| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
* NIEHS/NIH, Laboratory of Respiratory Biology, Durham, North Carolina, USA; and
Harvard University Department of Environmental Health, Boston, Massachusetts, USA
1 Correspondence: NIH/NIEHS MD 2–01, 111 T.W. Alexander Dr., Durham, NC 27709, USA. E-mail: imani{at}niehs.nih.gov
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, interleukin (IL)-6, IL-8, and regulated on activation normal T-cell expressed and secreted (RANTES). Furthermore, intranasal dsRNA treatment of SR-A-deficient (SR-A–/–) mice showed a significant decrease in the expression of inflammatory cytokines and a corresponding decrease in the accumulation of polymorphonuclear leukocytes (PMNs) in lungs. These data provide direct evidence that SR-A is a novel cell surface receptor for dsRNA, and therefore, SR-A may play a role in antiviral immune responses.—Limmon, G. V., Arredouani, M., McCann, K. L., Corn Minor, R. A., Kobzik, L., Imani, L. Scavenger receptor class-A is a novel cell surface receptor for double-stranded RNA.
Key Words: lung • epithelium • inflammation • virus infection
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2
3
4)
. Experimental evidence suggests that recognition of dsRNA, either intracellularly or extracellularly, is an early and potent regulatory signal for the activation of innate and adaptive immune responses (5
6
7
8
9
10
11
12)
.
The exact manner by which dsRNA interacts with cells and induces immune responses is not completely understood, but several signal transduction and transcription factors have been reported to be important in the early dsRNA-induced events leading to the up-regulation of inflammatory cytokines. These pathways include PKR, RIG-1, TLR3, IRFs, NF-
B, and MAPK (13
14
15
16
17
18
19
20
21
22
23
24
25
26)
. To be activated PKR, TLR-3, and RIG-1 require interaction with internalized dsRNA; however, the exact manner by which extracellular dsRNA gains entry into the cell is not yet determined.
To determine the cell surface receptor for dsRNA binding and uptake, we have examined scavenger receptors (SRs) as potential receptor candidates. SRs are known to bind anionic polymers, single-stranded polynucleotides including CpG dinucleotide containing polymers, and poly inosine (27
28
29
30
31)
. There are several SRs such as CD-36, SR-A, and SR-B that are reported to be present on epithelial cells and can therefore, potentially interact with dsRNA (32
33
34)
.
Scavenger receptors are integral membrane proteins that include eight different subclasses (A-H) of structurally unrelated receptors with broad ligand binding properties (35)
. Class A scavenger receptors are comprised of SR-AI, SR-AII, SR-AIII, macrophage receptor with collagenous structure (MARCO), SR with C-type lectin (SRCL; ref. 36
), and SCARA5 (33)
. SCARA5 possesses the typical structure of SR-A and forms homotrimers, and its expression is restricted to the plasma membranes of epithelial cells (33)
.
Accumulated evidence shows that ligand binding to SR-As activates intracellular signaling through phosphorylation of phospholipase C (PLC)-
l, phosphoinositide 3 (PI 3)-kinase, and protein kinase C (PKC), which lead to cytokine secretion (37)
. We have reported that SR-As mediate endocytosis and clearance of bacteria, environmental particles, and DNA oligonucleotides (31
, 38)
. Thus far, the role of SRs in dsRNA binding is not clearly established.
Here, we report that SR-A is a novel cell surface receptor for dsRNA binding, uptake, and intracellular signaling by lung epithelial cells. Our in vitro radioligand binding studies showed that poly I:C bound to SR-A in a saturable and competable fashion. Our data also showed that SR-A, but not SR-B antagonists, significantly inhibited poly I:C uptake and induction of tumor necrosis factor (TNF)-, interleukin (IL)-6, IL-8, and regulated on activation normal T-cell expressed and secreted (RANTES) mRNA. The decrease in cytokine expression was preceded by decreased phosphorylation of intracellular signaling molecules such as PKR and MAPK which are two downstream dsRNA-activated pathways (13
, 25
, 26
, 39
, 40)
. Importantly, our in vivo studies using SR-A–/– mice showed a decrease in cytokine and chemokine expression and lower number of polymorphonuclear leukocytes (PMN) in the dsRNA-treated mice lungs as compared to the wild-type mice. The possible implications of our observations are discussed.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. We have found this to be very important since we have observed significant differences in the capability of synthetic dsRNA poly I:C to activate PKR. Goat anti-SR-A and normal goat serum were purchased from CHEMICON (Temecula, CA, USA). Dextran sulfate, fucoidan, fetuin, and heparin were purchased from Sigma. Acetylated-LDL was purchased from AbD Serotec (Raleigh, NC, USA).
Radioligand binding studies
Poly I:C was end-labeled using T4 polynucleotide kinase (New England Biolabs, Ipswich, MA, USA) according to manufacturer’s instructions. Unincorporated 32P-ATP was removed by using Qiagen RNeasy kit (Qiagen, Valencia, CA, USA). Radioligand binding and competition assays were performed essentially as described previously (42)
. Briefly, BEAS-2B cells were seeded in 24-well plates at 50,000 cells/wells. After overnight incubation, cells were washed 1x with ice-cold serum-free medium and were incubated in 250 µl of ice-cold serum-free medium for 30 min at 4°C. Radiolabeled poly I:C at increasing concentrations was then added to each well at and after the indicated time points, and cells were washed 3x with 1 ml ice-cold PBS. Cells were then lysed with 500 µl of 0.1 N NaOH for 15 min and then neutralized with 50 µl of 1 N HCl. To determine the amount of bound ligand, 110 µl of the neutralized lysate were used for liquid scintillation counting. The amount of the bound ligand was measured by determining specific activity of a known amount of labeled poly I:C. To determine specificity and affinity we used competition assays with unlabeled poly I:C, acetylated-LDL, and dextran sulfate. The binding constant was determined using GraphPad Prizm software.
Animal experiments
Eight- to twelve-week-old male mice genetically-deficient in SR-A I/II (43)
and wild-type controls C57BL/6 (Charles River Laboratories, Wilmington, MA, USA) were used in all experiments. The mice were treated with 25 µl PBS or 25 µl poly I:C (1 mg/ml) by intranasal administration. At 5 h posttreatment, mice were euthanized and bronchoalveolar lavage (BAL) was performed as described previously (38)
followed by lung tissue harvest. The collected BAL samples were centrifuged to separate fluid from cells, and a fraction was centrifuged onto microscopic slides for staining with Diff-Quick (Baxter Scientific Products, McGaw Park, IL, USA) and for subsequent differential counts.
Confocal microscopy
Poly I:C was labeled with CY3 using Mirus RNA labeling kit (Madison, WI, USA). Labeled RNA was then purified with RNAeasy mini kit (Qiagen, Valencia, CA, USA). Cells were grown in glass-bottom microwell dishes (MatTek Corp., Ashland, MA, USA) and were treated with 10 µg/ml of CY3-labeled poly I:C alone or were first treated with 10 µg/ml of dextran sulfate. After 5 min, the cells were washed 3x with PBS, and fixed with 4% paraformaldehyde.
RNA extraction and reverse transcriptase-polymerase chain reaction (RT-PCR)
RNA was isolated using the TRIzol total RNA isolation reagent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized using superscript reverse transcriptase (Invitrogen). For real-time PCR 0.5 µg total RNA was subjected to a reverse transcription reaction. Following reverse transcription, 2 µl of cDNA was amplified by real-time PCR. Each experiment was performed in duplicate in 96 well plates by using 1x Sybr Green master mix (Bio-Rad, Hercules, CA, USA) in a final volume of 25 µl. Amplifications were performed with the following protocol: 95°C for 3 min followed by 50 cycles of 94°C for 10 s and 60°C for 30 s. The sequences of primers were as follows. Primers for the human genes were: GAPDH forward GGACCTGACCTGCCGTCTAG, GAPDH reverse TAGCCCAGGATGCCCTTGAG, TNF- forward GGA-GAAGGGTGACCGACTCA, TNF- reverse TGCCCAGACT-CGGCAAAG, IL-6 forward ATT CTG CGC ACG TTT AAG GA; IL-6 reverse ATC TGA GGT GCC CAT GCT AC, IL-8 forward TCTGGCAACCCTAGTCTGCT, IL-8 reverse GCTTCCACATGTCCTCACAA; RANTES forward TACCATGAAGGTCTCCGC, RANTES reverse GACAAAGACGACTGCTGG. Primers for the mouse genes were: GAPDH forward GGCATGGACTGTGGTCATGA, GAPDH reverse TTCACCACCATGGAGAAGGC; TNF- forward CATCTTCTCAAAATTCGAGTGACAA, TNF- reverse TGGGAGTAGACAAGGTACAACCC; IL-6 forward TTGCCTTCTTGGGACTGATGCT, IL-6 reverse GTATCTCTCTGAAGGACTCTGG; IL-8 forward TGTGGGA-GGCTGTGTTTGTA, IL-8 reverse ACGAGACCAGGAGAAA-CAGG; RANTES forward TCGTGTTTGTCACTCGAAGG, RANTES reverse GGGAAGCGTATACAGGGTCA; SR-AI forward TAGGCACTTGGGATGTCTGA, SR-AI reverse GTCCTCAATTTGTATTGGTGCT; SR-AII forward CGTTTTAACACACAGACCCAAG, SR-AII reverse CCTCACAACAACCCTGTGA.
Cell extraction and Western blot analysis
To isolate total cellular proteins, after each treatment, cells were washed 2x in phosphate-buffered saline and equal numbers of cells were lysed using one time SDS-sample buffer containing 2.5% β-mercaptoethanol. The proteins were denatured and reduced by heating the samples at 95°C for 5 min. The chromosomal DNA was then sheared by passing the samples through a 26-gauge needle several times. For isolation of cellular membranes, cells were washed 2x with ice-cold PBS and were then homogenized using a Dounce homogenizer with a tight pestle. Nuclei and large cellular debris were removed by low speed centrifugation at 1000 g total cellular membranes were then isolated by centrifugation at 15,000 g. The membranes were washed once with ice-cold PBS and were dissolved in 1x SDS sample buffer. The cytoplasmic fraction was also collected after the 15,000 g centrifugation and used in Western blot analysis. The proteins were resolved on a 12% SDS-PAGE and were electrotransferred onto nitrocellulose membranes. Polyclonal rabbit anti-MAPK and antiphospho-MAPK (SignalTransduction laboratories, Beverly, MA, USA) antibodies were used according to the manufacturer’s instructions. The immunoblotted proteins were visualized using the enhanced chemiluminescence (ECL) Western blot detection system (Amersham, Arlington Heights, IL, USA). For stripping, the blots were placed in a buffer containing 1% SDS, 62.5 mM Tris-HCl (pH 6.8), and 100 mM DTT. The blots were then heated to 65°C for 15 min. The buffer was then removed, and the blots were washed extensively before reprobing with appropriate antibodies.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 44)
, we examined the role of scavenger receptors in poly I:C induction of inflammatory cytokines. First we determined the concentration curve for poly I:C induction of cytokines. BEAS-2B cells were treated with increasing concentrations of poly I:C, and after 2 h total cellular RNA was harvested and was subjected to real-time RT-PCR (Fig. 1
A). The data show that poly I:C at 1–3 µg/ml is sufficient for optimal induction of cytokines and chemokines.
|
The effects of three polyanionic competitive antagonists of SR-A, dextran sulfate, fucoidan, and acetylated-LDL and two noncompetitive polyanions, fetuin and heparin, were tested for inhibition of cytokine induction. BEAS-2B cells were left untreated or were treated with increasing concentrations of the competitors immediately before addition of poly I:C (Fig. 1)
. The data from RT-PCR experiments revealed that antagonists of SR-A, dextran sulfate, fucoidan, and acetylated-LDL (Fig. 1B
), effectively inhibited poly I:C induction of TNF-, IL-6, IL-8, and RANTES. In contrast, noncompetitive polyanions, fetuin and heparin (Fig. 1B
), did not inhibit poly I:C induction of these cytokines and chemokines. These data suggest that SR-A is involved in induction of cytokines by poly I:C.
We then verified our data that were obtained using BEAS-2B cells in PHBE (Fig. 1C
). PHBE cells were first treated with dextran sulfate at 10 µg/ml. Immediately after dextran sulfate treatment, poly I:C was added at 1 µg/ ml and after 2 h, total cellular RNA was extracted and was used in RT-PCR. The data in Fig. 1C
showed that addition of dextran sulfate significantly inhibited poly I:C induction of cytokines and chemokines in PHBE cells.
To more specifically address the role of SR-A on dsRNA induction of cytokines in epithelial cells, we tested the effect of a specific anti-SR-A antibody. In this experiment, BEAS-2B or PHBE cells were treated with anti-SR-A antibody or normal goat serum for 1 h before addition of poly I:C at 1 µg/ml. Total cellular RNA was harvested after 2 h of poly I:C treatment and was subjected to real-time RT-PCR. Similar to the results obtained using competitive antagonists, anti-SR-A antibody significantly inhibited poly I:C induction of TNF-, IL-6, IL-8, and RANTES in both BEAS-2B (Fig. 2
A) and PHBE cells (Fig. 2B
). However, normal goat serum had no effect on poly I:C induction of these cytokines and chemokines.
|
Human bronchial epithelial cells express SR-A
Previous studies showed that the human bronchial epithelial cell line BEAS-2B expressed several different SRs (34)
; however, the presence of SR-As on primary human cells has not yet been reported. To verify whether BEAS-2B and PHBE cells expressed SR-A, we used real-time RT-PCR and Western blot analysis. RNA and protein from normal untreated PHBE and BEAS-2B cells were isolated, and the presence of SR-A was determined by using specific primers and a specific rabbit antibody to SR-A (Fig. 3
A). The data from RT-PCR and Western blot show that PHBE cells express SR-A as indicated by amplification of SR-AI/II (Fig. 3A
) and by specific bands in Western blot of cellular proteins including a band at 
70 kDa, the expected molecular mass for SR-A (Fig. 3B
). The other bands that are detected by the polyclonal rabbit anti-SR-A may represent cross-reactive SRs that may be present in epithelial cells. As a control, normal rabbit IgG was used in an identical lane of the same blot (Fig. 3B
).
|
Ligand binding and competition assays
To directly examine the role of SR-A in poly I:C binding, we performed kinetic, saturation, and competition studies using 32P-and CY3-labeled poly I:C. First, for kinetic studies, radiolabeled poly I:C was added to confluent monolayers of BEAS-2B cells at 4°C. At indicated times, cells were washed and bound radioactivity was measured by scintillation counting (Fig. 4
A, left panel). Next, binding assays with increasing concentrations of poly I:C were performed (Fig. 4A
, right panel). The dissociation constant (Kd) was determined using GraphPad Prizm software to be 0.28 µg/ml.
|
We next performed competition assays using SR-A ligands, dextran sulfate, and acetylated-LDL. Although, data in Fig. 4B
showed that both SR-A ligands could attenuate poly I:C binding to BEAS-2B cells, dextran sulfate was more effective. As a control, we used unlabeled poly I:C.
To further visualize the role of SR-A in internalization of poly I:C, we used Cy3 fluorescence labeling. BEAS-2B cells were first treated with CY3-labeled poly I:C at 37°C or 4°C, and after 5, 15, or 30 min cells were washed with PBS, fixed and examined by confocal microscopy (Fig. 4C
). The data show that within 5 min cells are saturated with labeled poly I:C. Furthermore, at 4°C poly I:C is not internalized after initial cell surface binding (Fig. 4C
).
To determine the role of SR-A in internalization, cells were treated with dextran sulfate, acetylated-LDL, anti-SR-A antibody, or NGS before the addition of Cy3-labeled poly I:C (Fig. 4D
). After 5 min, cells were washed with PBS, fixed, and examined by confocal microscopy. The data revealed that dextran sulfate, acetylated-LDL, and anti-SR-A inhibited uptake of poly I:C.
SR-A antagonists inhibit poly I:C activation of intracellular signaling pathways
We next examined the effect of SR-A antagonist, dextran sulfate, on poly I:C activation of intracellular signaling pathways. BEAS-2B (Fig. 5
A, B) and PHBE (Fig. 5C
) cells were treated with increasing concentrations of dextran sulfate and cells were then immediately treated with poly I:C at 1 µg/ml. After 5 min (determined to be optimal), whole cell extracts were prepared and total cellular proteins were resolved by SDS-PAGE. The activation states of PKR and p38 MAPK were then determined by using specific antiphospho-PKR and antiphospho-p38 MAPK antibodies. The total amount of protein was quantified by specific antibodies to the nonphosphorylated form of PKR and p38 MAPK.
|
The data in Fig. 5A, B
show that there was a concentration-dependent inhibition of dsRNA activation of PKR and p38 MAPK by treating the cells with dextran sulfate. Furthermore, the data in Fig. 5C
showed that dextran sulfate also inhibited dsRNA activation of p38 MAPK in PHBE cells. Treatment of cells with dextran sulfate, fucoidan, or acetylated-LDL at 50 µg/ml did not induce any increase in phosphorylation of p38 MAPK (data not shown), suggesting that interaction of an appropriate ligand with responsive intracellular signaling molecules is necessary for the observed responses.
Impaired responsiveness of SR-A-deficient mice to dsRNA treatment
To directly evaluate the role of SR-A in dsRNA induction of immune responses in vivo, SR-A–/– and wild-type control mice were treated with 25 µl PBS or 25 µl of poly I:C (1 µg/µl) by intranasal administration. At 5 h posttreatment, the mice were euthanized and BAL fluid and whole lungs were collected. To evaluate the effect of SR-A deficiency on the dsRNA-induced lung inflammation, we first determined the abundance of PMNs in BAL fluid. The data revealed that BAL fluid of SR-A–/– mice contained significantly lower numbers of PMNs compared to wild-type controls (Fig. 6
A). It is important to note that there was no significant difference in the basal inflammatory cell counts between the wild-type and SR-A–/– mice.
|
We next examined the effect of SR-A deficiency on cytokine expression. Total cellular RNA was extracted from lungs and was subjected to real-time RT-PCR. As compared to the wild type, the lungs from SR-A–/– mice exhibited significantly diminished expression of TNF-, IL-6, IL-8, and RANTES (Fig. 6B
).
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, IL-6, IL-8, and RANTES. Since the initial site of respiratory viral infections is the epithelium, induction of cytokines in epithelial cells can play an important role in the initiation of innate and subsequently adaptive antiviral immune responses.
A key signal for the presence of viral infection is dsRNA, which is present as the genomic fragment (rotavirus, reovirus, and bluetongue virus) or as replicative intermediates (rhinovirus, influenza virus, dengue virus, and rubella virus; refs. 1
2
3
4
). Previous work by our laboratory and others showed that dsRNA was a potent inducer of inflammatory cytokines and chemokines in many different cell types (5
6
7
, 9
10
11
12
13
, 45)
. However, the cell surface receptor for dsRNA has not yet determined.
In this study, we have shown, by several different methods, that SR-A is a novel cell surface receptor on lung epithelial cells for dsRNA binding, uptake, and the subsequent signaling and inflammatory cytokine and chemokine expression. First, our radioligand competition assays showed that poly I:C binds to SR-A in a saturable and competable fashion with a Kd of 0.28 µg/ml. Ligand competition data showed that dextran sulfate, acetylated-LDL, and fucoidan significantly inhibited induction of cytokines by poly I:C in BEAS-2B and PHBE cells (Figs. 1
and 2)
. CY3-labeled ligand visualization confocal microscopy data showed that specific antibody and ligands to SR-A inhibited uptake and internalization of poly I:C into the cells.
Also, consistent with the ligand competition assays, a specific antibody to SR-A attenuated poly I:C induction of cytokines (Fig. 4)
. Finally, by using SR-A–/– mice, our data showed that SR-A was a critical receptor for poly I:C induction of inflammatory responses (Fig. 5)
. It is important to mention that in both SR-A–/– mice and anti-SR-A antibody experiments, the level of cytokine was only partially reduced. We believe that this is likely due to the presence of other members of SR-A, which may mediate binding and internalization of poly I:C.
At this point, the nature of the cells in mice lungs that are involved in dsRNA induction of immune responses is not clear. The presence of scavenger receptors on macrophages and endothelial cells is well studied; however, the presence and role of SRs on epithelial cells is not as well understood. Our data suggest that epithelial SR-A can function as a dsRNA receptor and participate in innate immune responses. Nevertheless, we expect that dsRNA interaction with SR-A on different cell types can lead to activation of intracellular signaling pathways and to induction of cytokines and chemokines.
Based on our data in Fig. 6
, poly I:C interaction with SR-A leads to downstream activation of PKR and p38 MAPK signaling pathways. PKR is a well-studied intracytoplasmic serine/threonine protein kinase that requires interaction specifically with dsRNA as other forms of nucleic acids do not activate this enzyme (25
, 39)
. We previously reported that PKR activation was an intracellular signal for induction of cytokines in epithelial cells (40)
. After dsRNA interaction and activation, PKR is known to activate MAPK pathways such as p38 MAPK, JNK, and ERK (26
, 46)
. The activation of MAPK pathways is a well-established signaling event in induction of inflammation. Since treatment of the cells with SR-A ligands alone did not increase MAPK activation (data not shown), we believe that SR-A mediates internalization of dsRNA into an intracellular compartment where it can bind and activate responsive signaling pathways.
Accumulating evidence, including ours, suggest that different scavenger receptors display both a positive and negative effect on infectious agents. Recently, we reported that the class-A scavenger receptor macrophage receptor with a collagenous structure (MARCO) functions as a pattern recognition molecule for bacterial products such as CpG oligodeoxynucleotides (31)
.
In this study, we show that dsRNA poly I:C enters the cells very rapidly through binding to SR-A and then activates downstream intracellular signaling pathways such as PKR and p38 MAPK. We believe that SR-A uptake of poly I:C may also result in activation of other dsRNA-responsive pathways such as TLR-3, RIG-1, STAT-1, NF-B, and interferon response factors (IRFs; refs. 14
15
16
17
18
19
20
21
22
23
24
25
26
). Further experiments are underway to delineate the exact mechanisms by which dsRNA interacts with and activates epithelial cells.
|
ACKNOWLEDGMENTS |
|---|
Received for publication February 16, 2007. Accepted for publication July 19, 2007.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  I. Tirapu, B. Giquel, L. Alexopoulou, S. Uematsu, R. Flavell, S. Akira, and S. S. Diebold PolyI:C-induced reduction in uptake of soluble antigen is independent of dendritic cell activation Int. Immunol., July 1, 2009; 21(7): 871 - 879. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. G. Cho, R. J. C. Albuquerque, M. E. Kleinman, V. Tarallo, A. Greco, M. Nozaki, M. G. Green, J. Z. Baffi, B. K. Ambati, M. De Falco, et al. Small interfering RNA-induced TLR3 activation inhibits blood and lymphatic vessel growth PNAS, April 28, 2009; 106(17): 7137 - 7142. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. T. Trifonova, G. F. Doncel, and R. N. Fichorova Polyanionic Microbicides Modify Toll-Like Receptor-Mediated Cervicovaginal Immune Responses Antimicrob. Agents Chemother., April 1, 2009; 53(4): 1490 - 1500. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Shibamiya, K. Hersemeyer, T. Schmidt Woll, D. Sedding, J.-M. Daniel, S. Bauer, T. Koyama, K. T. Preissner, and S. M. Kanse A key role for Toll-like receptor-3 in disrupting the hemostasis balance on endothelial cells Blood, January 15, 2009; 113(3): 714 - 722. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. T. Ranjith-Kumar, K. E. Duffy, J. L. Jordan, A. Eaton-Bassiri, R. Vaughan, S. A. Hoose, R. J. Lamb, R. T. Sarisky, and C. C. Kao Single-Stranded Oligonucleotides Can Inhibit Cytokine Production Induced by Human Toll-Like Receptor 3 Mol. Cell. Biol., July 15, 2008; 28(14): 4507 - 4519. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
