FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.07-8739com.
(The FASEB Journal. 2008;22:236-245.)
© 2008 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.07-8739comv1
22/1/236    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, N.
Right arrow Articles by Napoli, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, N.
Right arrow Articles by Napoli, J. L.
(The FASEB Journal. 2008;22:236-245.)
© 2008 FASEB

All-trans-retinoic acid stimulates translation and induces spine formation in hippocampal neurons through a membrane-associated RAR{alpha}

Na Chen and Joseph L. Napoli1

Nutritional Science and Toxicology, University of California, Berkeley, California, USA

1Correspondence: 119 Morgan Hall, MC#3104, University of California, Berkeley, CA 94720, USA. E-mail: jna{at}berkeley.edu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Differentiation and patterning in the developing nervous system require the vitamin A metabolite all-trans-retinoic acid (atRA). Recent data suggest that higher cognitive functions, such as creation of hippocampal memory, also require atRA and its receptors, RAR, through affecting synaptic plasticity. Here we show that within 30 min atRA increased dendritic growth ~2-fold, and PSD-95 and synaptophysin puncta intensity ~3-fold, in cultured mouse hippocampal neurons, suggesting increased synapse formation. atRA (10 nM) increased ERK1/2 phosphorylation within 10 min. In synaptoneurosomes, atRA rapidly increased phosphorylation of ERK1/2, its target 4E-BP, and p70S6K, and its substrate, ribosome protein S6, indicating activation of MAPK and mammalian target of rapamycin (mTOR). Immunofluoresence revealed intense dendritic expression of RAR{alpha} in the mouse hippocampus and localization of RAR{alpha} on the surfaces of primary cultures of hippocampal neurons, with bright puncta along soma and neurites. Surface biotinylation confirmed the locus of RAR{alpha} expression. Knockdown of RAR{alpha} by shRNA impaired atRA-induced spine formation and abolished dendritic growth. Prolonged atRA stimulation reduced surface/total RAR{alpha} by 43%, suggesting internalization, whereas brain-derived nerve growth factor or bicuculline increased the ratio by ~1.8-fold. atRA increased translation in the somatodendritic compartment, similar to brain-derived nerve growth factor. atRA specifically increased dendritic translation and surface expression of the {alpha}-amino-3-hydroxyl-5-methyl-4-isoxazole propionate receptor (AMPAR) subunit 1 (GluR1), without affecting GluR2. These data provide mechanistic insight into atRA function in the hippocampus and identify a unique membrane-associated RAR{alpha} that mediates rapid induction of neuronal translation by atRA.—Chen, N., Napoli, J. L. All-trans-retinoic acid stimulates translation and induces spine formation in hippocampal neurons through a membrane-associated RAR{alpha}.


Key Words: vitamin A • cytoskeleton remodeling • GluR • dendritic protein synthesis


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
VERTEBRATES REQUIRE THE VITAMIN A (retinol) metabolite all-trans-retinoic acid (atRA) for reproduction, development, growth, and survival (1) . atRA regulates differentiation and functions of many cell types, including epithelial, immune, and nerve cells (2 3 4 5) . Nervous system development depends on atRA for patterning of the hindbrain anterior/posterior axis and the spinal cord dorsal/ventral axis, and interneuron and motor neuron specification (6) . In neural crest cells, embryonic stem cells, and established neuronal cell lines (e.g., PC12, Ntera2), atRA induces differentiation into region-specific central or peripheral nervous system progeny (6 , 7) . Members of the nuclear receptor family, RAR{alpha}, β, and {gamma}, mediate atRA action (8) . The distinct RAR subtypes have been associated with distinct, but sometimes overlapping, retinoid functions (8 , 9) . The liganded receptors are best known for their ability to bind to response elements in the promoters of target genes and induce transcription.

The developed nervous system also relies on atRA signaling, notably in synaptic plasticity that underlies hippocampus-dependent spatial learning and memory. RARβ-null mice exhibit severely compromised performance in the Morris water maze, an assessment of spatial learning (10) . Rats and mice restricted in dietary vitamin A make markedly more errors than controls in the radial arm maze, another measurement of hippocampus-dependent learning (11) . Replenishing dietary vitamin A reverses the defects in rats and attenuates the defects in mice. Retinoid effects on learning and memory extend to aged mice. Compared with younger adult mice (4–5 months), aged mice (21–23 months) exhibit relational memory deficits, also reversible by atRA dosing (12) . Long-lasting, activity-dependent changes in synaptic efficacy, i.e., long-term potentiation (LTP) and long-term depression (LTD), provide leading cellular mechanisms for learning and memory (13) . Vitamin A deprivation in adult mice reduces LTP and abolishes LTD in the hippocampus (14) . Acute treatment of vitamin A-depleted hippocampal slices with atRA rescues these defects. Little or no insight, however, has been forthcoming into mechanism(s) of these atRA effects.

Dendritic spines provide contact sites for most excitatory synaptic inputs in the brain (15) . Spines are thought to derive from filopodia, slender, highly motile, headless structures prevalent early in development (16 17 18) . Quantitative and ultrastructure analysis of spines and filopodia in developing hippocampal neurons suggest that dendritic filopodia serve as the direct precursors to spines (18) . Time-lapse images support this conclusion, revealing that dendritic filopodia make iterative contacts with axons en passant, followed by formation of synaptic boutons and addition of pre- and postsynaptic proteins, culminating in synaptogenesis (16 , 19 20 21 22) .

Activity dynamically shapes spines. Induction of LTP stimulates formation and enlargement of spines, whereas induction of LTD causes spine shrinkage and elimination (23 24 25 26) . Stimulation of the N-methyl-D-aspartate receptor (NMDAR) leads to growth of spine-like protrusions from dendrites (26 , 27) , whereas activation of AMPAR inhibits spine motility, producing more regular and stable spines (28) . AMPAR activity also maintains spines. Blocking AMPAR activity with botulinum toxin A or C, which blocks vesicular glutamate release, markedly reduces spines (29) . Thus, NMDAR activation initiates spine dynamics, followed by AMPAR-dependent stabilization and maintenance.

Enduring modification of synaptic strength often involves changes in the postsynaptic AMPAR content (30 -2 ). Activity bidirectionally regulates transport of mRNA to dendrites that encode the AMPAR subunits GluR1 and GluR2 (33) . These mRNA undergo dendritic translation, followed by incorporation of the translated AMPAR subunits into the synaptic membrane (34) . Distinct regulation of dendritic GluR1 and GluR2 synthesis facilitates AMPAR recomposition, which underlies various forms of plasticity. For example, activation of the dopamine receptor induces a rapid form of synaptic enhancement, mediated by an increase in dendritic GluR1 translation (35) . During homeostatic scaling, a form of plasticity elicited by chronic activity blockade, GluR1 undergoes translation locally and incorporation into the synaptic membrane, followed by gradual replacement with GluR2-containing AMPARs (36) .

Here we report that atRA signaling contributes to spine formation in hippocampal neurons and does so through an unconventional mechanism for retinoids. This effect relies on an RAR{alpha} unexpectedly targeted to the neuronal membrane. Furthermore, we show that atRA function through RAR{alpha} modifies translation, but not transcription, leading to an increase of GluR1 in the synaptic compartment.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Cultures and transfections
Hippocampal neurons were dissected from E17–18 C57/Black 6 mouse embryos, and cultured in DMEM with 10% FBS on plates or glass cover slips precoated with poly-D-Lysine (Sigma, St. Louis, MO, USA). Neurons were plated in 24-well (1x105 cells/well) or 6-well (5x105 cells/well) plates. Four hours after initial culture, the medium was replaced with neurobasal medium containing 2% B27 supplement (Invitrogen, Carlsbad, CA, USA). Half of the medium was replenished each week. After 1 wk culture, 2 µM Ara C (Sigma) was added to prevent glia proliferation. Neurons were transfected with Lipofectamine 2000 (Invitrogen) on days in vitro (DIV) 9–12 for 24 to 48 h. atRA and inhibitors were obtained from Sigma or EMD Chemicals (San Diego, CA, USA), and added in DMSO (final concentration 0.1%): actinomycin (10 µg/ml); anisomycin (40 µM); AGGC (50 µM); cycloheximide (50 µg/ml); cytochalasin D (10 µM); KT5720 (1 µM); U0126 (10 µM).

Immunofluorescent staining
Neurons grown on cover slips were fixed with 4% paraformaldehyde/4% sucrose for 10–15 min, permeabilized with 0.2% Triton X-100 for 5 min and blocked with PBS containing 10% goat serum for 1 h at room temperature. Neurons were incubated with antibodies (Ab) raised against RAR{alpha}, RARβ, RAR{gamma} (1:200, Santa Cruz Biotech, Santa Cruz, CA, USA, or Millipore, Billerica, MA, USA), synaptophysin (1:200, Millipore, Billerica, MA, USA), MAP2 (1:1000, Millipore) or PSD-95 (1:200, Affinity Bioreagents, Golden, CO, USA) overnight at 4°C, followed by three 5-min washes in PBS. Alexa 350, Alexa 488 and Alexa 555 secondary Ab (1:50 to 1:250, Invitrogen) incubations were done for 1 h at room temperature. Alexa 594-conjugated phalloidin was obtained from Invitrogen and used according to the manufacturer’s instructions. Immunohistochemistry with mouse brain cryosections (30 µm, from 3-month-old C57/Black 6 mice) was done similarly, except sections were postfixed with 4% PFA for 1 h and blocked with 10% goat serum and 0.2% Triton X-100-supplemented PBS overnight at 4°C. For surface staining of GluR2 and RAR{alpha}, live neurons were incubated with mouse Ab raised against the extracellular domain of GluR2 (10 µg/ml, Invitrogen), rabbit anti-RAR{alpha} C-20 (1:50, Santa Cruz Biotech), or mouse anti-RAR{alpha} MAB5346 (1:50, Millipore) for 30 min at 4°C. Neurons were rinsed with PBS, fixed, and processed for secondary Ab staining as described above.

Surface biotinylation
Neurons were rinsed with progressively cooler (room temperature, 10°C and 4°C) PBS containing 1 mM MgCl2 and 2.5 mM CaCl2, followed by incubation with 1.5 mg/ml sulfo-NHS-biotin reagent (Pierce, Rockford, IL, USA) in PBS for 15 min at 4°C. Unreacted biotin was quenched with cold 50 mM glycine (Sigma) in PBS. Cells were scrapped into modified RIPA buffer with 0.5% Triton X-100, sonicated, and centrifuged at 12,000 g for 10 min. The supernatant was incubated for 1 h at room temperature with Streptavidin MagneSphere beads (Promega, Madison, WI, USA). MagneSphere beads were isolated with a magnetic stand (Qiagen, Valencia, CA, USA) and washed with RIPA buffer 3 times. Bound proteins were eluted with Laemmli buffer (Bio-Rad, Hercules, CA, USA).

mRNA reporter, RAR{alpha} siRNA, and shRNA constructs
A reporter mRNA template was generated by PCR amplification of a 160 nt fragment of the CaMKII {alpha} 3'-UTR distal region, which confers translation regulation (37) , from mouse brain cDNA, and the EGFP-coding region from pEGFP-N1 plasmid (Clontech, Mountain View, CA, USA), both of which were ligated into pBluescript (Promega) for transcription in vitro with T7 Message Machine (Ambion, Austin, TX, USA). The reporter mRNA was transfected into DIV10 neurons with transmessenger reagent (Qiagen, Valencia, CA, USA) following manufacturer’s protocol. atRA (1 µM) and BDNF (100 ng/ml in H2O) were added immediately after transfection. EGFP-positive neurons were scored 18 h after treatment in 5 randomly selected panels from at least 3 coverslips per experiment. Experiments were repeated 3 times, and the data were pooled.

The siRNA duplexes were purchased from Dharmacon (Lafayette, CO, USA) or Santa Cruz Biotech. siRNA was transfected into HEK or neurons with Lipofectamine 2000 (Invitrogen) or Transmessenger (Qiagen). The RAR{alpha} shRNA sequence was designed based on published guidelines (38) : 5'– AAGCCTTGCTTTATTTGTCAGTACAAATATTCATTGTATTGACAAACAAAGCAAGGCTT–3'. Oligos were annealed and cloned into pSuppressor-Neo (Imgenex, San Diego, CA, USA) to produce pSuppressor-Neo-RAR{alpha} shRNA. The shRNA plasmids were cotransfected with pEGFP-N1 (Clontech) using Lipofectamine 2000 (Invitrogen). Firefly luciferase siRNA or shRNA was used as control. Analyses of siRNA and shRNA effects were done 48 h after transfection.

Synaptoneurosomes and immunoblots
Synaptoneurosomes were prepared from 1-month-old C57/Black 6 mice as described (39) . Purity was verified by immunoblotting for GFAP (glia marker), laminin (a nuclear protein), PSD-95 and synaptophysin (synaptic proteins). Isolated synaptoneurosomes were kept in a 37°C incubator for at least 10 min before treatment. After atRA (1 µM) treatment, synaptoneurosomes were solubilized with SDS sample buffer (2% SDS in 50 mM Tris-HCl, pH 7.5) preheated to 95°C and were subjected to 4–15% gradient SDS-PAGE. Proteins were transferred onto a nitrocellulose membrane and blotted with phosphorylated ERK1/2 (1:2000), p70S6K, S6, or 4EBP (1:1000, Millipore) Ab, or GluR1 (1:2000, Millipore, Billerica, MA, USA), GluR2 (1:2000, Invitrogen, Carlsbad, CA, USA), PSD-95 (1:2000, Affinity Bioreagents), Tuj1, transferrin receptor, and total ERK1/2 (1:2000, Millipore) Ab for 3 h at room temperature or overnight at 4°C. Blots were washed with PBST, incubated with secondary Ab for 1 h at room temperature, and developed with SuperSignal West Pico Chemoluminescent Kit (Pierce, Rockford, IL, USA). Signals were quantified with densitometry. Immunoblot experiments were repeated at least three times. For experiments that examined pERK1/2, surface/total RAR{alpha}, and synaptoneurosome or surface/total GluR1, band intensities, and surface/total ratios from the vehicle-treated controls were assigned a value of 1. Band intensities and ratios of the treated groups were expressed relative to the controls and averaged.

Image acquisition and quantification
Z-stacked images were acquired on a Zeiss LSM 510 laser scanning confocal microscope. Each experiment was repeated 3 to 5 times. Neuronal images for analysis were selected randomly and quantified by an investigator blind to the treatments. For analysis of dendritic spines, z-stacks were acquired with a x63 (N.A. 1.4) oil immersion Plan-Apochromat objective with a x2 digital zoom (or x4 digital zoom for higher magnification). To count spines or to quantify fluorescent signals, two to three 100 µm segments were chosen from dendrites of similar calibers in each cell: 8–10 neurons were analyzed for each condition. Spines in blinded samples were traced manually and counted. The data were normalized to 10 µm of dendrites. We used customized MATLAB 6.5 software to quantify immunofluorescent intensity. Individual density and intensity measurements were grouped and averaged per neuron. Means from different neurons were then averaged. Live imaging was done in neurobasal medium supplemented with 10 mM HEPES. Inhibitor treatment began 10 to 30 min before atRA (1 µM) addition. Quantification of dendritic growth after atRA dosing included filopodia, defined as headless dendritic protrusions 0.5–3 µm long.

Statistics
Statistical differences were calculated using an unpaired, two-tailed Student’s t test, except for the experiment examining the atRA effect on control or RAR{alpha} knockdown neurons, where we used two-way ANOVA. Data in bar graphs represent means ± SEM.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
atRA induces dendritic growth rapidly
atRA induced a 2-fold increase in dendritic protrusions (3.2±0.6 vs. 6.7±0.9, P<0.0001, n=10 neurons), including spines (defined as <0.5 µm dendritic protrusions with rounded heads at least twice the diameter of the neck) and filopodia (defined as headless dendritic protrusions 0.5–3 µm long) in cultured mouse hippocampal neurons by 30 min (Fig. 1 A). Filopodia seem to function as explorative precursors for dendritic spine and synapse formation (16 17 18 , 40 , 41) . To test for synapse formation, we fixed neurons immediately after atRA treatment and stained them with the synaptic markers PSD-95 (a scaffold protein at the postsynaptic density) or synaptophysin (a presynaptic vesicle protein) (42) . We costained cells with phalloidin, which binds specifically to filamentous actin (F-actin), and an antimicrotubule associated protein 2 (MAP2) Ab, to visualize the cytoskeleton (Fig. 1B ). Phalloidin staining demonstrated that atRA induced expansion (thickening) of F-actin, in contrast to the unaltered microtubules revealed by MAP2 staining. atRA increased the fluorescence intensity of PSD-95 and synaptophysin ~3-fold, suggesting an increase in the number of synapses (Fig. 1B ). Notably, PSD95 and synaptophysin puncta occurred along the length, and often at the tips of the extended actin bundles. These results indicated that atRA induces spine formation and possibly initiates synapse formation within 30 min.


Figure 1
View larger version (64K):
[in this window]
[in a new window]

 
Figure 1. atRA induces rapid dendritic growth and MAPK activation in cultured neurons. A) DIV11 hippocampal neurons transfected with EGFP were treated with vehicle or atRA for 30 min. The bottom panels show higher magnifications of representative dendritic segments: scale bars, 25 µm. B) DIV11 neurons were treated with vehicle or atRA for 30 min, fixed, and stained for MAP2 (blue), PSD-95 or synaptophysin (green), and phalloidin (red). The three channels of each set were merged (merge). Representative dendritic segments are shown; scale bar, 10 µm. Bottom graph: quantification of the mean fluorescent intensities of PSD-95 (orange bars) and synaptophysin (blue bars) puncta; *P < 0.001, n = 8 neurons. C) Impact of inhibitors on dendritic growth (defined in the text) of DIV10–11 neurons treated with atRA for 10 min; *P < 0.01, n = 6 neurons. D) Representative dendritic images of DIV11 neurons treated with vehicle or atRA for 10 min, in the absence (no inhibitor) or presence of cytochalasin D. Note that the dendritic protrusions induced by atRA were absent in cytochalasin D-treated cells; scale bar, 25 µm. E) DIV12 neurons were treated with increasing concentration of atRA for 10 or 30 min. Lysates were immunoblotted for phosphorylated ERK1/2 (pERK1/2) and total ERK1/2 (tERK1/2). F) DIV12 neurons were treated with atRA for the times indicated. Lysates were analyzed as described in E. Right panel: quantification of three experiments.

We imaged EGFP-expressing neurons exposed to atRA in the presence of inhibitors to gain insight into the mechanism of this rapid effect. Within 10 min, atRA induced an average growth of 1.5 ± 0.05 protrusions per 10 µm dendrite, n = 5 (Fig. 1C, D ). At this time, most atRA-induced growth was filopodia-like. The MEK inhibitor U0126, the Ras inhibitor AGGC, and the actin depolymerization drug cytochalasin D, each prevented dendritic growth, whereas the protein kinase A inhibitor KT5720 had no effect. These results suggest involvement of the Ras-MAPK pathway and actin remodeling in atRA-induced dendritic growth.

The rapid onset of atRA action, and the impact of Ras-MEK inhibitors, suggested a nontranscriptional mechanism involving MAPK signaling. MAPK activation induces cytoskeletal rearrangement and dendritic translation in hippocampal neurons, producing persistent dendritic growth (43 , 44) , and atRA stimulates the MAPK pathway in non-neuronal cells (45 , 46) . Therefore, we probed atRA activation of MAPK with phosphorylated ERK1/2 Ab. Within 10 min, atRA increased phosphorylation of ERK1/2 in a dose-dependent manner (Fig. 1E ), without altering total ERK1/2. Activation subsided after prolonged atRA treatment (Fig. 1F ). These data indicate that MAPK activation underlies atRA-induced structural growth.

RAR{alpha} localizes to the neuronal membrane
Immunostaining of cryosections from the mouse hippocampus revealed that the dendritic region expressed RAR{alpha} intensely, whereas somatic and axonal expression occurred to a much lesser extent (Fig. 2 A). In contrast, RARβ expression concentrated in the cell soma. We did not detect RAR{gamma} (47) . Dendritic localization of RAR{alpha} and nuclear localization of RARβ were confirmed in cultured neurons (data not shown). This unexpected dendritic expression suggests that RAR{alpha} may mediate the rapid atRA-induced signaling.


Figure 2
View larger version (47K):
[in this window]
[in a new window]

 
Figure 2. RAR{alpha} localizes to the dendritic membrane. A) Coronal cryosections from adult mouse brain were stained with anti-RAR{alpha} or RARβ Ab. The figure shows the hippocampal CA1 region: Rad, stratum radiatum; Or, stratum oriens; Py, stratum pyramidale; Mol, stratum moleculare: scale bar, 100 µm. B) DIV12 neurons were surface biotinylated, and the fractions indicated were immunoblotted for RAR{alpha}, GluR2, or Tuj1. C) Representative images of live DIV12–13 neurons stained with anti-RAR{alpha}, GluR2, or CaMKII{alpha} Ab, followed by fixation and secondary Ab staining. The two RAR{alpha} Ab (MAB5346 and C-20) recognize different epitopes. The epitope for MAB5346 maps to the N terminus, whereas C-20 recognizes the last 20 amino acids of RAR{alpha}; scale bar, 10 µm. D) DIV12–15 neurons were surface biotinylated after vehicle or atRA treatment (1 µM, 30 min). The fractions indicated were immunoblotted for RAR{alpha}: **P < 0.0001. E) DIV12–18 neurons were surface biotinylated following indicated treatments. Indicated fractions were immunoblotted for RAR{alpha}. Bottom graphs in (D) and (E): quantification of three independent experiments; *P < 0.001, **P < 0.00001.

Some nuclear receptors localize to the plasma membrane or the endoplasmic reticulum, and transduce nongenomic ligand signaling (48 49 50) . To test for localization of RAR{alpha} in the plasma membrane, we biotinylated the surface proteins from cultured neurons and isolated the biotinylated fraction with streptavidin beads. Immunoblots demonstrated the presence of RAR{alpha} and the membrane receptor GluR2, but not the intracellular protein Tuj1 in the surface fraction (streptavidin pull-down) (Fig. 2B ). Ab staining of live neurons confirmed the surface expression of RAR{alpha} (Fig. 2C ). Two different RAR{alpha} Ab each labeled bright puncta along the cell soma and neurites, similar to those observed for GluR2. The Ab to an abundant cytoplasmic protein, calcium-calmodulin dependent protein kinase II {alpha} (CaMKII {alpha}), produced no signal in sister cultures, validating cell membrane integrity. Immunostaining of fixed and nonpermeabilized cells yielded similar results (data not shown). Significantly, atRA reduced the ratio of surface to total RAR{alpha} by 43%, indicating ligand-induced endocytosis (Fig. 2D ). Stimulating neurons with brain-derived nerve growth factor (BDNF) or bicuculline, a GABA-receptor antagonist, each increased the ratio of surface to total RAR{alpha} by ~1.8-fold, whereas blocking action potential with tetrodotoxin (TTX) had no marked effect (Fig. 2E ). Taken together, these results demonstrate the ligand- and activity-dependent regulation of a distinct pool of RAR{alpha} on the neuronal surface.

RAR{alpha} mediates atRA-dependent spine formation
We used siRNA to assess the contribution of RAR{alpha} to atRA-induced spine formation. Because siRNA generally transfects more efficiently than plasmids (data not shown) and may affect nearby non-EGFP-expressing neurons, we also designed a Pol III-driven RAR{alpha}-specific small hairpin RNA (shRNA) expression cassette to ensure that knockdown occurred only in EGFP-expressing cells. Both siRNA and shRNA eliminated expression of a cotransfected EGFP-RAR{alpha} fusion protein in HEK293 cells and COS cells, without affecting β-actin, verifying their specificities (Fig. 3 A). Neurons transfected with RAR{alpha} siRNA and shRNA had 60% and 70% fewer spines, respectively (Fig. 3B ). Notably, atRA increased dendritic protrusions in control shRNA-transfected, but not RAR{alpha} shRNA-transfected neurons (Fig. 3C ). These data indicate that RAR{alpha} mediates atRA signaling in hippocampal neurons to promote spine formation.


Figure 3
View larger version (32K):
[in this window]
[in a new window]

 
Figure 3. Knockdown of RAR{alpha} reduces spines and abolishes atRA effects. A) HEK cells were cotransfected with EGFP-RAR{alpha} and control siRNA (control) or RAR{alpha} siRNA (RAR{alpha}). COS cells were cotransfected with EGFP-RAR{alpha} and pSuppressor-Neoluc shRNA (control) or pSuppressor-Neo-RAR{alpha} shRNA (RAR{alpha}). Lysates were prepared 48 h after transfection and immunoblotted for RAR{alpha} or β-actin. B) Representative images of DIV10 neurons cotransfected with EGFP and control siRNA or RAR{alpha} siRNA for 48–72 h. The bottom panels show higher magnifications of the boxed regions in the top panels scale bars, 10 µm. Top-right graph: quantification of spines in control siRNA/shRNA (control) or RAR{alpha} siRNA/shRNA (RAR{alpha}) transfected neurons; *P < 0.01, n = 10 neurons. C) DIV10 neurons were cotransfected with EGFP and control shRNA (control) or RAR{alpha} shRNA (RAR{alpha}) for 48 h and treated with vehicle (orange) or atRA (blue) for 30 min. Dendritic protrusions (including spines and filopodia) in each group were quantified and normalized to the vehicle-treated control-shRNA-transfected group; *P < 0.01, n = 6 neurons per group.

atRA induces neuronal translation
Rapid activation of MAPK and the contribution of MAPK to neuronal translation suggest a mechanism of atRA action (37 , 51) . To test whether atRA induces translation, we transfected neurons with an mRNA encoding a EGFP reporter appended with a 160-bp segment of CaMKII {alpha} 3'-UTR, which confers translational regulation, as used previously to probe translation regulation by MAPK in neurons (37) . atRA increased the number of EGFP-positive cells >2-fold (Fig. 4 A, B), similar to the effects of BDNF, a translation stimulator (37) . The translation inhibitor anisomycin, but not the transcription inhibitor actinomycin, prevented the increase in EGFP expression, confirming an atRA effect on translation. To test whether atRA affected mRNA stability, we transfected neurons with CaMKII –3'UTR-GFP mRNA, treated them with DMSO or atRA, and used real-time PCR to quantify the amount of RNA after treatment. There was no difference in reporter mRNA levels normalized to β-actin between the two groups: GluR1/β-actin of DMSO (0.65±0.16) vs. RA-treated (0.63±0.05), mean ± SEM, n = 3.


Figure 4
View larger version (43K):
[in this window]
[in a new window]

 
Figure 4. atRA enhances neuronal translation and activates both MAPK and mTOR signaling in synaptoneurosomes. A) Representative images of CaMKII {alpha} 3'UTR-EGFP reporter expression in DIV10 neurons treated with vehicle, atRA, or BDNF, or atRA with the translation inhibitor anisomycin (AN) or the transcription inhibitor actinomycin (AC). Inhibitors were added 30 min before atRA; scale bar, 100 µm. B) Quantification of EGFP-positive cells; *P < 0.001 relative to vehicle, n = 6 to 10 coverslips from 3 different cultures. Semiquantitative RT-PCR analysis of EGFP mRNA showed similar transfection efficiencies among groups (data not shown). C) Synaptoneuosomes were treated with vehicle or atRA for 15 or 30 min. Lysates were immunoblotted for the proteins indicated. Experiments were repeated at least twice with similar results.

In addition, rapid MAPK activation (ERK1/2) was observed in synaptoneurosomes, with a concomitant increase in phosphorylation of its target, eIF4E binding protein 4E-BP (Fig. 4C ). Brief atRA treatment also increased phosphorylation of p70S6K and its substrate, ribosome protein S6, indicating activation of mammalian target of rapamycin (mTOR), which acts upstream of p70S6K. MAPK and mTOR regulate cap-dependent translation and 5'-oligopyrimidine tract-containing ribosomal protein and translation factor synthesis (51) . These results suggest that atRA increases general translation efficiency and capacity in the somatodendritic compartment.

atRA increases surface expression and dendritic translation of GluR1
Next, we sought to identify targets of atRA-stimulated translation. Glutamate receptors (GluR1 and GluR2) and synaptic scaffold protein PSD-95 can be translated locally in dendrites (33 , 34 , 52 53 54) . In synaptoneurosomes. atRA treatment induced a small (25%) but consistent increase in GluR1 (Fig. 5 A), without changing GluR2 or PSD-95 expression. The translation inhibitor cycloheximide prevented the atRA-induced increase in GluR1, confirming translational regulation. The proteasome inhibitor, MG132, raised the GluR1 steady-state level by 2-fold, obscuring the small increase in GluR1 induced by atRA. Consistent with this, cycloheximide treatment did not change basal or MG132-enhanced GluR1, indicating a quantitatively minor contribution of newly translated GluR1 to the steady-state pool.


Figure 5
View larger version (31K):
[in this window]
[in a new window]

 
Figure 5. atRA increases dendritic translation and membrane expression of GluR1. A) Synaptoneurosomes were treated with vehicle or atRA (1 µM, 10 min) and incubated further in fresh medium for 30 min. Lysates were immunoblotted for GluR1, GluR2, PSD-95, or Tuj1. Cycloheximide (CHX) and/or MG132 were added 20–30 min before atRA. Bottom panel: quantification of immunoblots from 4 independent experiments (*P<0.05, relative to vehicle alone); GluR1 (gray), GluR2 (white), PSD-95 (black). B) DIV14–17 neurons were treated with vehicle or atRA for 15 or 30 min, surface biotinylated and the fractions indicated were immunoblotted for GluR1, GluR2, or the transferrin receptor (TR). Right: quantification of immunoblots from 3 independent experiments (*P<0.001, relative to vehicle alone); GluR1 (gray), GluR2 (white), TR (black).

Thirty-five to forty percent of newly synthesized AMPAR move to the dendritic membrane, where they await activity-dependent synaptic recruitment (34 , 55 , 56) . Activation of synaptic AMPAR stabilizes actin and maintains spines (28 , 29) . Enhancement of dendritic GluR1 synthesis by atRA, and the specific requirement of GluR1 in synaptic AMPAR expression (13 , 57) , suggest that atRA-induced spine formation may involve an increase in surface AMPAR. Indeed, surface biotinylation demonstrated that atRA elevated the ratio of surface to total GluR1 by 50% within 15 to 30 min (Fig. 5B ), without affecting the ratios surface/total GluR2 or transferrin receptor. These results indicate that atRA specifically modulates dendritic synthesis and surface expression of GluR1.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
atRA has been used widely to induce differentiation of stem cells into neurons and glia (58 , 59) . In vivo, atRA promotes differentiation and survival of adult neural stem cells in the hippocampal dentate gyrus and controls the number, timing, and subtype of motor neurons produced in the spinal cord (60) . These effects require prolonged atRA exposure and seem to rely on transcription. Here, we have demonstrated nontranscriptional atRA signaling in relatively differentiated neurons. The observations of a membrane-associated RAR{alpha} and atRA-induced translation were unexpected, because the prevailing insight into atRA and RAR action has centered on transcription (7 , 10 , 61) , and the initial association between atRA and synaptic plasticity was made in the RARβ-null mouse (10) .

atRA acts through several mechanisms to promote spine formation (Fig. 6 ). First, atRA initiates actin dynamics, evident by rapid filopodia growth. Dendritic growth occurs almost immediately (less than 5 min) after atRA stimulation and may serve as the platform for later atRA-dependent modifications. Second, atRA enhances dendritic translation, indicated by activated MAPK and mTOR signaling, major regulatory pathways of neuronal translation (51) , and increased expression of a reporter bearing a CaMKII {alpha} mRNA regulatory element. Dendritic protein synthesis and growth mechanisms interact to implement persistent structure and synaptic modification (62 63 64) . atRA-induced translation may maintain initial structural growth. Consistent with this, translation inhibition by anisomycin nearly abolished atRA-induced spine formation (data not shown). Third, atRA increases dendritic translation and surface expression of GluR1. GluR1 insertion is required for activity-driven AMPAR trafficking to the synapse and involves two steps: activity-independent extrasynaptic insertion and activity-dependent synaptic recruitment/stabilization (54 , 57 , 65) . The atRA-dependent increase in surface GluR1 occurs in the presence of the NMDAR antagonist DL-2-amino-5-phosphonovaleric acid (data not shown), suggesting that insertion occurs extrasynaptically and independent of synaptic NMDAR activation. Locally synthesized GluR1 readily incorporates into the dendritic membrane and may contribute to the synaptic AMPAR recomposition that supports synaptic plasticity (35 , 36) . Therefore, atRA-induced GluR1 translation and membrane targeting may prime activity-dependent synaptic recruitment of AMPAR. Synaptic AMPAR activity would in turn stabilize actin and transform atRA-induced growth into persistent spines (28 , 29) .


Figure 6
View larger version (17K):
[in this window]
[in a new window]

 
Figure 6. A model of atRA signaling in hippocampal neurons. atRA/RAR{alpha} initiates actin remodeling and dendritic translation through activation of the Ras-MAPK and mTOR pathways. In addition, atRA/RAR{alpha} increases dendritic translation and surface expression of GluR1, priming an increase in synaptic GluR1, and therefore AMPAR, expression. Synaptic AMPAR activity in turn would stabilize actin dynamics and consolidate atRA-induced spines. Dendritic synthesis of other proteins induced by atRA also may contribute to spine formation.

Administration of atRA to aged mice enhanced LTP of hippocampal CA1 synapses, which generally expresses as postsynaptic enhancement of the AMPAR response (13) . atRA could facilitate LTP expression by enriching extrasynaptic GluR1 and/or by augmenting basal dendritic translation. Consistent with these notions, expanding the extrasynaptic pool of GluR1 through forskolin/rolipram-induced PKA activation primed LTP expression (66) , and mice lacking the translation initiation inhibitors 4E-BP2 or GCN2 had enhanced basal translation and a lowered threshold for LTP induction (67 , 68) . The effect of atRA on protein synthesis may explain the bidirectional defects in both LTP and LTD expression in vitamin A-depleted mice (14) , because early expression of LTP and LTD can require new protein synthesis (69 70 71 72) . Therefore, atRA seems to function as a neuromodulator that facilitates expression of bidirectional synaptic plasticity.

RAR{alpha} likely serves as the principle mediator of nongenomic atRA effects on spine formation, because knockdown of RAR{alpha} blunted the response to atRA and reduced spine numbers. Loss of surface RAR{alpha} followed the onset of atRA signaling closely, possibly terminating signals through ligand-induced internalization. Notably, we observed attenuation of MAPK and a plateau of mTOR signaling after 30 min of atRA stimulation, a time of greatly reduced surface RAR{alpha}. Neuronal activity, stimulated by BDNF or bicuculline (Fig. 2E ), also modulated the surface expression of RAR{alpha}, suggesting an RAR{alpha} contribution to activity-dependent structure rearrangement. These actions of atRA and RAR{alpha} have features in common with estrogen and ER{alpha}. Brief exposure to estradiol induces signaling cascades dependent on the cell type, including Ras (73) , Raf-1 (73) , ERK1/2 (73 , 74) , PKA (75) , and PKC (75 , 76) and initiates cytoskeletal reorganization, such as formation of membrane raffles and pseudopodia (49) . These nongenomic effects require a membrane-resident ER{alpha} that associates with other membrane receptors (e.g., G-protein G{alpha}13) (49) or adaptor molecules (e.g., the Src homology and collagen homology adaptor protein shc) (77) . Likely, membrane RAR{alpha} also interacts with unique partners: we are currently addressing this issue.

atRA concentrations in the hippocampus are among the highest in the brain (76) . Both astrocytes and neurons convert the serum-borne precursor retinol into atRA (4) . Astrocytes express Stra6, the receptor for serum retinol binding-protein (rbp4), and therefore should concentrate serum retinol (78 , 79) . Hippocampal astrocytes have a higher rate of atRA biosynthesis than neurons and export most of their atRA into the medium (Wang and Napoli, unpublished observations). In the CNS, glia cells associate intimately with the neuronal synapse and secrete signaling molecules that modulate synaptic development and function (80 , 81) . Therefore, astrocytes may provide atRA for membrane-localized neuronal RAR{alpha}. In contrast, neurons tend to retain the atRA they biosynthesize. In contrast to an earlier report that RARβ cannot be detected in the hippocampus (47) , we have detected RARβ constitutively in the nuclei of hippocampal neurons. Our observation is consistent with the hippocampal plasticity defects in RARβ-null mice (10) . We suspect that intracellular neuronal atRA biosynthesis may provide ligand for activating nuclear RARβ. These two different potential sources of atRA would provide opportunity for differential atRA delivery and signaling.


   ACKNOWLEDGMENTS
 
We thank Dr. Lu Chen for helpful discussions and Dr. James Chithalen for carefully reading the manuscript. This work was supported by National Institutes of Health grants DK36870 and AG13566. We thank Weiya Jiang for help with blind labeling of samples.

Received for publication April 13, 2007. Accepted for publication July 26, 2007.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Chytil, F. (2003) Rough and rocky road to the retinoid revolution. Annu. Rev. Nutr. 23,1-16[CrossRef][Medline]
  2. Evans, T. R., Kaye, S. B. (1999) Retinoids: present role and future potential. Br. J. Cancer 80,1-8[CrossRef][Medline]
  3. Jacobs, S., Lie, D. C., DeCicco, K. L., Shi, Y., DeLuca, L. M., Gage, F. H., Evans, R. M. (2006) Retinoic acid is required early during adult neurogenesis in the dentate gyrus. Proc. Natl. Acad. Sci. U. S. A. 103,3902-3907[Abstract/Free Full Text]
  4. Chandrasekaran, V., Zhai, Y., Wagner, M., Kaplan, P. L., Napoli, J. L., Higgins, D. (2000) Retinoic acid regulates the morphological development of sympathetic neurons. J. Neurobiol. 42,383-393[CrossRef][Medline]
  5. Scheibe, R. J., Ginty, D. D., Wagner, J. A. (1991) Retinoic acid stimulates the differentiation of PC12 cells that are deficient in cAMP-dependent protein kinase. J. Cell Biol. 113,1173-1182[Abstract/Free Full Text]
  6. Maden, M. (2002) Retinoid signalling in the development of the central nervous system. Nat. Rev. Neurosci. 3,843-853[CrossRef][Medline]
  7. Lane, M. A., Bailey, S. J. (2005) Role of retinoid signalling in the adult brain. Prog. Neurobiol. 75,275-293[CrossRef][Medline]
  8. Mark, M., Ghyselinck, N. B., Wendling, O., Dupe, V., Mascrez, B., Kastner, P., Chambon, P. (1999) A genetic dissection of the retinoid signalling pathway in the mouse. Proc. Nutr. Soc. 58,609-613[Medline]
  9. Cocco, S., Diaz, G., Stancampiano, R., Diana, A., Carta, M., Curreli, R., Sarais, L., Fadda, F. (2002) Vitamin A deficiency produces spatial learning and memory impairment in rats. Neuroscience 115,475-482[CrossRef][Medline]
  10. Chiang, M. Y., Misner, D., Kempermann, G., Schikorski, T., Giguere, V., Sucov, H. M., Gage, F. H., Stevens, C. F., Evans, R. M. (1998) An essential role for retinoid receptors RARbeta and RXRgamma in long-term potentiation and depression. Neuron 21,1353-1361[CrossRef][Medline]
  11. Etchamendy, N., Enderlin, V., Marighetto, A., Pallet, V., Higueret, P., Jaffard, R. (2003) Vitamin A deficiency and relational memory deficit in adult mice: relationships with changes in brain retinoid signalling. Behav. Brain. Res. 145,37-49[CrossRef][Medline]
  12. Etchamendy, N., Enderlin, V., Marighetto, A., Vouimba, R. M., Pallet, V., Jaffard, R., Higueret, P. (2001) Alleviation of a selective age-related relational memory deficit in mice by pharmacologically induced normalization of brain retinoid signaling. J. Neurosci. 21,6423-6429[Abstract/Free Full Text]
  13. Malenka, R. C., Bear, M. F. (2004) LTP and LTD: an embarrassment of riches. Neuron 44,5-21[CrossRef][Medline]
  14. Misner, D. L., Jacobs, S., Shimizu, Y., de Urquiza, A. M., Solomin, L., Perlmann, T., De Luca, L. M., Stevens, C. F., Evans, R. M. (2001) Vitamin A deprivation results in reversible loss of hippocampal long-term synaptic plasticity. Proc. Natl. Acad. Sci. U. S. A. 98,11714-11719[Abstract/Free Full Text]
  15. Gray, E. G. (1959) Axo-somatic and axo-dendritic synapses of the cerebral cortex: an electron microscope study. J. Anat. 93,420-433[Medline]
  16. Fiala, J. C., Feinberg, M., Popov, V., Harris, K. M. (1998) Synaptogenesis via dendritic filopodia in developing hippocampal area CA1. J. Neurosci. 18,8900-8911[Abstract/Free Full Text]
  17. Friedman, H. V., Bresler, T., Garner, C. C., Ziv, N. E. (2000) Assembly of new individual excitatory synapses: time course and temporal order of synaptic molecule recruitment. Neuron 27,57-69[CrossRef][Medline]
  18. Ziv, N. E., Smith, S. J. (1996) Evidence for a role of dendritic filopodia in synaptogenesis and spine formation. Neuron 17,91-102[CrossRef][Medline]
  19. Ahmari, S. E., Buchanan, J., Smith, S. J. (2000) Assembly of presynaptic active zones from cytoplasmic transport packets. Nat. Neurosci. 3,445-451[CrossRef][Medline]
  20. Goldin, M., Segal, M., Avignone, E. (2001) Functional plasticity triggers formation and pruning of dendritic spines in cultured hippocampal networks. J. Neurosci. 21,186-193[Abstract/Free Full Text]
  21. Dai, Z., Peng, H. B. (1996) Dynamics of synaptic vesicles in cultured spinal cord neurons in relationship to synaptogenesis. Mol. Cell. Neurosci. 7,443-452[CrossRef][Medline]
  22. Jontes, J. D., Buchanan, J., Smith, S. J. (2000) Growth cone and dendrite dynamics in zebrafish embryos: early events in synaptogenesis imaged in vivo. Nat. Neurosci. 3,231-237[CrossRef][Medline]
  23. Muller, D., Toni, N., Buchs, P. A. (2000) Spine changes associated with long-term potentiation. Hippocampus 10,596-604[CrossRef][Medline]
  24. Matsuzaki, M., Honkura, N., Ellis-Davies, G. C., Kasai, H. (2004) Structural basis of long-term potentiation in single dendritic spines. Nature 429,761-766[CrossRef][Medline]
  25. Zhou, Q., Homma, K. J., Poo, M. M. (2004) Shrinkage of dendritic spines associated with long-term depression of hippocampal synapses. Neuron 44,749-757[CrossRef][Medline]
  26. Toni, N., Buchs, P. A., Nikonenko, I., Bron, C. R., Muller, D. (1999) LTP promotes formation of multiple spine synapses between a single axon terminal and a dendrite. Nature 402,421-425[CrossRef][Medline]
  27. Engert, F., Bonhoeffer, T. (1999) Dendritic spine changes associated with hippocampal long-term synaptic plasticity. Nature 399,66-70[CrossRef][Medline]
  28. Fischer, M., Kaech, S., Wagner, U., Brinkhaus, H., Matus, A. (2000) Glutamate receptors regulate actin-based plasticity in dendritic spines. Nat. Neurosci. 3,887-894[CrossRef][Medline]
  29. McKinney, R. A., Capogna, M., Durr, R., Gahwiler, B. H., Thompson, S. M. (1999) Miniature synaptic events maintain dendritic spines via AMPA receptor activation. Nat. Neurosci. 2,44-49[CrossRef][Medline]
  30. Shi, S. H., Hayashi, Y., Petralia, R. S., Zaman, S. H., Wenthold, R. J., Svoboda, K., Malinow, R. (1999) Rapid spine delivery and redistribution of AMPA receptors after synaptic NMDA receptor activation. Science 284,1811-1816[Abstract/Free Full Text]
  31. Heynen, A. J., Quinlan, E. M., Bae, D. C., Bear, M. F. (2000) Bidirectional, activity-dependent regulation of glutamate receptors in the adult hippocampus in vivo. Neuron 28,527-536[CrossRef][Medline]
  32. Takahashi, T., Svoboda, K., Malinow, R. (2003) Experience strengthening transmission by driving AMPA receptors into synapses. Science 299,1585-1588[Abstract/Free Full Text]
  33. Grooms, S. Y., Noh, K. M., Regis, R., Bassell, G. J., Bryan, M. K., Carroll, R. C., Zukin, R. S. (2006) Activity bidirectionally regulates AMPA receptor mRNA abundance in dendrites of hippocampal neurons. J. Neurosci. 26,8339-8351[Abstract/Free Full Text]
  34. Ju, W., Morishita, W., Tsui, J., Gaietta, G., Deerinck, T. J., Adams, S. R., Garner, C. C., Tsien, R. Y., Ellisman, M. H., Malenka, R. C. (2004) Activity-dependent regulation of dendritic synthesis and trafficking of AMPA receptors. Nat. Neurosci. 7,244-253[CrossRef][Medline]
  35. Smith, W. B., Starck, S. R., Roberts, R. W., Schuman, E. M. (2005) Dopaminergic stimulation of local protein synthesis enhances surface expression of GluR1 and synaptic transmission in hippocampal neurons. Neuron 45,765-779[CrossRef][Medline]
  36. Sutton, M. A., Ito, H. T., Cressy, P., Kempf, C., Woo, J. C., Schuman, E. M. (2006) Miniature neurotransmission stabilizes synaptic function via tonic suppression of local dendritic protein synthesis. Cell 125,785-799[CrossRef][Medline]
  37. Kelleher, R. J., 3rd, Govindarajan, A., Jung, H. Y., Kang, H., Tonegawa, S. (2004) Translational control by MAPK signaling in long-term synaptic plasticity and memory. Cell 116,467-479[CrossRef][Medline]
  38. Reynolds, A., Leake, D., Boese, Q., Scaringe, S., Marshall, W. S., Khvorova, A. (2004) Rational siRNA design for RNA interference. Nat. Biotechnol. 22,326-330[CrossRef][Medline]
  39. Scheetz, A. J., Nairn, A. C., Constantine-Paton, M. (2000) NMDA receptor-mediated control of protein synthesis at developing synapses. Nat. Neurosci. 3,211-216[CrossRef][Medline]
  40. Yuste, R., Bonhoeffer, T. (2004) Genesis of dendritic spines: insights from ultrastructural and imaging studies. Nat. Rev. Neurosci. 5,24-34[CrossRef][Medline]
  41. Fletcher, T. L., De Camilli, P., Banker, G. (1994) Synaptogenesis in hippocampal cultures: evidence indicating that axons and dendrites become competent to form synapses at different stages of neuronal development. J. Neurosci. 14,6695-6706[Abstract]
  42. Okabe, S., Miwa, A., Okado, H. (2001) Spine formation and correlated assembly of presynaptic and postsynaptic molecules. J. Neurosci. 21,6105-6114[Abstract/Free Full Text]
  43. Grewal, S. S., York, R. D., Stork, P. J. (1999) Extracellular-signal-regulated kinase signalling in neurons. Curr. Opin. Neurobiol. 9,544-553[CrossRef][Medline]
  44. Sweatt, J. D. (2004) Mitogen-activated protein kinases in synaptic plasticity and memory. Curr. Opin. Neurobiol. 14,311-317[CrossRef][Medline]
  45. Aggarwal, S., Kim, S. W., Cheon, K., Tabassam, F. H., Yoon, J. H., Koo, J. S. (2006) Nonclassical action of retinoic acid on the activation of the cAMP response element-binding protein in normal human bronchial epithelial cells. Mol. Biol. Cell 17,566-575[Abstract/Free Full Text]
  46. Canon, E., Cosgaya, J. M., Scsucova, S., Aranda, A. (2004) Rapid effects of retinoic acid on CREB and ERK phosphorylation in neuronal cells. Mol. Biol. Cell 15,5583-5592[Abstract/Free Full Text]
  47. Krezel, W., Kastner, P., Chambon, P. (1999) Differential expression of retinoid receptors in the adult mouse central nervous system. Neuroscience 89,1291-1300[CrossRef][Medline]
  48. Simoncini, T., Fornari, L., Mannella, P., Varone, G., Caruso, A., Liao, J. K., Genazzani, A. R. (2002) Novel non-transcriptional mechanisms for estrogen receptor signaling in the cardiovascular system. Interaction of estrogen receptor alpha with phosphatidylinositol 3-OH kinase. Steroids 67,935-939[CrossRef][Medline]
  49. Simoncini, T., Scorticati, C., Mannella, P., Fadiel, A., Giretti, M. S., Fu, X. D., Baldacci, C., Garibaldi, S., Caruso, A., Fornari, L., Naftolin, F., Genazzani, A. R. (2006) Estrogen receptor alpha interacts with Galpha13 to drive actin remodeling and endothelial cell migration via the RhoA/Rho kinase/moesin pathway. Mol. Endocrinol. 20,1756-1771[Abstract/Free Full Text]
  50. Boonyaratanakornkit, V., McGowan, E., Sherman, L., Mancini, M. A., Cheskis, B. J., Edwards, D. P. (2007) The role of extranuclear signaling actions of progesterone receptor in mediating progesterone regulation of gene expression and the cell cycle. Mol. Endocrinol. 21,359-375[Abstract/Free Full Text]
  51. Kelleher, R. J., 3rd, Govindarajan, A., Tonegawa, S. (2004) Translational regulatory mechanisms in persistent forms of synaptic plasticity. Neuron 44,59-73[CrossRef][Medline]
  52. Akama, K. T., McEwen, B. S. (2003) Estrogen stimulates postsynaptic density-95 rapid protein synthesis via the Akt/protein kinase B pathway. J. Neurosci. 23,2333-2339[Abstract/Free Full Text]
  53. Lee, C. C., Huang, C. C., Wu, M. Y., Hsu, K. S. (2005) Insulin stimulates postsynaptic density-95 protein translation via the phosphoinositide 3-kinase-Akt-mammalian target of rapamycin signaling pathway. J. Biol. Chem. 280,18543-18550[Abstract/Free Full Text]
  54. Derkach, V. A., Oh, M. C., Guire, E. S., Soderling, T. R. (2007) Regulatory mechanisms of AMPA receptors in synaptic plasticity. Nat. Rev. Neurosci. 8,101-113[CrossRef][Medline]
  55. Groc, L., Heine, M., Cognet, L., Brickley, K., Stephenson, F. A., Lounis, B., Choquet, D. (2004) Differential activity-dependent regulation of the lateral mobilities of AMPA and NMDA receptors. Nat. Neurosci. 7,695-696[CrossRef][Medline]
  56. Tardin, C., Cognet, L., Bats, C., Lounis, B., Choquet, D. (2003) Direct imaging of lateral movements of AMPA receptors inside synapses. EMBO J. 22,4656-4665[CrossRef][Medline]
  57. Malinow, R., Malenka, R. C. (2002) AMPA receptor trafficking and synaptic plasticity. Annu. Rev. Neurosci. 25,103-126[CrossRef][Medline]
  58. Takahashi, J., Palmer, T. D., Gage, F. H. (1999) Retinoic acid and neurotrophins collaborate to regulate neurogenesis in adult-derived neural stem cell cultures. J. Neurobiol. 38,65-81[CrossRef][Medline]
  59. Brandenberger, R., Wei, H., Zhang, S., Lei, S., Murage, J., Fisk, G. J., Li, Y., Xu, C., Fang, R., Guegler, K., Rao, M. S., Mandalam, R., Lebkowski, J., Stanton, L. W. (2004) Transcriptome characterization elucidates signaling networks that control human ES cell growth and differentiation. Nat. Biotechnol. 22,707-716[CrossRef][Medline]
  60. Sockanathan, S., Jessell, T. M. (1998) Motor neuron-derived retinoid signaling specifies the subtype identity of spinal motor neurons. Cell 94,503-514[CrossRef][Medline]
  61. McCaffery, P., Zhang, J., Crandall, J. E. (2006) Retinoic acid signaling and function in the adult hippocampus. J. Neurobiol. 66,780-791[CrossRef][Medline]
  62. Vanderklish, P. W., Edelman, G. M. (2002) Dendritic spines elongate after stimulation of group 1 metabotropic glutamate receptors in cultured hippocampal neurons. Proc. Natl. Acad. Sci. U. S. A. 99,1639-1644[Abstract/Free Full Text]
  63. Casadio, A., Martin, K. C., Giustetto, M., Zhu, H., Chen, M., Bartsch, D., Bailey, C. H., Kandel, E. R. (1999) A transient, neuron-wide form of CREB-mediated long-term facilitation can be stabilized at specific synapses by local protein synthesis. Cell 99,221-237[CrossRef][Medline]
  64. Martin, K. C., Casadio, A., Zhu, H., Yaping, E., Rose, J. C., Chen, M., Bailey, C. H., Kandel, E. R. (1997) Synapse-specific, long-term facilitation of aplysia sensory to motor synapses: a function for local protein synthesis in memory storage. Cell 91,927-938[CrossRef][Medline]
  65. Kauer, J. A., Malenka, R. C. (2006) LTP: AMPA receptors trading places. Nat. Neurosci. 9,593-594[CrossRef][Medline]
  66. Oh, M. C., Derkach, V. A., Guire, E. S., Soderling, T. R. (2006) Extrasynaptic membrane trafficking regulated by GluR1 serine 845 phosphorylation primes AMPA receptors for long-term potentiation. J. Biol. Chem. 281,752-758[Abstract/Free Full Text]
  67. Banko, J. L., Hou, L., Poulin, F., Sonenberg, N., Klann, E. (2006) Regulation of eukaryotic initiation factor 4E by converging signaling pathways during metabotropic glutamate receptor-dependent long-term depression. J. Neurosci. 26,2167-2173[Abstract/Free Full Text]
  68. Costa-Mattioli, M., Gobert, D., Harding, H., Herdy, B., Azzi, M., Bruno, M., Bidinosti, M., Ben Mamou, C., Marcinkiewicz, E., Yoshida, M., Imataka, H., Cuello, A. C., Seidah, N., Sossin, W., Lacaille, J. C., Ron, D., Nader, K., Sonenberg, N. (2005) Translational control of hippocampal synaptic plasticity and memory by the eIF2alpha kinase GCN2. Nature 436,1166-1173[CrossRef][Medline]
  69. Hou, L., Klann, E. (2004) Activation of the phosphoinositide 3-kinase-Akt-mammalian target of rapamycin signaling pathway is required for metabotropic glutamate receptor-dependent long-term depression. J. Neurosci. 24,6352-6361[Abstract/Free Full Text]
  70. Huber, K. M., Kayser, M. S., Bear, M. F. (2000) Role for rapid dendritic protein synthesis in hippocampal mGluR-dependent long-term depression. Science 288,1254-1257[Abstract/Free Full Text]
  71. Huber, K. M., Roder, J. C., Bear, M. F. (2001) Chemical induction of mGluR5- and protein synthesis-dependent long-term depression in hippocampal area CA1. J. Neurophysiol. 86,321-325[Abstract/Free Full Text]
  72. Fonseca, R., Nagerl, U. V., Bonhoeffer, T. (2006) Neuronal activity determines the protein synthesis dependence of long-term potentiation. Nat. Neurosci. 9,478-480[CrossRef][Medline]
  73. Migliaccio, A., Piccolo, D., Castoria, G., Di Domenico, M., Bilancio, A., Lombardi, M., Gong, W., Beato, M., Auricchio, F. (1998) Activation of the Src/p21ras/Erk pathway by progesterone receptor via cross-talk with estrogen receptor. EMBO J. 17,2008-2018[CrossRef][Medline]
  74. Ivanova, T., Karolczak, M., Beyer, C. (2001) Estrogen stimulates the mitogen-activated protein kinase pathway in midbrain astroglia. Brain Res. 889,264-269[CrossRef][Medline]
  75. Kelly, M. J., Lagrange, A. H., Wagner, E. J., Ronnekleiv, O. K. (1999) Rapid effects of estrogen to modulate G protein-coupled receptors via activation of protein kinase A and protein kinase C pathways. Steroids 64,64-75[CrossRef][Medline]
  76. Kane, M. A., Chen, N., Sparks, S., Napoli, J. L. (2005) Quantification of endogenous retinoic acid in limited biological samples by LC/MS/MS. Biochem. J. 388,363-369[CrossRef][Medline]
  77. Song, R. X., Barnes, C. J., Zhang, Z., Bao, Y., Kumar, R., Santen, R. J. (2004) The role of Shc and insulin-like growth factor 1 receptor in mediating the translocation of estrogen receptor alpha to the plasma membrane. Proc. Natl. Acad. Sci. U. S. A. 101,2076-2081[Abstract/Free Full Text]
  78. Kawaguchi, R., Yu, J., Honda, J., Hu, J., Whitelegge, J., Ping, P., Wiita, P., Bok, D., Sun, H. (2007) A membrane receptor for retinol binding protein mediates cellular uptake of vitamin A. Science 315,820-825[Abstract/Free Full Text]
  79. Bouillet, P., Sapin, V., Chazaud, C., Messaddeq, N., Decimo, D., Dolle, P., Chambon, P. (1997) Developmental expression pattern of Stra6, a retinoic acid-responsive gene encoding a new type of membrane protein. Mech. Dev. 63,173-186[CrossRef][Medline]
  80. Volterra, A., Steinhauser, C. (2004) Glial modulation of synaptic transmission in the hippocampus. Glia 47,249-257[CrossRef][Medline]
  81. Haydon, P. G. (2001) GLIA: listening and talking to the synapse. Nat. Rev. Neurosci. 2,185-193[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Neurosci.Home page
N. R. Farrar, J. M. Dmetrichuk, R. L. Carlone, and G. E. Spencer
A Novel, Nongenomic Mechanism Underlies Retinoic Acid-Induced Growth Cone Turning
J. Neurosci., November 11, 2009; 29(45): 14136 - 14142.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. J. Laserna, M. L. Valero, L. Sanz, M. M. Sanchez del Pino, J. J. Calvete, and D. Barettino
Proteomic Analysis of Phosphorylated Nuclear Proteins Underscores Novel Roles for Rapid Actions of Retinoic Acid in the Regulation of mRNA Splicing and Translation
Mol. Endocrinol., November 1, 2009; 23(11): 1799 - 1814.
[Abstract] [Full Text] [PDF]


Home page
FASEB J.Home page
F. Tippmann, J. Hundt, A. Schneider, K. Endres, and F. Fahrenholz
Up-regulation of the {alpha}-secretase ADAM10 by retinoic acid receptors and acitretin
FASEB J, June 1, 2009; 23(6): 1643 - 1654.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Maghsoodi, M. M. Poon, C. I. Nam, J. Aoto, P. Ting, and L. Chen
Retinoic acid regulates RAR{alpha}-mediated control of translation in dendritic RNA granules during homeostatic synaptic plasticity
PNAS, October 14, 2008; 105(41): 16015 - 16020.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Gupta, P.-C. Ho, M. M. Huq, S. G. Ha, S. W. Park, A. A. Khan, N.-P. Tsai, and L.-N. Wei
Retinoic acid-stimulated sequential phosphorylation, PML recruitment, and SUMOylation of nuclear receptor TR2 to suppress Oct4 expression
PNAS, August 12, 2008; 105(32): 11424 - 11429.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Chen, B. Onisko, and J. L. Napoli
The Nuclear Transcription Factor RAR{alpha} Associates with Neuronal RNA Granules and Suppresses Translation
J. Biol. Chem., July 25, 2008; 283(30): 20841 - 20847.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.07-8739comv1
22/1/236    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, N.
Right arrow Articles by Napoli, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, N.
Right arrow Articles by Napoli, J. L.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS