| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,1,2
* W. M. Keck Center for Comparative and Functional Genomics, University of Illinois, Urbana, Illinois, USA; and
Laboratory of Animal Molecular Evolution, Institute of Evolution, University of Haifa, Mt. Carmel, Haifa, Israel
2Correspondence: Institute of Evolution, University of Haifa, Haifa 31905, Israel. E-mail: aaron{at}research.haifa.ac.il
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: Spalax ehrenbergi • VEGF-R2
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2
3
4
5)
. The Spalacidea, originating 25–40 million years ago in Asia Minor, have evolved physiological strategies enabling their respiratory and cardiovascular systems to cope with hypoxia more efficiently than other mammalian species (6
, 7)
. Hence, Spalax is an extraordinary, wild model organism for in vivo studies of hypoxia under a natural range of stress.
There are four Spalax allospecies in Israel, which are distinguished by different numbers of chromosomes and adapted to four different climatic regimes. Extreme differences in ecological conditions are observed between those inhabited by Spalax galili (2n=52), which inhabits the northern cool-humid Upper Galilee Mountains, and Spalax judaei (2n=60), which resides in the southern warm-dry regions in Israel. An improved hypoxic adaptation of S. galili has been established with higher normoxic breathing and heart rate (8)
as well as higher hematocrit and hemoglobin levels as compared to S. judaei (9)
. Furthermore, subcutaneous gas tension is significantly lower in S. galili than in S. judaei implying an increased efficiency of gas extraction (10)
. Lastly, in laboratory experiments the lowest levels of oxygen concentrations tolerated by S. galili (2.6±0.4%) was significantly lower than S. judaei (3.7±0.9%) (11)
.
Compared to Rattus norvegicus, Spalax survives at lower O2 levels and higher CO2 for longer periods of time (11
, 12)
. Under laboratory conditions, Spalax survived O2 concentrations as low as 3% and up to 15% CO2 for 8 to 11 h without serious deleterious effects or behavioral changes as compared to a threshold for Rattus of 2 to 4 h (12)
. In field measurements, we recorded 7.2% O2 and 6.1% CO2 in S. ehrenbergi burrows in flooded heavy clay soils during the Mediterranean rainy season; however, it is feasible that conditions may actually be more extreme (13)
.
Hypoxia tolerance mechanisms identified in Spalax as compared to Rattus include blood properties, anatomical and biochemical changes in respiratory organs, and differences in the structure and function of a growing list of gene products including hemoglobin, myoglobin, haptoglobin, neuroglobin, and cytoglobin (14
15
16
17)
. Furthermore, we found varying transcription patterns of many genes and gene products related to hypoxic stress between Spalax and Rattus. Erythropoietin (Epo) and hypoxia inducible factor1-alpha (HIF1
) (18
, 19)
as well as the expression of Epo receptor differ in Spalax as compared to Rattus throughout development, suggesting adaptation of Spalax to hypoxic habitats early in development (20)
. Noteworthy, we recently discovered that the binding domain of Spalax p53 harbors two amino acid substitutions identical to those found in human tumor cells. These substitutions result in increased activation of DNA repair elements and reduced activation of apoptotic genes by Spalax p53 as compared to human wild-type p53 (21
, 22)
.
Capillary growth is critically dependent on various growth factors, in particular, vascular endothelial growth factor (VEGF) (23)
. Our previous findings demonstrate that under in vivo conditions, in an ambient atmosphere, VEGF, as well as its transcription activator HIF1 (24)
and HuR, a posttranscriptional stabilizer of VEGF mRNA (25)
, are expressed at higher levels in Spalax muscles compared to Rattus muscles (12
, 26)
. The higher constitutive mRNA expression levels of these genes in Spalax muscle correlates with a significantly higher blood vessel concentration; however, in the brain, where the blood vessel concentration is similar in Spalax and in Rattus, the expression pattern of VEGF is also similar.
The biological effects of VEGF are mediated by two tyrosine kinase receptors, VEGF-R1 (Flt1) and VEGF-R2 (KDR/Flk1), which differ in their signaling properties [for review see Ferrara et al. (27)
]. Flk1 functions as the major signal transducer of angiogenesis, and has been shown to mediate VEGF-stimulated endothelial cell mitogenesis, migration, and permeability and is responsible for the induction of endothelial tubulogenesis (28)
. This is indicated also by the lack of vasculogenesis and failure to develop organized blood vessels in mice lacking the gene for this receptor, resulting in death by day 9 of embryonic development (29)
.
In a previous study (30)
, we compared microarray expression profiles of muscle tissue at normoxic (21%) and hypoxic (3%) levels of oxygen concentration for 8 h between S. galili and S. judaei. Results uncovered species-specific responses to hypoxic stress among numerous genes involved in angiogenesis, apoptosis, and oxidative stress management; however, neither Spalax Flt1 nor Flk1 showed significant differential expression for effects of species or oxygen levels.
Nevertheless, considering our findings on the differences in muscle blood vessel density and VEGF expression between Spalax and Rattus (12
, 31)
, the mRNA of Flk1 from Spalax was cloned and sequenced. Expression levels under ambient conditions and hypoxic oxygen levels in the natural range of stress at various developmental stages were compared between the subterranean hypoxia-tolerant Spalax and the aboveground hypoxia-intolerant Rattus.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Tissues
Animals were euthanized by injection with Ketaset CIII (Fort Dodge Laboratories, Fort Dodge, IA, USA), at 5 mg/kg of body weight. Whole brain and skeletal muscle dissections were removed and immediately frozen in liquid nitrogen. All protocols were approved by the Haifa University committee on animal care.
RNA and cDNA preparation
Total RNA was extracted from tissues of at least three individuals using TRI Reagent (Molecular Research Center, Inc., Cincinnati, OH, USA) following the manufacturer’s instructions. The RNA samples were treated with DNase I (Ambion, Austin, TX, USA), and 1 µg was used for first-strand cDNA using M-MLV-H– reverse transcriptase (Promega, Madison, WI, USA). Undiluted cDNA (0.5 µl) was used per real-time polymerase chain reaction (PCR) reaction.
Cloning of Spalax Flk1 cDNA
The ORF of Flk1 receptor was isolated from skeletal muscles of both S. galili and S. judaei. This was carried out by reverse transcription PCR using TaqDNA polymerase (Qbiogene, Illkrich, France) and 5' and 3' oligonucleotides (Sigma Genosys, Rehovot, Israel) designed according to published human, mouse, and Rattus sequences and then with Spalax specific oligos to completion. The PCR products were subcloned into pGEM T-easy vector (Promega) and transformed by electroporation into Escherichia coli XL1-blue. The sequence was determined on both DNA strands (Technion, Haifa, Israel) and analyzed using GCG software (Accylris Software, San Diego, CA, USA).
Gene quantification
Gene quantification was performed using an ABI Prism 7000 sequence detector (Applied Biosystems, Foster City, CA, USA). In absence of a proven housekeeping gene along a developmental timescale Flk1 gene expression was normalized to total RNA as recommended by Bustin (32)
. Primers were designed in conserved regions of the genes using Primer Express 2 software (Applied Biosystems). The forward primer used was GAt/cTTCCTGACCTTGGAGCATC (Spalax=t; Rattus=c), and the reverse primer was ATGCCCTTAGCCACTTGGAAG (between bp # 2951 and 3006 in our S. judaei clone, Acc. #AM773787).
For standard curves, plasmid-DNA constructs containing the amplicons of each gene were used. Reactions were performed using SYBR Green PCR Master Mix (Applied Biosystems). Dilutions of cDNA were used in order to verify efficiency of the PCR (slope=3.3±0.1, R2
1 were achieved). The PCR plate was incubated at 50°C for 2 min, 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Samples from embryonic or newborn stages were pooled due to the low yields available. Two pools of three individuals each were tested. Real-time PCR measurements were carried out in triplicate with three replicates. Results were repeatable and exhibited an identical pattern of expression.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Expression of Flk1 in S. galili and Rattus at different developmental stages
In this set of experiments, we compared the expression levels of Flk1 mRNA in S. galili and Rattus.
Under ambient conditions
The relative expression of Flk1 mRNA at normoxic conditions is depicted in Fig. 1
for both skeletal muscle (A) and brain (B) of S. galili and Rattus. In general, the levels of Flk1 muscle mRNA in S. galili are significantly higher than in Rattus at all stages excluding the embryonic stage where they are similar. Flk1 levels increase from an approximate common level at third trimester of gestation, increasing at 1 wk postnatal, peaking at 2 wk postnatal, followed by a significant decline toward adulthood.
|
A very different pattern of expression was observed in the brain for both species. Although in both tissues the relative pattern of expression between S. galili and Rattus is similar and S. galili expresses higher levels, maximum levels of Flk1 mRNA were measured in the brain at the embryonic stage, declining progressively toward adulthood. Furthermore, while in muscle at the embryonic stage, the levels of Flk1 mRNA in S. galili and in Rattus are almost identical; in the brain S. galili expresses much higher levels than Rattus, with the gap between the two species narrowing toward adulthood.
It should be mentioned, however, that at all developmental stages, the levels of Flk1 mRNA in both species were higher in skeletal muscle than in the brain and is most pronounced in newborns 2 wk postnatal where levels are 6-fold higher in muscle than in the brain.
Hypoxia of 6% O2 for 5 h
Figure 2
demonstrates the influence of hypoxic stress on Flk1 mRNA expression in skeletal muscle (A) and brain (B) in postnatal and adult animals. (Embryos were not studied, as they cannot survive ex utero for significant periods of time.)
|
As observed in our previous microarray experiments (30)
, Flk1 transcript levels in S. galili muscle are not significantly influenced by short-term hypoxic stress. In Rattus muscle, both postnatal and adult animals present an increase in the levels of Flk1 mRNA after hypoxic stress, most noticeable in adult Rattus, exhibiting a 4-fold increase as compared with normoxic conditions.
In the brain, both the pattern of expression and the relative increase in levels of Flk1 mRNA are similar in both species. In 1- and 2-wk postnatal animals, no change is observed in the expression of the receptor. In the adult brain there is a slight, though significant, increase in the level of Flk1 mRNA of both species: 1.4-fold increase in Rattus and 1.6-fold increase in S. galili.
Under the above conditions there is a significant 2-fold (P<0.05) increase in the expression response of Flk1 mRNA in adult S. judaei muscle as compared to S. galili, reflecting the lower tolerance to hypoxia observed for S. judaei. In the brain, the response to short-term hypoxic stress in S. judaei is identical to that of Rattus and not significantly different from S. galili (results not shown).
Expression of Flk1 mRNA under moderate, long-term hypoxic stress in adult S. galili, S. judaei, and Rattus
Adult animals from all three species were exposed to moderate (10%) oxygen levels over a period of 22 or 44 h. The ratios of hypoxic to normoxic levels of Flk1 expression are summarized in Fig. 3
.
|
Both Spalax species express similar levels of Flk1 mRNA in muscle after 22 h exposure to hypoxic stress (
2.5-fold above normoxia, Fig. 3A
). No further increase was observed for S. galili; however, after 44 h S. judaei levels increase to twice those observed at 22 h. Levels in Rattus muscle, however, increase to significantly higher levels than Spalax, 9.7-fold and 22-fold above normoxia at 22 and 44 h, respectively.
In the brain (Fig. 3B
), the patterns of expression are similar in all three species. After 22 h of exposure to 10% O2 all three species exhibit a 1.5-fold increase in Flk-1 mRNA levels as compared to normoxic conditions. Levels continue to increase after 44 h to a level 3.5- fold over normoxia for Rattus and S. judaei and significantly higher (4.6-fold) for S. galili.
Flk1 mRNA expression under of 3% O2 for 8 h
Figure 4
depicts the hypoxic response of S. galili and S. judaei to extreme hypoxic conditions of 3% O2 for 8 h, conditions beyond the survival threshold for Rattus. Significantly increased levels of muscle Flk1 mRNA are observed as compared with normoxia for both species; however, the response in S judaei is twice that of S. galili, 3-fold vs. 1.5-fold, respectively. In the brain, however, transcript levels in both species responded in a similar manner and showed 2-fold increase relative to normoxic conditions.
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Spalax, as a wild subterranean mammal, provides a model for the investigation of the molecular mechanisms of hypoxia tolerance under in vivo conditions and at a natural range of stress. Results presented in this work describe the species differences of Flk1 expression between the subterranean hypoxia-tolerant Spalax and the terrestrial hypoxia-intolerant Rattus.
Developmental patterns of Flk1 expression
The most outstanding observation of developmental changes in Flk1 expression under normoxic conditions is the divergent expression patterns observed between muscle and brain tissues hinting on different control mechanisms and possible involvement in multiple processes. Although pattern trends are similar for both species, Flk1 expression peaks at 2 wk postnatal animals in muscle with levels reduced in adults; however, in the brain, levels are highest in the embryo with a gradual reduction of transcript levels toward adult stages (Fig. 1)
. Recently, a growing number of studies have shown that many genes involved in angiogenesis also carry a similar role in neurogenesis. Overexpression of VEGF in transgenic mice enhances postischemic neurogenesis in the brain, while reduction of VEGFR2/Flk1 by antisense inhibition induces neuronal death in Rattus spinal chord subjected to hypoxia (33
, 34)
. In addition, blocking VEGFR2/Flk1 in newborn mice cancels the effect of neuroprotection by hypoxic preconditioning. This was the first study that shows that hypoxic preconditioning protects against neuronal damage via the Flk1 receptor (35)
. It has also been shown that VEGF stimulates expansion of neural stem cells, but only when Flk1 receptors are coexpressed (36)
.
These relatively new experiments may provide clues as to the differences in expression patterns of Flk1 and VEGF in developing the muscle or brain observed in both Rattus and Spalax. Early postnatal animals undergo rapid muscle growth and an increase in oxidative respiration as activity increases; thus, rapid angiogenesis is a requirement for normal development. As muscle mass stabilizes, levels of VEGF and/or receptors may taper off to maintenance levels. Development and neurogenesis in the brain peaks during the embryonic stages of development and, until recently, was thought to be nonexistent in the adult brain. Adult neurogenesis occurs at much lower levels than during early developmental stages. Thus, it would be expected that genes involved in neurogenesis and vasculogenesis would follow expression patterns coordinated with developmental rates of the central nervous system.
Furthermore, in rats it was shown that brain capillary density increases dramatically during development (37)
. The dual function of angiogenic and neurogenic factors substantiates our results of Flk1 expression in the muscle and brain. Furthermore, the in vivo results we present here are supported by measurements of Flk1 carried out in vitro in a cerebral slice culture system of mice from prenatal stages and up to 30 days postnatal (38)
showing high expression of both Flk1 and VEGF during embryonic development, mainly in the brain but not, for example, in the umbilical vein; levels that are down-regulated toward adulthood and barely detectable at 30 days postnatal. Noteworthy, the ambient levels of Flk1 mRNA in the brain of S. galili are higher than in Rattus in all stages studied and are most significant in embryos. This pattern reflects the difference in the adaptation to hypoxic stress, notably higher for S. galili, especially during development, as gestation occurs during the Mediterranean rainy season, with a high probability of experiencing acute hypoxic insult (4
, 13)
.
Differences in vascular density are correlated with Flk1 expression response to hypoxia
The conditions induced for studying the ontogeny of Flk1 expression were dictated by the survival thresholds for each species and developmental stage. Hence, we needed to exclude the embryonic stage and restrict the hypoxic duration to a period newborns will survive without maternal care. Thus, the hypoxic insult chosen was 5 h at 6% O2.
In both skeletal muscle and the brain the pattern of Flk1 expression in response to hypoxia (6% oxygen, 5 h) is similar to that shown previously for VEGF expression (12
, 26)
and may be correlated with the difference of blood vessel density between the two tissues (26
, 31)
. In adult Rattus muscle, where the vascular density is significantly lower than that of Spalax, and normoxic Flk1 levels are relatively low (Fig. 1)
, we observed a significant 4-fold increase of Flk1 mRNA levels in response to hypoxia (Fig. 2)
. Smaller changes, however still significant (1.7-fold increase), were observed in the muscle of 1 and 2 wk postnatal Rattus pups. Spalax Flk1 transcript levels remained relatively unchanged under hypoxia. In the brain, where the vessel density, at least in adults, is similar in both species (26
, 31)
, the response of Flk1 expression is similar at all stages of development. At postnatal stages, there appears to be no significant change; however, in adult animals there are significant 1.4- and 1.6-fold increases in Rattus and S. galili brain, respectively. The differences in the response between the two species are not statistically significant; however, they are significantly lower than the differences observed between species in muscle. Furthermore, similar disparities in response to hypoxia occur for levels of muscle Flk1 between adult animals of the two species of Spalax with a 2-fold difference in response for S. judaei as compared to S. galili (results not shown). This difference is most likely the result of adaptive pressures due to the different ecological niches inhabited by the two species. As has already been shown in our previous works on the expression of other genes, S. galili is more tolerant to hypoxia than S. judaei. In the present case of Flk1 expression, S. judaei exhibits intermediate levels between the hypoxia tolerant S. galili and the intolerant Rattus at 6% oxygen, 5 h.
The difference in response to short-term acute hypoxia between Rattus and Spalax in muscle as opposed to the brain may be dependent on different mechanisms of compensation for low-oxygen pressures in each tissue. While cerebral hypoxia may lead to cerebral dysfunction and injury in a short period (39)
, capillary densities in the Rattus begin to increase only after 1 wk of hypoxic stress and peak sometime between 2 and 3 wk (40)
. A compensative mechanism in the brain regulates blood flow through vasodilatation so that sufficient oxygen is preferentially supplied to ensure normal function at the expense of other peripheral organs (41)
. This is achieved by a rich perivascular nerve supply to all parts of the brain, allowing for rapid vasodilatation and changes in both neuronal activity and blood flow (42
, 43)
. Indeed, for Rattus, during prolonged mild hypoxic exposure, brain blood flow was renewed within the first week of hypoxic exposure, well before initiation of capillary modeling (40)
. Hence, mitigation of brain hypoxia during this time must occur through small vessel vasodilatation mechanisms (44)
. Similar mechanisms have been reported in the epaulette shark (45)
and the estuarine crocodile (46)
, two species that are able to survive transient hypoxia.
Long-term exposure to hypoxia
The long-term response to hypoxia at moderate stress is reflected more clearly in all three species examined for both tissues (Fig. 3)
. Though the rate of increase in Flk1 transcript levels is similar to those observed at 6% oxygen, animals from all three species survive over longer periods of time at 10% allowing observation of longer term adaptation to hypoxic conditions. While in muscle, S. galili Flk1 levels peak at 22 h (1.8-fold increase), transcript levels in Rattus muscle continue to rise through 44 h with a dramatic 22-fold increase. Again S. judaei shows intermediate levels between Rattus and S. galili. Noteworthy, the different response experienced in the skeletal muscle of the two Spalax species after 44 h is statistically significant and more pronounced in the less tolerant S. judaei. Our in vivo results are in accordance with the in vitro results presented in a study conducted by Rissanen et al. (47)
. In this study, where the expression of VEGF and its receptors were followed in atrophic muscle cells of human lower limbs, it was shown that Flk1, VEGF, and HIF1 were strongly expressed in more atrophic myocytes. The significant difference in the response of Rattus muscle to hypoxia compared with Spalax indicates, once more, the highly stressful status the Rattus experiences, compared to Spalax. Noteworthy, response in the brain shows continually increasing levels in all three species. Under both 6% O2 and 10% O2, all three species demonstrated a similar mild, though statistically significant, increase in brain Flk1 levels with a slightly greater, though statistically significant, response for S. galili.
Expression of Flk1 under extreme hypoxia
In extreme hypoxia of 3% O2 for 8 h, no significant differences were noticed in brain Flk1 expression between the two Spalax species studied here; however, there is a difference in the hypoxic response of muscle Flk1 (Fig. 4)
. While there is no significant change in the level of expression in the muscle of S. galili in 3% O2 for 8 h (1.5-fold) compared to 6% O2 for 5 h (1.3-fold), in S. judaei muscle the relative amount of Flk1 transcripts compared to ambient conditions is 3-fold at 3% O2 after 8 h, significantly higher than the 2-fold increase demonstrated at 6% O2 for 5 h. Though we cannot directly deduce from the results of one treatment to the other, as both O2 levels and the duration of the stress were changed, we can still state that at both hypoxic insults, Flk1 in S. judaei changes to a greater extent than in S. galili.
Mechanisms of regulation
Various mechanisms and transcription factors have been identified as regulators of Flk1 expression in both vasculogenesis and neural development. Xiao et al. (36)
assessed the effect of both VEGF and basic fibroblast growth factor (bFGF) on mouse neural stem cell proliferation. While VEGF alone did not have a stimulatory effect, when bFGF was added proliferation increased significantly. It was shown that bFGF induced increased expression of Flk1 via the phosphorylation of ERK1/2. Blocking ERK1/2 phosphorylation inhibited Flk1 expression. Both bFGF and FGF receptor-1 are coexpressed during development of the mouse cortex. In addition, binding sites for the transcription elements SCL/Tal-1, GATA2, and Ets were found in an enhancer for Flk1 (48)
. Unlike Flk1, the Flt-1 receptor gene is directly up-regulated by hypoxia via a hypoxia-inducible enhancer element HIF1 binding site in its promoter (49)
. Elvert et al. (50)
showed that HIF2 but not HIF1 cooperates with Ets binding to tandem sites in the Flk1 enhancer and that both HIF2 and Flk1 are coregulated in postnatal mouse brain capillaries. The upstream binding sites have been identified in many organisms from zebrafish to humans; thus, the mechanisms are most likely conserved among most vertebrates. An additional binding site for FOXH1 was identified in zebrafish. Binding of FOXH1 to the enhancer apparently has a repressor effect on Flk1 expression, and overexpression of FOXH1 has a negative effect on vascular formation in zebrafish (51)
. It was also observed that Flk1 is directly upregulated by VEGF via the activation of FLK1 protein kinase. That is, the ligand binding acts as a positive feedback mechanism that appears to amplify the angiogenic response (52)
. Thus, the higher levels of HIF1 and VEGF in adult Spalax skeletal muscles (12
, 26)
may play a major role in the significantly higher Flk1 mRNA in S. galili normoxic skeletal muscle in adults.
Two important findings emerge from the present study. First, Flk1 expression at the mRNA level, under in vivo conditions, responds to a natural range of hypoxia in both skeletal muscles, primarily in Rattus, and in the brain. Second, the response in the brain is significantly lower than in muscle, therefore, it appears that the regulatory mechanisms differentiating expression between the two tissues are most likely unique. In addition, expression in the brain may be regulated by multiple functions of both angiogenesis and neurogenesis or neuroprotection.
As already emphasized here, S. galili is better adapted to hypoxia than S. judaei, and for adult animals, at all conditions studied here, a similar trend in levels of muscle Flk1 mRNA repeats itself, that is, Rattus > S. judaei > S. galili, an inverse correlation with the tolerance of the species to hypoxia. In contrast, the response in the adult brain appears to take on an alternate reverse trend with slightly larger responses in S. galili as compared to S. judaei or Rattus. In the brain, where blood vessel density in Spalax and Rattus is similar (12
, 31)
, one would expect that as a result of adaptation to a more extreme environment Spalax is capable of mounting a more efficient response to hypoxia.
Considering the enhanced efficiency of response to hypoxia it would make sense to assume that Spalax has developed adaptive mechanisms in the brain that respond quickly to acute hypoxia before longer term angiogenesis is initiated. The regulation of blood flow to the brain and the biochemical mechanisms involved, while well established in Rattus, have yet to be studied in Spalax. The higher response of Flk1 mRNA in the brain of S. galili to hypoxia may reflect a more efficient mechanism of blood vessel formation or neuroprotection as an adaptation to the extreme underground environment.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Received for publication April 25, 2007. Accepted for publication July 19, 2007.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  M. Band, A. Joel, A. Hernandez, and A. Avivi Hypoxia-induced BNIP3 expression and mitophagy: in vivo comparison of the rat and the hypoxia-tolerant mole rat, Spalax ehrenbergi FASEB J, July 1, 2009; 23(7): 2327 - 2335. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
