Published as doi: 10.1096/fj.06-7538com.
(The FASEB Journal. 2007;21:2205-2214.)
© 2007 FASEB
Fast skeletal muscle regulatory light chain is required for fast and slow skeletal muscle development
Yingcai Wang*,
Danuta Szczesna-Cordary*,1,
Roger Craig
,
Zoraida Diaz-Perez*,
Georgianna Guzman*,
Todd Miller* and
James D. Potter*,1
* Department of Molecular and Cellular Pharmacology, University of Miami, Miller School of Medicine, Miami, Florida, USA; and
Department of Cell Biology, University of Massachusetts Medical School, Worcester, Massachusetts, USA
1Correspondence: J.P., Department of Molecular and Cellular Pharmacology, University of Miami, Miller School of Medicine, Rm. 6085A RMSB, 1600 NW 10th Ave, Miami, FL 33136 USA. E-mail: jdpotter{at}miami.edu D.S.-C., Department of Molecular and Cellular Pharmacology, University of Miami, Miller School of Medicine, Rm. 6113 RMSB, 1600 NW 10th Ave, Miami, FL 33136, USA. E-mail: dszczesna{at}med.miami.edu
 |
ABSTRACT
|
|---|
In skeletal muscle, the myosin molecule contains two sets of noncovalently attached low molecular weight proteins, the regulatory (RLC) and essential (ELC) light chains. To assess the functional and developmental significance of the fast skeletal isoform of the RLC (RLC-f), the murine fast skeletal RLC gene (Mylpf) was disrupted by homologous recombination. Heterozygotes containing an intronic neo cassette (RLC/+) had approximately one-half of the amount of the RLC-f mRNA compared to wild-type (WT) mice but their muscles were histologically normal in both adults and neonates. In contrast, homozygous mice (RLC/) had no RLC-f mRNA or protein and completely lacked both fast and slow skeletal muscle. This was likely due to interference with mRNA processing in the presence of the neo cassette. These RLC-f null mice died immediately after birth, presumably due to respiratory failure since their diaphragms lacked skeletal muscle. The body weight of newborn RLC-f null mice was decreased 30% compared to heterozygous or WT newborn mice. The lack of skeletal muscle formation in the null mice did not affect the development of other organs including the heart. In addition, we found that WT mice did not express the ventricular/slow skeletal RLC isoform (RLC-v/s) until after birth, while it was expressed normally in the embryonic heart. The lack of skeletal muscle formation observed in RLC-f null mice indicates the total dependence of skeletal muscle development on the presence of RLC-f during embryogenesis. This observation, along with the normal function of the RLC-v/s in the heart, implicates a coupled, diverse pathway for RLC-v/s and RLC-f during embryogenesis, where RLC-v/s is responsible for heart development and RLC-f is necessary for skeletal muscle formation. In conclusion, in this study we demonstrate that the Mylpf gene is critically important for fast and slow skeletal muscle development.Wang, Y., Szczesna-Cordary, D., Craig, R., Diaz-Perez, Z., Guzman, G., Miller, T., Potter, J. D. Fast skeletal muscle regulatory light chain is required for fat and slow skeletal muscle development.
Key Words: RLC-f knock-out mouse myofibril structure histology
 |
INTRODUCTION
|
|---|
THE REGULATORY LIGHT CHAIN (RLC) of striated muscle can be encoded by three genes, the fast skeletal muscle (mouse gene: Mylpf, NCBI accession #NM_016754), the ventricular/slow skeletal (MYL2), and the atrial (MYL7) encoding for RLC-f, RLC-v/s and RLC-a proteins, respectively (1
2
3)
. It has been shown that disruption of RLC gene expression in drosophila resulted in the flightless phenotype (4
5
6)
. Moreover, disruption of the MYL2 gene in mouse heart led to embryonic lethality in homozygous mice and caused severe defects in cardiac sarcomeric assembly (7)
. Heterozygous mice were indistinguishable from wild-type (WT) mice in all aspects and displayed normal levels of RLC-v/s protein despite a 50% reduction in mRNA (7)
. To assess the functional and developmental significance of the fast skeletal RLC isoform (RLC-f), an RLC-f knockout mouse was developed utilizing a strategy, where a floxed neo cassette was inserted in intron 2 of the Mylpf gene. In this study, we provide detailed information on the generation and appearance of homozygotes containing these intronic neo cassettes that resulted in the knockout of the Mylpf gene (RLC/) and compare them to the heterozygote (RLC/+) and WT mouse phenotypes. We also present insight into mechanisms implicated in the role of fast and slow skeletal RLC in skeletal muscle development. There have been only two other studies describing null phenotypes of genes encoding skeletal myofilament proteins, skeletal muscle actin (8)
, and Ca2+/calmodulin-dependent skeletal muscle myosin light chain kinase (MLCK; ref. 9
). Mice lacking skeletal actin died in the early neonatal period (day 1 to 9); however, they appeared normal at birth. A loss of glycogen and reduced brown fat that result in malnutrition were most likely responsible for death of the neonatal null mice (8)
. In contrast to our study, other actin isoforms (cardiac and vascular smooth muscle) could partially compensate for the lack of skeletal actin in null mice, but this was not sufficient to support adequate skeletal muscle growth and/or function (8)
. Ablation of the MYLK2 gene in mice resulted in loss of skeletal muscle MLCK expression, with no change in smooth muscle MLCK expression (9)
. The post-tetanic potentiation of the isometric twitch tension and RLC phosphorylation responses were significantly attenuated with ablation of MYLK2 expression. No obvious phenotypes were noted for the knockout mice, including litter size, fertility, or viability relative to WT mice (9)
. In the recent study of Rottenbauer et al. (10)
, the authors isolated a mutation in zebrafish, tell tale heart (telm225), which selectively perturbed contractility of the embryonic heart. By positional cloning, they identified tel as encoding the zebrafish MYL2 gene (zMLC-2). In contrast to mammals, zebrafish have only 1 cardiac-specific mlc-2 gene (10)
and the loss of zMLC-2 function could therefore not be compensated for by up-regulation of another MYL2 gene. Ultrastructural analysis of tel cardiomyocytes revealed a complete absence of organized thick myofilaments (10)
.
In this study, we demonstrated that there is a specific requirement for RLC-f protein expression in the formation of fast and slow skeletal muscle. Since we found that the MYL2 gene encoding for RLC-v/s is only expressed after birth in skeletal muscle of WT mice, it is likely that this would be too late to rescue normal skeletal muscle development in the RLC-f null mice.
 |
MATERIALS AND METHODS
|
|---|
Construction of targeting vector
A genomic clone including the entire murine Mylpf gene was isolated from the mouse 129/sv genomic library. To construct the targeting vector, two separate gene fragments were subcloned into Pbluescript II KS(+) (Stratagene, La Jolla, CA, USA). 1) The 1.7 Kb PstI fragment, containing exon 14, was used to generate the D/A mutation at codon 49. The mutation was introduced into a SacI/ PstI subclone containing exon 3 and 4 using the four pair oligonucleotide PCR mutagenesis method. The sense oligonucleotide (5' CGACAAAGAGGCTCTTCGGGACAC3') and antisense oligonucleotide (5'CCCGAAGAGCCTCTTTGTCGATAATG 3') contain the mutation (underlined), and the T7 and T3 primers were from the vector flanks. The PCR product was cut with SacI/PstI and replaced the same fragment in subclone 1. In this clone, a polylinker that contains 5'-PflM1-XhoI-ClaI-PflM13' sites was inserted into the unique PflM1site. 2) The 4.5 Kb PstI/XhoI fragment encompassing exon 57 was then joined to subclone 1 to form plasmid 1 + 2. The targeting construct was generated in the vector Osdupdel, which contains MCI neo, flanked by loxP and thymidine kinase under control of 3' phophoglycerate kinase (PGK; a gift from O. Smithies, University of North Carolina), as follows: the PstI/ XhoI (1.7 Kb) fragment from plasmid 1 + 2 was ligated to the vector downstream from the neo gene to form the 5' region homology. The XhoI/XhoI fragment from plasmid 1 + 2 was ligated to the same site between the neo and Tk gene to form the 3' region homology. The transcription orientation of the Mylpf and neo marker is opposite in this targeting vector.
Generation of RLC-f mutant mice
Thirty micrograms of the NotI linearized construct were electroporated into Tc1 ES cells. Culture and selection of recombinant ES clones were performed as described previously (11)
by using positive (G418) and negative (ganciclovir) selection. Recombinant ES clones were screened by PCR with a 5' primer upstream to the PstI site external to the construct and a 3' primer from the neo gene amplifying a 1.8 Kb fragment. Clones shown positive by PCR were confirmed by Southern blot using KpnI digestion and probing with 5' RLC-f and neo probes. This analysis was also verified with EcoR V digested DNA, using a 3' probe (see Fig. 1
B). The same analyses were also used for screening of heterozygote and homozygote mice. Three independent clones that carried homologous recombinant constructs were injected into C57BL/6 blastocysts. Male progeny with a high percentage of coat color chimerism were bred to C57BL/6 females to establish germ line transmission. The mouse genotypes were identified by Southern blot of tail DNA digested with XhoI based on the XhoI site inserted into the polylinker at intron 3 (data not shown).

View larger version (21K):
[in this window]
[in a new window]
|
Figure 1. Strategy used to mutate mouse RLC-f via gene targeting and Southern blot to characterize the targeted ES cells and RLC-f mutant mice. A) Diagrams from top to bottom show WT Mylpf, illustrating the exon-intron organization and simplified restriction map of the murine Mylpf gene (NCBI accession #NM_016754) surroundings; targeting vector, illustrating the targeted construct region to introduce lox P flanked neo cassette site, tk gene, polylinker and the D49A mutation; mutated RLC-f, indicating mutated Mylpf after homologous recombination and probes used for Southern blot to identify targeted ES clone and mutated mice; restriction sites: B, Bam H1; C, ClaI; E, EcoR V; K, KpnI; P, PstI; Pf, PflM; S, SacI; X, XhoI. B) Southern blot pattern shows targeted and untargeted ES cell DNA after KpnI digestion using the 5' and neo probes, and after EcoRV digestion using the 3' probe. Lanes 1, 4, and 7 are untargeted ES clones and lanes 2, 3, 5, 6, 8, and 9 are targeted ES clones. Note that digestion of targeted DNA generates fragments 1.2 Kb bigger than untargeted DNA due to inclusion of the1.2 Kb neo cassettes within intron 2. Both alleles are shown in targeted digests. C) Southern blot analysis of KpnI and EcoR V digested tail DNA of progeny from interheterozygote mating. Lanes 1, 4, and 7 WT (RLC+/+); lanes 2, 5, and 8 RLC/+ heterozygote; lanes 3, 6, and 9 RLC/ homozygote.
|
|
Northern blot
Hind limbs of progeny were dissected, and total RNA was extracted using Trizol reagent (Invitrogen Life Technologies, Inc., Carlsbad, CA, USA) according to the manufacturers directions. Fifteen micrograms of RNA were loaded per lane. After the RNA was transferred to hybond-XL nylon membrane (Amersham, Piscataway, NJ, USA), the blot was serially hybridized to probes which were labeled with [
-32P]dCTP using the Rediprimer labeling kit (Amersham). After each hybridization, the bound probe was removed by washing the blot in a boiling solution of 1x SSC-0.1% SDS. Removal of the probe was confirmed before the next hybridization was carried out. After hybridization, the membrane was exposed to X-ray film (Kodak MOMAT) to obtain an autoradiographic image. The DNA bands were visualized and quantified using a phosphoimager and Image Quant Software.
PCR and RT-PCR analyses
To examine the expression of muscle-specific genes as well as the Diff6 gene in RLC/, RLC/+, and WT mice at early stages of muscle development, total RNA samples were isolated from the legs of 14-, 17-, and 20-day-old embryos. The primers used for amplify these genes are listed in Table 1
.
Western blot
Tissue was dissected and homogenized using a Retsch Mixer Mill in a solution of 1% SDS and 1% ß-mercaptoethanol, 1 mM EDTA, and protease inhibitors. The protein concentration of each cleared homogenate was determined by Bio-Rad Coomassie Plus assay and adjusted to a uniform concentration in Laemmli loading buffer. Protein samples were boiled, electrophoresed on 6% or 15% SDS polyacylamide gels, and transferred to nitrocellulose membrane (Bio-Rad, Hercules, CA, USA). Blocking and 1 h antibody incubations were done at room temperature. Membranes were blocked 30 min in 5% nonfat dry milk for chemoluminescence detection or in a 50:50 mix of Tris buffered saline: Rockland blocking buffer for Odyssey fluorescence detection. Rabbit polyclonal anti-RLC serum developed in this laboratory was used at a 1:5000 dilution for detection of the RLC. The specific RLC antibody was detected with a 1:4000 dilution of goat anti-rabbit IgG antibody labeled with peroxidase or CY5.5 fluorescent dye. Reaction signal was measured by scanning the blot with the Odyssey Infrared Imager (LICOR). Myosin essential light chain (ELC) was used as a loading control and was detected with an ELC-specific monoclonal antibody (MAB150; Accurate Chemical and Scientific Corp., Westbury, NY, USA).
ATPase staining
For classification of skeletal muscle fibers into type I or type II fibers, EDL muscle samples were dissected from three 18-month-old male mice of each genotype. The samples were frozen in liquid nitrogen-cooled isopentane and immediately placed in a cryostat cabinet at 20° for 1 h. Serial 10 µm cross sections of fibers were taken from the midlength of the muscle and stained for ATPase at pH 4.35 to detect type I fibers and at pH 10.3 to detect type II fibers as described previously (12)
.
Microscopy
Adult or newborn mice were killed by exposure to an atmosphere of 100% CO2. EDL muscles (adult) or entire legs (adult and neonate) were removed, and the skin was peeled off the legs in the case of the adult. Specimens were then fixed in PBS-buffered glutaraldehyde at 4°C overnight or longer. After fixation, specimens were osmicated (in the case of whole legs, the gastrocnemius was first dissected out), dehydrated, and embedded in Embed 812/Araldite 502. For light microscopy, 1 µm longitudinal sections were cut and stained with toluidine blue. Images of the ATPase stained muscle sections were digitized and analyzed with AxioVision 4 software (Carl Zeiss MicroImaging, Inc., Thornwood, NY, USA). The cell numbers of type I and type II fibers were determined by counting them in six randomly selected cross-sectional areas of 900 µm2 (a total of 5400 µm2 per section). For electron microscopy, 100 nm sections were stained with uranyl acetate and lead citrate. Light microscope images were recorded digitally with a PixeLINK PL-A662 camera on an Olympus microscope. Electron micrographs were recorded on Philips CM10 and CM12 electron microscopes. For each age, WT and heterozygote mutant (RLC/+) animals were studied, one each for the adult, and two each for the neonate.
 |
RESULTS
|
|---|
Generation and characterization of RLC-f mutant mice
To generate RLC-f null (RLC/) mice a knockout/knockin strategy was utilized, where a point mutation in exon 3 of the Mylpf was introduced into a targeting construct with a floxed neo cassette in intron 2 of the Mylpf gene (Fig. 1A
). Other than this mutation, the coding sequence in the construct including the entire 7 exons of Mylpf was unchanged; however, new restriction sites were introduced 3' to the neo cassette to facilitate molecular analysis. The targeting construct was linearized with NotI and electroporated into 129/SV derived Tc 1 embryonic stem cells (13)
. Of 148 G-418 and ganciclovir selected ES clones analyzed for homologous recombination, nine ES clones contained the correct targeting events. Two independent ES clones heterozygous for the targeted mutation of the Mylpf gene were characterized by Southern blot using KpnI digestion and probing with 5' RLC-f and neo probes and verified with EcoR V digested DNA, using a 3' probe (Fig. 1B
). These clones were injected into C57BL/6 blastocysts to produce male chimeras. These males were mated with C57BL/6 females to obtain heterozygotes. Since a 1.2 kb PGK neo cassette was inserted in intron 2 of Mylpf, a 6.7 kb mutated allele and a 5.5 kb wild type allele were generated when the mouse tail DNA was digested with KpnI and hybridized with a 5' probe (Fig. 1C
). These results were verified in EcoRV digested DNA by using the 3' probe (Fig. 1C
). Southern blot analysis showed that
50% of the agouti offspring carried the mutation. Phenotypes of Mylpf targeted mice from the two independently derived ES clones were found to be identical.
Lethality and the lack of skeletal muscle development in RLC/ mice
Surprisingly, when RLC/+ mice were cross-mated, the surviving F2 litters showed a nontypical Mendelian distribution of offspring in which the homozygous (RLC/) genotype was not found. The genotypic ratio of 69 (WT):146 (RLC/+):0 (RLC/) was observed in the surviving F2 generation (
25%:50:0), a ratio that could suggest a recessive lethal transmission. Analysis of the nonsurviving pups showed that they all contained the RLC/ genotype. This result indicated that RLC/ mice died either before or after delivery. To explore further the exact time of RLC/ lethality, 58 embryos from 8 litters were genotyped at 20 days gestation utilizing Southern blots along with 72 newborn pups from 11 litters, including those that died immediately after birth. The 20-day embryos and newborns showed normal Mendelian distribution, confirming that RLC/ mutant mice died shortly after birth. As shown in Fig. 2
A, the newborn RLC/ mice were much smaller in size than their heterozygous (RLC/+) or WT littermates and their body weight (1.02±0.05 g, n=12) was only
70% of the WT or RLC/+ mice (1.34±0.07 g, n=18). There was no visible skeletal muscle mass in their limbs (Fig. 2C
). In contrast, heterozygous RLC/+ mice were viable and indistinguishable in size, body weight, and heart weight from the WT. They had a normal life span and were able to reproduce normally. Light microscopic images of the diaphragm from WT mice had normal muscle fibers whereas the RLC/ mice lacked these (Fig. 2B
). Northern blot analysis of the hind limb muscles from newborn mice revealed that there was no detectable RLC-f mRNA (Fig. 3
A) or protein (Fig. 3B
) in the RLC/ mice and they had an
50% reduction in RLC/+ mRNA compared with WT mice (Fig. 3A
and Fig. 4
A). These results suggest that the neo cassette may have interfered with the proper splicing of the RLC-f transcript from the recombined gene. We conclude that this transcriptional interference caused a loss of RLC-f expression in the RLC/ homozygote, resulting in the absence of skeletal muscle development and lethality to newborn pups probably due to respiratory failure.

View larger version (66K):
[in this window]
[in a new window]
|
Figure 2. Anatomic and structural analysis of newborn RLC/ and WT mice. A) WT newborn mouse (left) and smaller sized, skeletal muscle deficient homozygous RLC/ newborn mouse (right). Body weight of WT mouse was 1.34 ± 0.07 g, while body weight of RLC/ mouse was 1.02 ± 0.05 g. B) Unstained phase contrast views of freshly excised diaphragm show normal muscle fiber of WT mouse (left), and no skeletal muscle fiber, but normal epithelial cell membrane of RLC/ mice (right). In focusing through entire thickness of the RLC/ specimen, no muscle fibers could be found in contrast to WT specimen where muscle fibers were visible. This was clearly shown in H&E (hematoxylin and eosin) stained cross sections of diaphragm (25)
. C) Leg specimens were fixed in 2% p-formaldehyde/2.5% gluteraldehyde in PBS at 4°C overnight. Paraffin embedded 5 µm longitudinalhistological sections stained with H&E (prepared by American Histolabs, Inc., Gaithersburg, MD, USA) show total absence of skeletal muscle fibers in hind limb of RLC/ neonatal mouse (right) compared to normal skeletal muscle fibers seen in WT neonatal mouse (left). In B and C, light microscope images were recorded digitally with an AxioCam HRC camera on a Zeiss Axiovert 200M microscope; bars = 20 µm.
|
|

View larger version (22K):
[in this window]
[in a new window]
|
Figure 3. Mylpf mRNA, protein and muscle-specific gene expression analyses in hind limb of WT, RLC/+, and RLC/ embryonic and newborn mice. A) Northern blot analysis of Mylpf and neo mRNA content of hind limbs of WT, RLC/+ and RLC/ mice shows total absence of Mylpf mRNA expression in RLC/ mice. Top panel) Probed with a Mylpf specific cDNA probe. Middle panel) Probed with neo cDNA; Bottom panel) Probed with GAPDH mRNA as an internal standard for loading. B) Western blot analysis of RLC-f protein expression in WT, RLC/+, and RLC/ mice depicts total absence of RLC-f protein expression in RLC/ mice. C) Skeletal muscle-specific mRNAs are absent in RLC/ mice. Total RNA samples were extracted from mouse legs of 14-, 17-, and 20-day-old embryos of RLC/, RLC/+ and WT mice. Note that no mRNAs of fast skeletal RLC (Mylpf), slow skeletal RLC-v/s (MYL2), embryonic isoform of myosin heavy chain (MYH3), fast skeletal myosin alkali (essential) light chain (MYL1), and fast skeletal troponin I (TNNI2) were expressed in RLC/ compared with RLC/+ and WT mice. D) Expression of Diff6 gene in the leg, heart, and liver of WT, RLC/+ and RLC/ mice.
|
|

View larger version (21K):
[in this window]
[in a new window]
|
Figure 4. Mylpf (RLC-f) and MYL2 (RLC-v/s) mRNA and protein analysis of EDL muscle in WT and RLC/+ mice. A) mRNA hybridized with a cDNA probe recognizing both the Mylpf and the MYL2 genes (left); hybridized with a cDNA probe specifically recognizing Mylpf (middle); and hybridized with a cDNA probe specifically recognizing MYL2 (right); showing decreased Mylpf mRNA, and a compensatory increase of MYL2 mRNA in RLC/+ mice. GAPDH mRNA levels were also determined as an internal standard for loading. B) Western blot analysis of RLC-f and RLC-v/s expression in EDL muscle in young WT and RLC/+ mice. Myosin essential light chain (ELC) (MYL1 gene) was used as a loading control and was detected with an ELC-specific monoclonal antibody MAB150 (Accurate Chemical and Scientific Corp). C) Classification of WT and RLC/+ mice EDL muscle into type I and type II fibers. Cross sections of EDL muscle were stained for myosin ATPase at pH 4.35. Type I fibers show dark staining while type II fibers are unstained. Bar = 50 µm.
|
|
Skeletal muscle-specific gene expression in RLC/ mice
Since no muscle development was observed in RLC/ mice, we conducted RT-PCR to examine transcription of skeletal muscle-specific genes in the limbs of the embryos of RLC/, RLC/+, and WT mice (Fig. 3C and D
). Total RNA was extracted from the mouse legs and studied utilizing primers designed to amplify muscle specific genes (Table 1)
. As shown in Fig. 3C
, no mRNAs of fast skeletal RLC (RLC-f), slow skeletal RLC (RLC-v/s), the embryonic isoforms of myosin heavy chain (E-MHC), essential myosin light chain 1 (ELC1), and fast troponin I (TnI-f) were expressed in RLC/ compared with RLC/+ and WT mice. With the exception of RLC-v/s, high levels of all skeletal muscle-specific genes examined were expressed in embryos of RLC/+ and WT mice (Fig. 4C
). The RLC-v/s mRNA was barely detectable in 17-day-old embryos of WT and RLC/+ mice and did not accumulate until embryo day 20 (Fig. 3C
). The RLC-s/v protein could only be detected in mouse legs after birth (Fig. 3B
). These results indicate that no skeletal muscle cells were present in the legs of RLC/ mice. In addition, we have examined whether the neo gene in the Mylpf locus exclusively interrupted transcription of the Mylpf gene and did not affect the expression of neighboring genes. RT-PCR was employed to test the expression level of the Diff6 gene, which is oriented tail to tail with the Mylpf gene and separated by
200 bp between their poly(A) signals (Fig. 3D
). As shown, the expression of Diff6 was not disrupted in the leg, heart, and liver of RLC/, RLC/+, and WT mice. Since the Diff6 gene is ubiquitously expressed in all tissues, and its expression was not altered, we conclude that the insertion of the neo cassette specifically disrupted expression of the Mylpf gene. Moreover, the Southern blot probed with the neo gene showed that only one copy of neoloxP was inserted in the DNA sequence at the Mylpf locus (Fig. 1C
).
Compensation in RLC-v/s expression in skeletal muscle of RLC/+ mice
Since the mRNA in RLC/+ mice was only 50% of that of WT littermates, we examined the expression pattern of RLC-v/s (mRNA and protein) to see if there was a possibility of a compensatory mechanism for sarcomeric proteins, as observed in other knockout mice (7
, 8
, 14
, 15)
. Northern blot analysis of the mRNA expression in EDL muscle of young adult mice (with a 142 bp 5' cDNA probe for RLC-f, which could also recognize RLC-v/s), showed equal levels of total mRNA (RLC-f and RLC-v/s) in RLC/+ and WT mice (Fig. 4A
, left panel). Hybridization with the 3' probe specific for RLC-f showed a decreased level of RLC-f in RLC/+ mice compared to WT (Fig. 4A
, middle panel). An increased expression of RLC-v/s mRNA was observed in RLC/+ vs. WT mice when the 3' probe, specific for RLC-v/s, was used (Fig. 4A
, right panel). In addition, Western blot analysis showed a 3.3-fold higher expression of RLC-v/s protein in RLC/+ vs. WT mice and this was accompanied by a 10% reduction in the expression of RLC-f (Fig. 4B
). Note that under our experimental conditions (15% SDS-PAGE), the RLC-v/s isoform migrates slower than RLC-f (Fig. 4B
). Myosin ELC1 was used as a loading control. These results show that this might represent a compensatory response in the heterozygous mice. Since the proportion of RLC-f vs. RLC-v/s protein in EDL muscle was increased in RLC/+ mice compared to WT mice (Fig. 4B
), we performed histological staining for myosin ATPase activity to determine whether this change could be due to alterations in fiber number or type. Type I and II fibers were visualized by myosin ATPase staining at pH 4.35 (Fig. 4C
). As was shown in (12)
, type I fibers, but not type II fibers, are well stained at pH 4.24.6. The opposite is true at basic pH (10.210.5) (12)
. Our initial preincubation of muscle sections at pH 4.35 or at pH 10.35 confirmed this reciprocal distribution of staining of the EDL muscle sections from WT and RLC/+ mice. Our results revealed that the absolute cell number in EDL muscle of RLC/+ mice (240±8, n=3) was not statistically different compared with the EDL muscle of WT mice (239±7, n=3; Fig. 4C
). Also, the proportion of type II and type I fibers in EDL muscle of RLC/+ mice was 93:7% and it was similar to that observed in WT mice (92.9:7.1%). These results indicate that the 10% increase of RLC-v/s protein in EDL muscles of the RLC/+ mice compared with WT control mice was not due to increased numbers of type I fibers in RLC/+ mice. Up-regulation of RLC-v/s protein in RLC/+ mice might be due to a post-transcriptional regulation of RLC isoform expression that allows the RLC/+ mice to maintain more or less normal sarcomeric structure and function.
RLC-v/s is not expressed in embryonic skeletal muscle
To understand why no slow skeletal muscle development was observed in RLC/ mice, we examined the expression pattern of the RLC-v/s in skeletal and heart muscles of RLC/ mice vs. control groups. Unlike the whole body mass, hearts of newborn RLC/ homozygous mice were normal in size and weight (0.013±0.002 g) and hearts from 20-day-old RLC/ embryos beat normally. Western blot analysis of the RLC-v/s expression in the heart of newborn RLC/ vs. RLC/+ vs. WT mice revealed no differences (Fig. 5
A). This result indicated that the RLC-v/s gene was not interrupted in RLC/ mice and that the lack of slow skeletal muscle formation in these mice must be due to other mechanisms. This finding of the lack of slow skeletal muscle development in RLC/ mice with normal formation of the heart prompted us to examine the expression pattern in normal mice of RLC-v/s in skeletal muscle of 14-, 16-, 18-, and 20-day-old embryos (Fig. 5B
, top panel) and that of 1-, 2-, 4-, 7-, 10-, 14-, and 21-day-old neonates (Fig. 5C
). As demonstrated by Western blot, the RLC-v/s was not expressed in embryonic hind limb muscle (Fig. 5B
, top panel). The expression of RLC-v/s in hind limb muscle was only initiated after birth (Fig. 5C
). The peak expression was observed at
10 days after birth (Fig. 5C
). The expression of RLC-v/s in the embryonic ventricular tissue, however, was at a constant level from E14 to E20 (Fig. 5B
, bottom panel).

View larger version (21K):
[in this window]
[in a new window]
|
Figure 5. SDS-PAGE analysis of RLC-f and RLC-v/s proteins of ventricles and hind limb muscle in embryonic and neonatal mice. A) RLC-v/s protein analysis shows no difference in ventricle from WT, RLC/+ and RLC/ newborn mice. B) Protein analysis illustrates RLC-v/s was not expressed in hind limb muscle in 1420 d WT embryos (top panel), and expressed consistently in ventricles in the same day WT embryos (bottom panel). C) RLC-f and RLC-v/s protein expression in hind limb muscle of WT neonatal mice shows that RLC-v/s expression started after birth. Abbreviations: E, embryo; d, day; STD, Standard (purified RLC-f and RLC-v/s protein mixture).
|
|
These results suggest that RLC-f is the only RLC isoform expressed in embryonic skeletal muscle and that the loss of RLC-f expression causes a complete lack of skeletal muscle development in both fast-twitch and slow-twitch muscles. Therefore, the RLC-f seems to be indispensable and necessary for all types of skeletal muscle development during embryogenesis and cannot be replaced or compensated for by the RLC-v/s due to its late expression in development.
Myofibril structure in RLC/+ mice
As demonstrated by electron micrographs of EDL muscles of newborn mice, there were no significant structural differences between age-matched RLC/+ and WT mice, either neonate (Fig. 6
) or adult (Fig. 7
). In the adult, both RLC/+ and WT specimens showed tightly packed myofibrils with typical A-bands, I-bands, M-lines, and Z-lines (Fig. 7)
. Fast and slow fibers were recognizable in both RLC/+ and WT animals (wider Z-lines and more mitochondria in slow fibers). In the case of neonate muscles, in both RLC/+ and WT, the myofibrils were much more sparsely packed, and the fibers overall appeared to be still in the process of formation (Fig. 6)
. A-bands, M-lines pseudo-H-zones, and Z-lines were similar in both RLC/+ and WT muscles. However, the neonate fibrils of both RLC/+ and WT muscles were contracted, so that there was no visible H-zone or I-band, and the thick filaments pushed against or penetrated the Z-line (Fig. 6)
.

View larger version (96K):
[in this window]
[in a new window]
|
Figure 6. Histology and electron microscopy of neonate leg muscles shows no structural differences between WT (AC) and RLC/+ (DF) fibers. A, D) 1 µm longitudinal histological sections (bar=25 µm). B, C, E, F) 100 nm longitudinal electron microscopic sections. Bars = 2 µm (B, E) and 1 µm (C, F).
|
|

View larger version (91K):
[in this window]
[in a new window]
|
Figure 7. Histology and electron microscopy of adult leg muscles shows no structural differences between WT (AC) and RLC/+ (DF) fibers. A, D)1 µm longitudinal sections (bar=25 µm); B, C, E, F) 100 nm longitudinal electron microscopic sections. Bars = 2 µm (B, E) and 1 µm (C, F).
|
|
 |
DISCUSSION
|
|---|
This study is the first to show the effects of disrupting the Mylpf gene on the formation and development of fast and slow skeletal muscle. The strategy that was utilized to produce the RLC-f knockout mice was previously used to generate a mouse model for achondroplasia (11)
. The neo cassette inserted in intron 2 of Mylpf interrupted Mylpf transcription, and as a consequence, an RLC-f null (RLC/) mouse phenotype was produced. Surprisingly, the RLC-f null mice showed a complete lack of skeletal muscle during development, suggesting that there is a specific requirement for RLC-f in the formation of both fast and slow skeletal muscle. Possibly, the myosin molecule lacking its regulatory subunit RLC cannot form its normal heteromultimeric structure containing two heavy chains, two ELC and two RLC. Therefore, we hypothesize that if this heteromultimer does not assemble or does so improperly, it would be degraded by the cell machinery for removing improperly folded proteins. Another possibility is that myosin heavy chains were not able to form thick filaments in the absence of RLC. The lack of thick filaments or the presence of abnormal ones would prevent normal myofibrillogenesis and lead to the death of the myocyte.
Contractile proteins occur as multiple isoforms that demonstrate a developmental and tissue-specific pattern of expression (16)
. MHC is one of the major sarcomeric proteins that can exist in multiple forms in striated muscle, and these are encoded by a highly conserved multigene family (17)
. The embryonic MHC gene (MYH3) belongs to this highly conserved multigene family and exhibits a high degree of nucleotide and amino acid sequence conservation with other sarcomeric MHC genes from nematode to humans (18)
. These early isoforms are gradually replaced by adult forms after birth. Our study shows that this transition may not occur when the endogenous MHC binding partner RLC is absent. We have also shown that even though the cardiac RLC isoform RLC-v/s was expressed in embryonic heart tissue, its late expression in skeletal muscle could not compensate for the lack of embryonic RLC-f. This finding agrees with previous studies where distinct regulatory programs for cardiac and skeletal muscle specific expression of the RLC-v/s gene were seen in transgenic mice overexpressing the slow skeletal/ventricular isoform of RLC (19)
. The MYL2 promoter fragment conferred cardiac-specific expression and was not detectable in slow skeletal muscle (19)
.
Interestingly, there are only two studies characterizing mouse knockout models for other skeletal myofilament proteins (8
, 9)
. Crawford et al. (8)
showed that skeletal-muscle-actin-deficient mice were indistinguishable from normal mice at birth, but they failed to thrive and thus died during the neonatal period. Although the null animals could breathe, walk, and suckle, apparently through a compensatory response leading to an increased expression in their skeletal muscles of cardiac and vascular actin, their muscles were weaker than those of their heterozygous and wild-type littermates and they died within 10 days, apparently from malnutrition. In the study by Zhi et al. (9)
, the lack of skeletal muscle MLCK expression had no effect on cardiac RLC phosphorylation, but in isolated fast-twitch skeletal muscles from these knockout homozygous mice, there was no increase in RLC phosphorylation in response to repetitive electrical stimulation. Interestingly, the authors reported that there was a small amount of monophosphorylated muscle RLC in muscles from MYLK2 knockout mice. Phosphorylation of the serine near the serine phosphorylated by MLCK indicated that another kinase might be involved in RLC phosphorylation.
Previous results from in vitro studies showed that the removal of RLC from skeletal muscle myosin greatly reduced actin sliding velocity (20)
. Removal of RLC from skinned skeletal muscle fibers decreased maximal force, Ca2+ sensitivity of force, and the rates of force activation measured with caged Ca2+ chelators (21)
. Studies with cardiac RLC animal models suggest that different regulatory and compensatory mechanisms occur in skeletal vs. cardiac muscles. Selective disruption of the cardiac ventricular RLC gene (MYL2) resulted in the sarcomeric disassembly of embryonic hearts and caused the early death (E 12.5) of the RLC-v/s/ mouse embryos (7)
. Clearly, the ventricular isoform of RLC has a unique function in the maintenance of cardiac ventricular chamber morphogenesis and contractility (7)
. In addition, the authors showed that the ventricles of heterozygous mutants that displayed a 50% reduction in MYL2 mRNA and expressed normal levels of protein exhibited normal cardiac function similar to WT mice (15)
. There were no differences in contractility and response to Ca2+ between WT and heterozygous cardiomyocytes. Thus, heterozygous mutants showed neither a molecular nor a physiological cardiac phenotype (15)
. Similarly, we showed that even although heterozygous null mice displayed a 50% reduction in Mylpf mRNA in skeletal muscle, no obvious structural differences between myofibrils of WT and heterozygous mice, either adult or neonate, were observed. A null mutation of the RLC in Drosophila melanogaster resulted in dominant flightless behavior that was associated with reduced wing beat frequency (4)
. The heterozygotes exhibited a 50% reduction in RLC mRNA concentration in adult thoracic tissue and resulted in a corresponding reduction of RLC protein in the indirect flight muscles. The authors showed that endogenous RLC stoichiometry is required for normal indirect flight muscle assembly and function. Similar to our studies, ultrastructural analysis of tel cardiomyocytes revealed complete absence of organized thick myofilaments due to mutation in the zebrafish MYL2 gene (10)
.
As was shown by others, skeletal myogenesis is initiated in the embryo as a result of signaling molecules from surrounding tissues that specify myogenic cell fate (ref 22
and references within). The MyoD family members were shown to play a role in these processes (23
, 24)
. Perhaps expression of myosin RLC-f protein is required for early myogenesis and together with other signaling molecules initiates and then regulates skeletal muscle formation and development. Further work is in progress to determine whether muscle begins to form in the RLC-f null mice or if it never starts. Additionally, if it does start, how does it stop? Answers to these questions will lead to a better understanding of the role of the RLC-f in normal skeletal muscle development.
 |
ACKNOWLEDGMENTS
|
|---|
This work was supported by National Institutes of Health (NIH)-HL-071778 (D. Szczesna-Cordary), NIH-AR-034711 (R. Craig), and NIH-AR-45183 (J. D. Potter). We thank Dr. Greg Hendricks for processing of muscle specimens for light and electron microscopy carried out at the Core Electron Microscopy Facility of the University of Massachusetts Medical School, supported in part by Diabetes Endocrinology Research Center grant DK32520.
Received for publication October 23, 2006.
Accepted for publication February 8, 2007.
 |
REFERENCES
|
|---|
- Macera, M. J., Szabo, P., Wadgaonkar, R., Siddiqui, M. A., Verma, R. S. (1992) Localization of the gene coding for ventricular myosin regulatory light chain (MYL2) to human chromosome 12q23q24.3. Genomics 13,829-831[CrossRef][Medline]
- Morano, I. (1999) Tuning the human heart molecular motors by myosin light chains. J. Mol. Med. 77,544-555[CrossRef][Medline]
- Szczesna, D. (2003) Regulatory light chains of striated muscle myosin. Structure, function and malfunction. Curr. Drug. Targets. Cardiovasc. Haematol. Disord. 3,187-197[CrossRef][Medline]
- Warmke, J., Yamakawa, M., Molloy, J., Falkenthal, S., Maughan, D. (1992) Myosin light chain-2 mutation affects flight, wing beat frequency, and indirect flight muscle contraction kinetics in Drosophila. J. Cell Biol. 119,1523-1539[Abstract/Free Full Text]
- Moore, J. R., Dickinson, M. H., Vigoreaux, J. O., Maughan, D. W. (2000) The effect of removing the N-terminal extension of the Drosophila myosin regulatory light chain upon flight ability and the contractile dynamics of indirect flight muscle. Biophys. J. 78,1431-1440[Medline]
- Dickinson, M. H., Hyatt, C. J., Lehmann, F. O., Moore, J. R., Reedy, M. C., Simcox, A., Tohtong, R., Vigoreaux, J. O., Yamashita, H., Maughan, D. W. (1997) Phosphorylation-dependent power output of transgenic flies: an integrated study. Biophys. J. 73,3122-3134[Medline]
- Chen, J., Kubalak, S. W., Minamisawa, S., Price, R. L., Becker, K. D., Hickey, R., Ross, J., Jr, Chien, K. R. (1998) Selective requirement of myosin light chain 2v in embryonic heart function. J. Biol. Chem. 273,1252-1256[Abstract/Free Full Text]
- Crawford, K., Flick, R., Close, L., Shelly, D., Paul, R., Bove, K., Kumar, A., Lessard, J. (2002) Mice lacking skeletal muscle actin show reduced muscle strength and growth deficits and die during the neonatal period. Mol. Cell. Biol. 22,5887-5896[Abstract/Free Full Text]
- Zhi, G., Ryder, J. W., Huang, J., Ding, P., Chen, Y., Zhao, Y., Kamm, K. E., Stull, J. T. (2005) Myosin light chain kinase and myosin phosphorylation effect frequency-dependent potentiation of skeletal muscle contraction. Proc. Natl. Acad. Sci. U. S. A. 102,17519-17524[Abstract/Free Full Text]
- Rottbauer, W., Wessels, G., Dahme, T., Just, S., Trano, N., Hassel, D., Burns, C. G., Katus, H. A., Fishman, M. C. (2006) Cardiac myosin light chain-2. A novel essential component of thick-myofilament assembly and contractility of the heart. Circ. Res. 99,323-331[Abstract/Free Full Text]
- Wang, Y., Spatz, M. K., Kannan, K., Hayk, H., Avivi, A., Gorivodsky, M., Pines, M., Yayon, A., Lonai, P., Givol, D. (1999) A mouse model for achondroplasia produced by targeting fibroblast growth factor receptor 3. Proc. Natl. Acad. Sci. U. S. A. 96,4455-4460[Abstract/Free Full Text]
- Brooke, M., Kaiser, K. (1970) Muscle fiber types: how many and what kind?. Arch. Neurol. 23,369-379[Medline]
- Deng, C., Wynshaw-Boris, A., Zhou, F., Kuo, A., Leder, P. (1996) Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell 84,911-921[CrossRef][Medline]
- Jones, W. K., Grupp, I. L., Doetschman, T., Grupp, G., Osinska, H., Hewett, T. E., Boivin, G., Gulick, J., Ng, W. A., Robbins, J. (1996) Ablation of the murine alpha myosin heavy chain gene leads to dosage effects and functional deficits in the heart. J. Clin. Invest. 98,1906-1917[Medline]
- Minamisawa, S., Gu, Y., Ross, J., Jr, Chien, K. R., Chen, J. (1999) A post-transcriptional compensatory pathway in heterozygous ventricular myosin light chain 2-deficient mice results in lack of gene dosage effect during normal cardiac growth or hypertrophy. J. Biol. Chem. 274,10066-10070[Abstract/Free Full Text]
- Loughna, P., Izumo, S., Goldspink, G., Nadal-Ginard, B. (1990) Disuse and passive stretch cause rapid alterations in expression of developmental and adult contractile protein genes in skeletal muscle. Development 109,217-223[Abstract]
- Periasamy, M., Wieczorek, D. F., Nadal-Ginard, B. (1984) Characterization of a developmentally regulated perinatal myosin heavy- chain gene expressed in skeletal muscle. J. Biol. Chem. 259,13573-13578[Abstract/Free Full Text]
- Periasamy, M., Wydro, R. M., Strehler-Page, M. A., Strehler, E. E., Nadal-Ginard, B. (1985) Characterization of cDNA and genomic sequences corresponding to an embryonic myosin heavy chain. J. Biol. Chem. 260,15856-15862[Abstract/Free Full Text]
- Lee, K. J., Ross, R. S., Rockman, H. A., Harris, A. N., OBrien, T. X., van Bilsen, M., Shubeita, H. E., Kandolf, R., Brem, G., Price, J. (1992) Myosin light chain-2 luciferase transgenic mice reveal distinct regulatory programs for cardiac and skeletal muscle-specific expression of a single contractile protein gene. J. Biol. Chem. 267,15875-15885[Abstract/Free Full Text]
- Lowey, S., Waller, G. S., Trybus, K. M. (1993) Skeletal muscle myosin light chains are essential for physiological speeds of shortening. Nature 365,454-456[CrossRef][Medline]
- Szczesna, D., Zhao, J., Potter, J. D. (1996) Phosphorylation of the regulatory light chains of myosin modulates force development in skeletal muscle fibers. Biophys. J. 70,A380
- Buckingham, M. (2001) Skeletal muscle formation in vertebrates. Curr. Opin. Genet. Dev. 11,440-448[CrossRef][Medline]
- Faerman, A., Pearson-White, S., Emerson, C., Shani, M. (1993) Ectopic expression of MyoD1 in mice causes prenatal lethalities. Dev. Dyn. 196,165-173[Medline]
- Faerman, A., Shani, M. (1993) The expression of the regulatory myosin light chain 2 gene during mouse embryogenesis. Development 118,919-929[Abstract]
- De Freitas, F., Wang, Y., Wang, Y., Xu, Y. W., Kerrick, G. L., Potter, J. D., Szczesna-Cordary, D. (2006) Functional analysis of muscle from a heterozygous knock-in mouse expressing the D49A mutant of fast skeletal myosin regulatory light chain. Bioph. J. ,421A