports (29 , 33 , 34 , 38) .

Determination of apoptosis
Abolishment of mitochondrial membrane potential is one of the earliest markers of apoptosis (39) . To assess the process, mitochondrial membrane potential of SZ95 sebocytes was determined using a MitoProbe DilC1(5) Assay Kit (Invitrogen). Cells (15,000 cells/well) were cultured in 96-well black-well/clear-bottom plates (Greiner Bio One) in quadruplicate and were treated with various compounds for 24–48 h. After removal of supernatants, cells were incubated with DilC1(5) working solution (30 µl/well), and the fluorescence of DilC1(5) was measured at 630-nm excitation and 670-nm emission wavelengths using FLIPR (36) .

In addition, another hallmark of apoptosis (i.e., membrane perturbation) was also assessed by flow cytometry according to our previous reports (29 , 34 , 36 , 38) . In brief, following treatment with various agents, SZ95 sebocytes were harvested and stained with an Annexin-V-FITC/propidium iodide (PI) apoptosis kit (Sigma-Aldrich) following the manufacturer’s protocol. Fluorescence intensity was measured by a Coulter Epics XL (Beckman Coulter, Fullerton, CA, USA) flow cytometer.

Determination of necrosis/cytotoxicity
Necrotic cell death was first determined by measuring the glucose-6-phosphate-dehydrogenase (G6PD) release (G6PD Release Assay Kit, Invitrogen). The enzyme activity was detected by a 2-step enzymatic process that leads to the reduction of resazurin into red-fluorescent resorufin. SZ95 sebocytes (15,000 cells/well) were cultured in 96-well black-well/clear-bottom plates (Greiner Bio One) in quadruplicate and treated with various compounds for 24–48 h. A 2x reaction medium was then prepared according to the manufacturer’s protocol and was added to the wells in 1:1 dilution. The fluorescence emission of resorufin was monitored by FLIPR at 545-nm excitation and 590-nm emission wavelengths (36) .

The cytotoxic effects of cannabinoid treatment were also determined by Sytox Green staining (Invitrogen). The dye is able to penetrate (and then bind to the nucleic acids) only to necrotic cells with ruptured plasma membranes, whereas healthy cells with intact surface membranes show negligible Sytox Green staining. SZ95 sebocytes were cultured in 96-well black-well/clear-bottom plates (Greiner Bio One) and were treated with various compounds (AEA, 2-AG, JWH-015, ACEA) for 24–48 h. Supernatants were then discarded, and the cells were incubated with 1 µM Sytox Green solution. The fluorescence of Sytox Green was measured at 490-nm excitation and 520-nm emission wavelengths using FLIPR (36) .

Statistical analysis
When applicable, data were analyzed using a 2-tailed unpaired t test, and values of P < 0.05 were regarded as significant. In addition, statistical differences were further verified using 1-way ANOVA with Bonferroni and Dunnett post hoc probes, resulting in similar results (data not shown).


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Human sebaceous gland epithelium and human SZ95 sebocytes express CB receptors
First, we intended to identify the existence of CB receptors in human sebaceous gland in situ and on human SZ95 sebocytes. Similar to a previous report (12) , in situ, both CB1- and CB2-like immunoreactivity was identified in the sebaceous gland epithelium of normal human scalp skin sections (Fig. 1A, B ). However, using mutually complementary and confirmatory immunocytochemistry and Western blot analysis on human SZ95 sebocytes, we were able to identify only the relatively high expression of CB2, whereas the appearance of CB1-like immunoreactivity, in all cases, was around the detection limit (Fig. 1C-E ). In addition, supporting the above findings, transcription of the CB2 (but not of CB1) gene in SZ95 sebocytes was demonstrated by RT-PCR (Fig. 1F ) and by real-time Q-PCR (not shown). For positive controls, human organ-cultured hair follicles (for CB1) (18) and human peripheral monocytes (for CB2) (32) (as well as other tissue and cell types listed in Materials and Methods, data not shown) were employed. Therefore, in striking contrast to human hair follicle epithelium in situ (18) , human sebocytes express primarily, if not exclusively, CB2, at least in vitro.

Human SZ95 sebocytes produce endocannabinoids
We also tested whether SZ95 sebocytes synthesize endocannabinoids. Using mass spectrometry, we were able to show that SZ95 sebocytes express both AEA (66.7±10 fmol/mg tissue) and 2-AG (6.2±1 pmol/mg tissue) (means±SE, n=4) at levels similar to those detected earlier in various skin samples; e.g., ~50 fmol/mg tissue AEA in rat paw and mouse ear samples (17 , 40) or 20–30 pmol/mg tissue 2-AG in mouse ear skin (17) .

Endocannabinoids enhance lipid synthesis and induce apoptosis in SZ95 sebocytes
To further explore the functionality and the biological consequences of CB stimulation as well as possible auto- and paracrine-signaling events, we next investigated the effects of these endocannabinoids found in human SZ95 sebocytes on key functions of these cells. As revealed by Oil Red-O staining and quantitative Nile Red-based fluorescence assay, both AEA and 2-AG markedly (P<0.05) and dose dependently enhanced neutral lipid accumulation in SZ95 sebocytes (Fig. 2A, B ), reflecting stimulation of sebocyte differentiation (35) .


Figure 2
View larger version (22K):
[in this window]
[in a new window]

 
Figure 2. Endocannabinoids enhance lipid synthesis and induce cell death in SZ95 sebocytes. A) Semiquantitative detection of sebaceous lipids. SZ95 sebocytes were treated with vehicle or 30 µM AEA or 2-AG for 24 h, and lipids were labeled by Oil Red O solution (nuclei were counterstained with hematoxylin). B, C) Cells were cultured in 96-well plates in quadruplicates and were treated with various concentrations of AEA and 2-AG for 24–48 h. Graphs report quantitative measurement of intracellular neutral lipids as assessed by Nile red labeling followed by FLIPR measurement after 24 h (B) and quantitative determination of viable cell number and cell death (apoptosis, necrosis) after 48 h (C). Cell viability was assessed by a colorimetric MTT assay; necrotic cell death was measured by FLIPR-based G6PD release and Sytox Green assays; apoptotic cell death was investigated by a FLIPR-based DilC1(5) assay. Data (means±SE) are expressed as a percentage of the mean value (defined as 100%, solid line in C) of the vehicle-treated control group. * P < 0.05 vs. control. Three to 5 additional experiments yielded similar results. D) Measurement of apoptosis by flow cytometry. Control and endocannabinoid-treated (30 µM, 48 h) cells were harvested and stained with an Annexin-V-FITC and PI kit; fluorescence intensity values were detected by flow cytometry. Numbers represent percentages of cells exhibiting single Annexin-V-positive (apoptotic cells, lower right quadrant) and double Annexin-V- and PI-positive (necrotic cells, upper right quadrant) staining patterns. Two additional experiments yielded similar results.

By MTT assay, we also showed that stimulation with these endocannabinoids decreased sebocyte viability (Fig. 2C ). To assess whether this effect was due to apoptosis and/or necrosis, first, flow cytometry analysis was performed. As seen in Fig. 2D , both AEA and 2-AG markedly (P<0.05) increased the number of Annexin-V-positive cells (reflecting phosphatidyl-serine translocation) (29 , 34 , 36 , 38 , 41) , whereas the number of double Annexin-V- and PI-positive SZ95 sebocytes was only slightly elevated. This suggests that exogenously applied endocannabinoids primarily induce sebocyte apoptosis. In further support of this concept, in a series of quantitative fluorimetric assays, AEA (as well as 2-AG, data not shown) significantly decreased mitochondrial membrane potential (another hallmark of apoptosis) (36 , 39) in a dose-dependent fashion (P<0.05), while only the highest concentration of AEA was able to moderately (yet significantly, P<0.05) increase Sytox Green accumulation and G6PD release, two complementary indicators of necrosis/cytotoxicity (Fig. 2C ) (36) .

The effects of AEA on human sebocytes are selectively mediated by CB2
We then investigated whether the cellular actions of AEA on SZ95 sebocytes were mediated by the CB receptors. As seen in Fig. 3A, B , the synthetic CB2-specific agonist JWH-015 (3 , 7 , 42) —but, notably, not the CB1-specific agonist ACEA (3 , 7 , 43) —mimicked the action of endocannabinoids to enhance lipid synthesis and to induce (chiefly apoptosis-driven) cell death. Moreover, the effects of AEA were prevented by the CB2-specific antagonist AM-630 (3 , 7 , 11 , 28) (Fig. 3C, D ) but not by the CB1-specific inhibitor AM-251 (3 , 7 , 18) (Fig. 3C ). These data suggested that the sebocyte-modulatory effects of endocannabinoids are mediated by CB2 but not by CB1.


Figure 3
View larger version (13K):
[in this window]
[in a new window]

 
Figure 3. The cellular effects of AEA are inhibited by the antagonist of CB2. SZ95 sebocytes were cultured in 96-well plates in quadruplicates and were treated with vehicle, AEA, the CB1 agonist ACEA, and the CB2 agonist JWH-015 (all at 30 µM) (A, B); or vehicle, 30 µM AEA, and various inhibitors alone (CB1 antagonist, 1 µM AM-251; CB2 antagonist, 10 µM AM-630; TRPV1 antagonist, 50 nM I-RTX), or combinations of AEA and one of the inhibitors (C, D). A, C) Quantitative measurement of intracellular lipids as assessed by Nile red labeling followed by FLIPR measurement after 24 h. B, D) Quantitative assessment of viable cell number (colorimetric MTT assay) (B), apoptosis (FLIPR-based DilC1(5) assay), and necrosis (FLIPR-based Sytox Green assay) after 48 h. Data (means±SE) are expressed as a percentage of the mean value (defined as 100%, solid line in A and B) of the vehicle-treated control group. * P < 0.05 vs. control; # P < 0.05 vs. AEA without inhibitors. Three or 4 additional experiments yielded similar results.

However, AEA, in various cellular systems, may also act on another receptor, i.e., transient receptor potential vanilloid-1 (TRPV1, the capsaicin receptor) (3 , 44 , 45) . Furthermore, we have recently described the functional existence of TRPV1-mediated signaling both in human organ-cultured hair follicles (29) and in SZ95 sebocytes (36) . Therefore, to further dissect the exact cellular mechanisms of action of the endocannabinoid, we also measured the effect of the TRPV1 antagonist I-RTX (46) on the actions of AEA. As seen in Fig. 3C , I-RTX did not interfere with the ability of AEA to enhance lipid synthesis (and to induce cell death, data not shown).

Collectively, these functional data are in agreement with the apparent lack of CB1 expression in SZ95 sebocytes at either the protein or gene level (Fig. 1) and suggest that the cellular actions of endocannabinoids are mediated by CB2. To further assess the role of CB2, a series of RNAi experiments against the receptors was carried out (Fig. 4A, B ). Western blot and RT-PCR analysis revealed that the expression of CB2 was significantly knocked down by all 3 RNAi probes at day 2 after transfection and remained suppressed also on day 3. However, this phenomenon was reversible, because we observed a return of the immunosignals at day 4. Scrambled RNAi probes (Fig. 4A ) or RNAi oligonucleotides against CB1 (data not shown) had no effect on the expression of CB2, indicating the specificity of the CB2 knockdown.


Figure 4
View larger version (13K):
[in this window]
[in a new window]

 
Figure 4. The cellular effects of AEA are prevented by RNAi-mediated knockdown of CB2. Various RNAi probes against CB2 (indicated by numbers) and CB1, as well as scrambled RNAi probe (SCR), were introduced to SZ95 sebocytes as described in Materials and Methods. To evaluate the efficacy of this intervention, at days 1–4 after transfection, cells were subjected to Western blot and RT-PCR analyses. A) Representative Western blot (WB) and RT-PCR results with CB2 at day 2 after transfection. As housekeeping molecules, expressions of cytochrome c (Cyt-C, Western blotting) and GAPDH (RT-PCR) were determined. In each case, amounts of CB2 were quantitated by densitometry (OD, optical density), normalized to those of the housekeeping molecule, and expressed as the percentage of the OD value of the SCR-treated group, regarded as 100%. Note that all CB2-specific RNAi probes employed markedly suppressed the expression of CB2 both at the protein and gene levels. C, transfection reagent-treated control group. B) Statistical analysis of Western blot data with CB2. OD values of CB2-specific immunosignals with RNAi probe 6 against CB2 were determined at days 1–4 after transfection in 3 independent experiments. Normalized OD values (to Cyt-C) in each group were then averaged and expressed as mean ± SE as the percentage of the averaged values of the respective SCR-treated groups, regarded as 100% (solid line). C) At day 2 after transfection, cells were seeded in 96-well plates and were treated with vehicle and 30 µM AEA for 24 h. Intracellular lipids were then quantitatively measured by Nile red labeling, followed by FLIPR measurement. Data (means±SE) are expressed as a percentage of the mean value (defined as 100%) of the vehicle-treated control group. * P < 0.05 vs. SCR; # P < 0.05 vs. AEA and SCR. Two additional experiments yielded similar results.

We then investigated the effects of AEA-treatment (24 h) on the lipid synthesis of RNAi-transfected SZ95 sebocytes on day 2. Similar to the effects of CB inhibitors, RNAi knockdown of CB2 resulted in the loss of effect of AEA in enhancing lipid synthesis. In contrast, treatment with the CB1-targeted RNAi did not affect the cellular action of AEA (Fig. 4C ). Intriguingly, in SZ95 sebocytes with RNAi-mediated knockdown of CB2, we found markedly and significantly decreased basal lipid content as well (Fig. 4C ). This strongly suggests that CB2-mediated signaling indeed plays an important endogenous role in the constitutive regulation of sebocyte lipid synthesis.

The CB2-mediated cellular signaling involves the MAPK pathway
On various cell types, CB receptor-mediated signaling, initiated by either endocannabinoids or exocannabinoids, recruits multiple intracellular pathway systems, such as protein kinase C (PKC), MAPK, or phosphatidyl-inositol-3-kinase (PI3K) (47 48 49) . Therefore, we have also undertaken attempts to elucidate selected components of CB2-mediated intracellular signaling in human sebocytes.

As seen in Fig. 5A , the enhancement of SZ95 lipid synthesis by AEA was not modified by the PKC inhibitor GF109203X (34 , 38) or by the PI3K inhibitor wortmannin (48) . In contrast, the MAPK inhibitor PD098059 (47) significantly (P<0.05) antagonized the effect of AEA, to an extent similar to that seen in the presence of the CB2 antagonist AM-630 (see Fig. 3C ). This suggests an important involvement of the MAPK pathway in endocannabinoid-induced sebocyte lipid synthesis. This concept was further supported by the finding that both AEA and 2-AG induced a marked, transient phosphorylation of MAPK Erk-1/2, which indicated activation of the MAPK pathway (Fig. 5B, C ).


Figure 5
View larger version (8K):
[in this window]
[in a new window]

 
Figure 5. The CB2-mediated signaling induced by endocannabinoids involves the MAPK pathway. A) SZ95 sebocytes were cultured in 96-well plates in quadruplicates and were treated for 24 h with vehicle, 30 µM AEA, various inhibitors alone (CB2 antagonist, 10 µM AM-630; PKC antagonist, 100 nM GF109203X; MAPK inhibitor, 10 µM PD98059; PI3K inhibitor, 100 nM wortmannin; PPAR{gamma} inhibitor, 5 µM GW9662), or with combinations of AEA and one of the inhibitors. Intracellular lipids were then quantitatively determined with Nile red labeling, followed by FLIPR measurement. Data (means±SE) are expressed as a percentage of the mean value (defined as 100%) of the vehicle-treated control group. * P < 0.05 vs. vehicle; # P < 0.05 vs. AEA without inhibitors. Three additional experiments yielded similar results. B, C) Cells were treated with 30 µM AEA (B) or 30 µM 2-AG (C) for the times indicated, and then Western blotting was performed to reveal expressions of the MAPK Erk-1/2 and its phosphorylated form. Two additional experiments yielded similar results.

Endocannabinoids upregulate expression of genes involved in the regulation of lipid synthesis
Members of the peroxisome proliferator-activated receptor (PPAR) nuclear transcription factor family are recognized as key regulators of lipid homeostasis in various cell types (50 51 52 53) . Interestingly, recent reports directly link endocannabinoid signaling to certain PPARs (54 , 55) . Because the stimulation of lipid synthesis that we had demonstrated for endocannabinoids appears to be rather similar to that reported for selected PPAR ligands in SZ95 and SEB-1 sebocytes (37 , 56 , 57) , we therefore investigated the effect of endocannabinoid treatment on the expression of PPAR isoforms in SZ95 sebocytes. As assessed by Q-PCR analysis (Table 1 ), both AEA and 2-AG significantly (P<0.05) up-regulated the expression of PPAR{delta} and PPAR{gamma}, whereas PPAR{alpha} gene expression was only increased in the 2-AG-treated group, at the 24-h time point.

Furthermore, both in human sebaceous glands and in cultured human SZ95 sebocytes, we have recently described (unpublished results) the expression pattern of recognized target genes (such as ADRP and PGAR), which are regulated or induced by PPAR{gamma} in macrophages, adipocytes, or dendritic cells (58 59 60) . In addition, COX2 was also defined as PPAR{gamma}-induced target gene in SZ95 sebocytes (61) . Hence, we finally also tested whether endocannabinoid treatment affects the expression of selected target genes. Intriguingly, both AEA and 2-AG dramatically elevated (i.e., 10- to 15-fold increase at 24 h) the expression levels of all target genes investigated, further supporting the activation of PPAR{gamma} (Table 1) . This idea was further strengthened by the observation that the effect of AEA to stimulate lipid accumulation in SZ95 sebocytes was significantly prevented by GW9662, a selective inhibitor of PPAR{gamma} (61) (Fig. 5A ).


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
In an effort to explore the functional significance of the ECS in human skin physiology, in the current study, we have focused on the sebaceous compartment of its adnexal structures—an emerging, major neuroendocrine organ (19 , 20 , 23 , 26) . In this context, we provide here the first evidence that prototypic endocannabinoids (AEA, 2-AG) are produced by sebocytes, and show that these endocannabinoids (at physiologically relevant concentration) stimulate sebocyte lipid synthesis and apoptosis in a CB2-mediated manner. We also provide evidence suggesting that intrasebocyte signaling downstream of CB2 stimulation involves the MAPK pathway and various nuclear transcription factors well recognized in the regulation of lipid synthesis. Taken together, our data support the concept that human sebocytes are both sources and targets of endocannabinoids, where they function as constitutively active paracrine-autocrine positive regulators of sebaceous gland lipid homeostasis and negative regulators of sebocyte survival.

Previous reports have shown that endocannabinoids may exert their cellular actions via CB1, CB2, and, in the case of AEA, TRPV1 receptors (3 , 18 , 44 , 45) . Furthermore, we have recently described the functional existence of TRPV1 both in human sebaceous glands and in SZ95 sebocytes (36) . Therefore, an important goal of our study was to identify the molecular targets of the endocannabinoids. Several lines of evidence indicate the endocannabinoids induce lipid synthesis and cell death in sebaceous cells exclusively via CB2 receptors. First, the cellular effects of endocannabinoids were abrogated by the CB2-specific antagonist AM-630 but not by TRPV1 or CB1 antagonists. Second, endocannabinoids were ineffective in sebocytes in which CB2 expression was selectively knocked down by RNAi. Third, the effects of endocannabinoids were mimicked by the synthetic CB2-specific agonist JWH-015 but not by the CB1-specific agonist ACEA. Fourth, CB2 was successfully identified in SZ95 sebocytes (both at the protein and mRNA levels), whereas the expression of CB1 was uncertain.

We also intended to define the downstream signaling mechanisms activated by CB2. Among the multiple intracellular signal transduction systems (e.g., PKC, MAPK, PI3K) known to be modulated by cannabinoids (47 48 49) , we identified the MAPK pathway as a mediator of CB2-induced cellular actions of endocannabinoids in human sebocytes. We also show for the first time that CB2 activation in sebocytes also results in the induction PPAR isoforms and certain target genes (of PPAR{gamma}) involved in regulating lipid homeostasis in various cell types (50 51 52 53) . This suggests that the ECS may modulate the lipogenic gene expression profile of the cells.

Our preclinical data in one of the best established human sebocyte cell culture systems encourage the systematic exploration now of whether CB2 antagonists or agonists can be exploited in the management of common skin disorders that are characterized by sebaceous gland dysfunctions (e.g., acne vulgaris, seborrhea, dry skin, sebaceous gland-derived tumors). The observed enhancement of lipid synthesis induced by endocannabinoids strikingly resemble those seen in acne vulgaris, a common, multifactorial pilosebaceous inflammatory skin disease in which differentiation and hence lipid synthesis of sebocytes are pathologically increased (21 , 23 , 24) . This, and the finding in CB2-silenced SZ95 sebocytes that both AEA-stimulated and basal lipid synthesis, were suppressed may be interpreted to indicate a role of enhanced CB2 signaling in acne pathogenesis. Proof-of-principle studies are now warranted to test the therapeutic value of CB2 blockade in the clinical management e.g., of acne and seborrhea. Conversely, CB2 agonists deserve exploration as novel therapeutic tools for enhancing sebum production in excessively dry skin and/or for stimulating sebocyte apoptosis in sebaceous tumors.

CB1-mediated signaling inhibits human hair growth and induces apoptosis-driven regression in the hair follicle (18) . Furthermore, it also suppresses differentiation of epidermal keratinocytes (10 , 13) . Moreover, both CB1 and CB2-coupled mechanisms have been reported to suppress murine (15) and human (16) skin tumor growth and to attenuate murine allergic contact dermatitis (17) . Our current data suggest that the endogenously active ECS, which enhances sebocyte lipid synthesis and cell death selectively operates via CB2. This, in turn, suggests the existence of cell type-specific and receptor-selective regulatory endocannabinoid mechanisms in mammalian skin, which call for systematic further experimental dissection. Moreover, in view of growing insights into the importance of neuroendocrine cross-talks, e.g., between cannabinoids/CBs and melanocortin receptors (63) , and of the multiple neuroendocrine controls that human sebocytes are subject to (23 , 24 , 26) , including melanocortin receptor-mediated ones (63) , it also deserves to be dissected whether and how CB2-mediated signaling is regulated by other sebaceous neuroendocrine signals and/or modulates their production/activity.

In summary, we have shown the expression of functional CB2 receptors and of key endocannabinoids by human sebocytes, which may utilize this endogenous cannabinoid signaling system for the autocrine and paracrine control of sebocyte lipid production and death in a MAPK pathway-dependent manner.


   ACKNOWLEDGMENTS
 
This work was supported in part by Hungarian research grants (OTKA T049231, OTKA K063153, ETT 480/2006, ETT 482/2006, RET 06/2004) to T.B., by a DFG grant (Pa 345/11–2) to R.P., and by the European Academy of Dermatology and Venereology (EADV) European Dermatology Research Award to C.C.Z. The authors declare no competing financial interests. T.B. is a recipient of the János Bolyai scholarship of the Hungarian Academy of Sciences.

Received for publication April 4, 2008. Accepted for publication June 5, 2008.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Di Marzo, V., Bifulco, M., De Petrocellis, L. (2004) The endocannabinoid system and its therapeutic exploitation. Nat. Rev. Drug Discov. 3,7712-7784
  2. Piomelli, D. (2005) The endocannabinoid system: a drug discovery perspective. Curr. Opin. Investig. Drugs 6,672-679[Medline]
  3. Pacher, P., Batkai, S., Kunos, G. (2006) The endocannabinoid system as an emerging target of pharmacotherapy. Pharmacol. Rev. 58,389-462[Abstract/Free Full Text]
  4. Maldonado, R., Rodríguez de Fonseca, F. (2002) Cannabinoid addiction: behavioral models and neural correlates. J. Neurosci. 22,3326-3331[Abstract/Free Full Text]
  5. Freund, T. F., Katona, I., Piomelli, D. (2003) Role of endogenous cannabinoids in synaptic signaling. Physiol. Rev. 83,1017-1066[Abstract/Free Full Text]
  6. Maldonado, R., Valverde, O., Berrendero, F. (2006) Involvement of the endocannabinoid system in drug addiction. Trends Neurosci. 29,225-232[CrossRef][Medline]
  7. Pacher, P., Bátkai, S., Kunos, G. (2005) Cardiovascular pharmacology of cannabinoids. Handb. Exp. Pharmacol. 168,599-625[CrossRef][Medline]
  8. Storr, M. A., Sharkey, K. A. (2007) The endocannabinoid system and gut-brain signalling. Curr. Opin. Pharmacol. 7,575-582[CrossRef][Medline]
  9. Wright, K. L., Duncan, M., Sharkey, K. A. (2008) Cannabinoid CB2 receptors in the gastrointestinal tract: a regulatory system in states of inflammation. Br. J. Pharmacol. 153,263-270[CrossRef][Medline]
  10. Maccarrone, M., Di Rienzo, M., Battista, N., Gasperi, V., Guerrieri, P., Rossi, A., Finazzi-Agrò, A. (2003) The endocannabinoid system in human keratinocytes. Evidence that anandamide inhibits epidermal differentiation through CB1 receptor-dependent inhibition of protein kinase C, activation protein-1, and transglutaminase. J. Biol. Chem. 278,33896-33903[Abstract/Free Full Text]
  11. Ibrahim, M. M., Porreca, F., Lai, J., Albrecht, P. J., Rice, F. L., Khodorova, A., Davar, G., Makriyannis, A., Vanderah, T. W., Mata, H. P., Malan, T.P., Jr (2005) CB2 cannabinoid receptor activation produces antinociception by stimulating peripheral release of endogenous opioids. Proc. Natl. Acad. Sci. U. S. A. 102,3093-3098[Abstract/Free Full Text]
  12. Ständer, S., Schmelz, M., Metze, D., Luger, T., Rukwied, R. (2005) Distribution of cannabinoid receptor 1 (CB1) and 2 (CB2) on sensory nerve fibers and adnexal structures in human skin. J. Dermatol. Sci. 38,177-188[CrossRef][Medline]
  13. Paradisi, A., Pasquariello, N., Barcaroli, D., Maccarrone, M. (2008) Ananamide regulates keratinocyte differentiation by inducing DNA methylation in a CB1 receptor-dependent manner. J. Biol. Chem. 283,6005-6012[Abstract/Free Full Text]
  14. Rajesh, M., Mukhopadhyay, P., Haskó, G., Huffman, J. W., Mackie, K., Pacher, P. (2008) CB2 cannabinoid receptor agonists attenuate TNF-alpha-induced human vascular smooth muscle cell proliferation and migration. Br. J. Pharmacol. 153,347-357[CrossRef][Medline]
  15. Casanova, M. L., Blazquez, C., Martinez-Palacio, J., Villanueva, C., Fernandez-Acenero, M. J., Huffman, J. W., Jorcano, J. L., Guzman, M. (2003) Inhibition of skin tumor growth and angiogenesis in vivo by activation of cannabinoid receptors. J. Clin. Invest. 111,43-50[CrossRef][Medline]
  16. Blazquez, C., Carracedo, A., Barrado, L., Real, P. J., Fernandez-Luna, J. L., Velasco, G., Malumbres, M., Guzman, M. (2006) Cannabinoid receptors as novel targets for the treatment of melanoma. FASEB J. 20,2633-2635[Abstract/Free Full Text]
  17. Karsak, M., Gaffal, E., Date, R., Wang-Eckhardt, L., Rehnelt, J., Petrosino, S., Starowicz, K., Steuder, R., Schlicker, E., Cravatt, B., Mechoulam, R., Buettner, R., Werner, S., Di Marzo, V., Tüting, T., Zimmer, A. (2007) Attenuation of allergic contact dermatitis through the endocannabinoid system. Science 316,1494-1497[Abstract/Free Full Text]
  18. Telek, A., Bíró, T., Bodó, E., Tóth, B. I., Borbíró, I., Kunos, G., Paus, R. (2007) Inhibition of human hair follicle growth by endo- and exocannabinoids. FASEB J. 13,3534-3541
  19. Paus, R., Cotsarelis, G. (1999) The biology of hair follicles. N. Engl. J. Med. 341,491-497[Free Full Text]
  20. Zouboulis, C. C. (2003) Sebaceous gland in human skin—the fantastic future of a skin appendage. J. Invest. Dermatol. 120,xiv-xv[CrossRef][Medline]
  21. Zouboulis, C. C., Xia, L., Akamatsu, H., Seltmann, H., Fritsch, M., Hornemann, S., Rühl, R., Chen, W., Nau, H., Orfanos, C. E. (1998) The human sebocyte culture model provides new insights into development and management of seborrhoea and acne. Dermatology 196,21-31[CrossRef][Medline]
  22. Toyoda, M., Morohashi, M. (2001) Pathogenesis of acne. Med. Electron Microsc. 34,29-40[CrossRef][Medline]
  23. Zouboulis, C. C., Böhm, M. (2004) Neuroendocrine regulation of sebocytes—a pathogenetic link between stress and acne. Exp. Dermatol. 13(Suppl. 4),31-35[CrossRef][Medline]
  24. Zouboulis, C. C., Eady, A., Philpott, M., Goldsmith, L. A., Orfanos, C., Cunliffe, W. C., Rosenfield, R. (2005) What is the pathogenesis of acne?. Exp. Dermatol. 14,143-152[CrossRef][Medline]
  25. Zouboulis, C. C., Seltmann, H., Neitzel, H., Orfanos, C. E. (1999) Establishment and characterization of an immortalized human sebaceous gland cell line (SZ95). J. Invest. Dermatol. 113,1011-1020[CrossRef][Medline]
  26. Zouboulis, C. C., Seltmann, H., Hiroi, N., Chen, W., Young, M., Oeff, M., Scherbaum, W. A., Orfanos, C. E., McCann, S. M., Bornstein, S. R. (2002) Corticotropin-releasing hormone: an autocrine hormone that promotes lipogenesis in human sebocytes. Proc. Natl. Acad. Sci. U. S. A. 99,7148-7153[Abstract/Free Full Text]
  27. Celso, C. L, Berta, M. A., Braun, K. M., Frye, M., Lyle, S., Zouboulis, C. C., Watt, F. M. (2008) Characterisation of bipotential epidermal progenitors derived from human sebaceous gland: contrasting roles of c-Myc and beta-catenin. Stem Cells 26,1241-1252[CrossRef][Medline]
  28. Batkai, S., Osei-Hyiaman, D., Pan, H., El-Assal, O., Rajesh, M., Mukhopadhyay, P., Hong, F., Harvey-White, J., Jafri, A., Hasko, G., Huffman, J. W., Gao, B., Kunos, G., Pacher, P. (2007) Cannabinoid-2 receptor mediates protection against hepatic ischemia/reperfusion injury. FASEB J. 21,1788-1800[Abstract/Free Full Text]
  29. Bodó, E., Bíró, T., Telek, A., Czifra, G., Griger, Z., Tóth, I. B., Mescalchin, A., Ito, T., Bettermann, A., Kovács, L., Paus, R. (2005) A hot new twist to hair biology: involvement of vanilloid receptor-1 (VR1/TRPV1) signaling in human hair growth control. Am. J. Pathol. 166,985-998[Abstract/Free Full Text]
  30. Bodó, E., Kovács, I., Telek, A., Varga, A., Paus, R., Kovács, L., Bíró, T. (2004) Vanilloid receptor-1 (VR1) is widely expressed on various epithelial and mesenchymal cell types of human skin. J. Invest. Dermatol. 123,410-413[CrossRef][Medline]
  31. Maccarrone, M., Fiorucci, L., Erba, F., Bari, M., Finazzi-Agrò, A., Ascoli, F. (2000) Human mast cells take up and hydrolyze anandamide under the control of 5-lipoxygenase and do not express cannabinoid receptors. FEBS Lett. 468,176-180[CrossRef][Medline]
  32. Nong, L., Newton, C., Friedman, H., Klein, T. W. (2001) CB1 and CB2 receptor mRNA expression in human peripheral blood mononuclear cells (PBMC) from various donor types. Adv. Exp. Med. Biol. 493,229-233[Medline]
  33. Bíró, T., Maurer, M., Modarres, S., Lewin, N. E., Brodie, C., Acs, G., Acs, P., Paus, R., Blumberg, P. M. (1998) Characterization of functional vanilloid receptors expressed by mast cells. Blood 91,1332-1340[Abstract/Free Full Text]
  34. Griger, Z., Páyer, E., Kovács, I., Tóth, B. I., Kovács, L., Sipka, S., Bíró, T. (2007) Protein kinase C-beta and -delta isoenzymes promote arachidonic acid production and proliferation of MonoMac-6 cells. J. Mol. Med. 85,1031-1042[CrossRef][Medline]
  35. Wróbel, A., Seltmann, H., Fimmel, S., Müller-Decker, K., Tsukada, M., Bogdanoff, B., Mandt, N., Blume-Peytavi, U., Orfanos, C. E., Zouboulis, C. C. (2003) Differentiation and apoptosis in human immortalized sebocytes. J. Invest. Dermatol. 120,175-181[CrossRef][Medline]
  36. Tóth, I. B., Géczy, T., Czifra, G., Seltmann, H., Paus, R., Kovács, L., Zouboulis, C. C., Bíró, T. (2005) The vanilloid receptor 1 (TRPV1) is expressed and functionally active on human SZ95 sebocytes. J. Invest. Dermatol. 124,A68
  37. Alestas, T., Ganceviciene, R., Fimmel, S., Müller-Decker, K., Zouboulis, C. C. (2006) Enzymes involved in the biosynthesis of leukotriene B4 and prostaglandin E2 are active in sebaceous glands. J. Mol. Med. 84,75-84[CrossRef][Medline]
  38. Papp, H., Czifra, G., Bodó, E., Lázár, J., Kovács, I., Aleksza, M., Juhász, I., Acs, P., Sipka, S., Kovács, L., Blumberg, P. M., Bíró, T. (2004) Opposite roles of protein kinase C isoforms in proliferation, differentiation, apoptosis, and tumorigenicity of human HaCaT keratinocytes. Cell. Mol. Life. Sci. 61,1095-1105[CrossRef][Medline]
  39. Green, D.R., Reed, J.C. (1998) Mitochondria and apoptosis. Science 281,1309-1312[Abstract/Free Full Text]
  40. Calignano, A., La Rana, G., Giuffrida, A., Piomelli, D. (1998) Control of pain initiation by endogenous cannabinoids. Nature 394,277-281[CrossRef][Medline]
  41. Maccarrone, M., Finazzi-Agró, A. (2003) The endocannabinoid system, anandamide and the regulation of mammalian cell apoptosis. Cell Death Differ. 10,946-955[CrossRef][Medline]
  42. Huffman, J. W. (2000) The search for selective ligands for the CB2 receptor. Curr. Pharm. Des. 6,1323-1337[CrossRef][Medline]
  43. Wagner, J. A., Abesser, M., Karcher, J., Laser, M., Kunos, G. (2005) Coronary vasodilator effects of endogenous cannabinoids in vasopressin-preconstricted unpaced rat isolated hearts. J. Cardiovasc. Pharmacol. 46,348-355[CrossRef][Medline]
  44. Di Marzo, V., Blumberg, P. M., Szallasi, A. (2002) Endovanilloid signaling in pain. Curr. Opin. Neurobiol. 12,372-379[CrossRef][Medline]
  45. Sharkey, K. A., Cristino, L., Oland, L. D., Van Sickle, M. D., Starowicz, K., Pittman, Q. J., Guglielmotti, V., Davison, J. S., Di Marzo, V. (2007) Arvanil, anandamide and N-arachidonoyl-dopamine (NADA) inhibit emesis through cannabinoid CB1 and vanilloid TRPV1 receptors in the ferret. Eur. J. Neurosci. 25,2773-3782[CrossRef][Medline]
  46. Wahl, P., Foged, C., Tullin, S., Thomsen, C. (2001) Iodo-resiniferatoxin, a new potent vanilloid receptor antagonist. Mol. Pharmacol. 59,9-15[Abstract/Free Full Text]
  47. Derkinderen, P., Valjent, E., Toutant, M., Corvol, J. C., Enslen, H., Ledent, C., Trzaskos, J., Caboche, J., Girault, J. A. (2003) Regulation of extracellular signal-regulated kinase by cannabinoids in hippocampus. J. Neurosci. 23,2371-2382[Abstract/Free Full Text]
  48. Ozaita, A., Puighermanal, E., Maldonado, R. (2007) Regulation of PI3K/Akt/GSK-3 pathway by cannabinoids in the brain. J. Neurochem. 102,1105-1114[CrossRef][Medline]
  49. Vellani, V., Petrosino, S., De Petrocellis, L., Valenti, M., Prandini, M., Magherini, P.C., McNaughton, P.A., and Di Marzo, V. (2008) Functional lipidomics. Calcium-independent activation of endocannabinoid/endovanilloid lipid signalling in sensory neurons by protein kinases C and A and thrombin. [E-pub ahead of print] Neuropharmacology. doi:10.1016/j.neuropharm.2008.01.010
  50. Desvergne, B., Wahli, W. (1999) Peroxisome proliferator-activated receptors: nuclear control of metabolism. Endocrin. Rev. 20,649-688[Abstract/Free Full Text]
  51. Kersten, S., Desvergne, B., Wahli, W. (2000) Roles of PPARs in health and disease. Nature 405,421-424[CrossRef][Medline]
  52. Chawla, A., Barak, Y., Nagy, L., Liao, D., Tontonoz, P., Evans, R. M. (2001) PPAR-gamma dependent and independent effects on macrophage-gene expression in lipid metabolism and inflammation. Nat. Med. 7,48-52[CrossRef][Medline]
  53. Szatmari, I., Torocsik, D., Agostini, M., Nagy, T., Gurnell, M., Barta, E., Chatterjee, K., Nagy, L. (2007) PPARgamma regulates the function of human dendritic cells primarily by altering lipid metabolism. Blood 110,3271-3280[Abstract/Free Full Text]
  54. Lenman, A., Fowler, C. J. (2007) Interaction of ligands for the peroxisome proliferator-activated receptor gamma with the endocannabinoid system. Br. J. Pharmacol. 151,1343-1351[CrossRef][Medline]
  55. O'Sullivan, S. E. (2007) Cannabinoids go nuclear: evidence for activation of peroxisome proliferator-activated receptors. Br. J. Pharmacol. 152,576-582[CrossRef][Medline]
  56. Chen, W., Yang, C. C., Sheu, H. M., Seltmann, H., Zouboulis, C. C. (2003) Expression of peroxisome proliferator-activated receptor and CCAAT/enhancer binding protein transcription factors in cultured human sebocytes. J. Invest. Dermatol. 121,441-447[CrossRef][Medline]
  57. Trivedi, N. R., Cong, Z., Nelson, A. M., Albert, A. J., Rosamilia, L. L., Sivarajah, S., Gilliland, K. L., Liu, W., Mauger, D. T., Gabbay, R. A., Thiboutot, D. M. (2006) Peroxisome proliferator-activated receptors increase human sebum production. J. Invest. Dermatol. 126,2002-2009[CrossRef][Medline]
  58. Yoon, J. C., Chickering, T. W., Rosen, E. D., Dussault, B., Qin, Y., Soukas, A., Friedman, J. M., Holmes, W. E., Spiegelman, B. M. (2000) Peroxisome proliferator-activated receptor gamma target gene encoding a novel angiopoietin-related protein associated with adipose differentiation. Mol. Cell. Biol. 20,5343-5349[Abstract/Free Full Text]
  59. Shappell, S. B., Gupta, R. A., Manning, S., Whitehead, R., Boeglin, W. E., Schneider, C., Case, T., Price, J., Jack, G. S., Wheeler, T. M., Matusik, R. J., Brash, A. R., Dubois, R. N. (2001) 15S-Hydroxyeicosatetraenoic acid activates peroxisome proliferator-activated receptor gamma and inhibits proliferation in PC3 prostate carcinoma cells. Cancer Res. 61,497-503[Abstract/Free Full Text]
  60. Vosper, H., Patel, L., Graham, T. L., Khoudoli, G. A., Hill, A., Macphee, C. H., Pinto, I., Smith, S. A., Suckling, K. E., Wolf, C. R., Palmer, C. N. (2001) The peroxisome proliferator-activated receptor delta promotes lipid accumulation in human macrophages. J. Biol. Chem. 276,44258-44265[Abstract/Free Full Text]
  61. Zhang, Q., Seltmann, H., Zouboulis, C. C., Konger, R. L. (2006) Involvement of PPARgamma in oxidative stress-mediated prostaglandin E(2) production in SZ95 human sebaceous gland cells. J. Invest. Dermatol. 126,42-48[CrossRef][Medline]
  62. Matias, I., Vergoni, A. V., Petrosino, S., Ottani, A., Pocai, A., Bertolini, A., Di Marzo, V. (2008) Regulation of hypothalamic endocannabinoid levels by neuropeptides and hormones involved in food intake and metabolism: insulin and melanocortins. Neuropharmacology 54,206-212[CrossRef][Medline]
  63. Ganceviciene, R., Graziene, V., Böhm, M., Zouboulis, C. C. (2007) Increased in situ expression of melanocortin-1 receptor in sebaceous glands of lesional skin of patients with acne vulgaris. Exp. Dermatol. 16,547-552[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.07-104877v1
22/10/3685    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dobrosi, N.
Right arrow Articles by Bíró, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dobrosi, N.
Right arrow Articles by Bíró, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS