FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.06-7503com.
(The FASEB Journal. 2007;21:2042-2049.)
© 2007 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-7503comv1
21/9/2042    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, Y.
Right arrow Articles by Cone, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, Y.
Right arrow Articles by Cone, R. D.

Creation of a genetic model of obesity in a teleost

Youngsup Song and Roger D. Cone1

Center for the Study of Weight Regulation and Associated Disorders, Oregon Health and Science University, Portland, Oregon, USA

1Correspondence: Center for the Study of Weight Regulation, And Associated Disorders, Oregon Health and Science University, 3181 SW Sam Jackson Park Rd., Portland, OR 97239-3098, USA. E-mail: cone{at}ohsu.edu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The adipostat is the mechanism by which the brain detects and maintains constant levels of energy stored in adipocytes in the form of lipids. Key elements of the adipostat include the adipocyte-derived hormone leptin that is expressed in proportion to energy levels and serves to communicate this information to the central nervous system and the central circuits, which sense and respond to leptin. Blockade of one of these circuits, the central melanocortin system, disrupts leptin action and causes a distinct obesity syndrome in mice and humans, characterized by increased adiposity as well as increased linear growth. We show here that transgenic zebrafish overexpressing the endogenous melanocortin antagonist agouti-related protein (AgRP) also exhibit obesity, increased linear growth, and adipocyte hypertrophy. These findings demonstrate that key elements of the adipostat originated before the evolution of mammals. Furthermore, transgenic overexpression of AgRP in zebrafish yields a new model system for the genetic analysis of energy homeostasis in a simple vertebrate system.—Song, Y., Cone, R. D. Creation of a genetic model of obesity in a teleost.


Key Words: melanocortin receptor • zebrafish • AgRP • energy homeostasis


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
ENERGY HOMEOSTASIS REQUIRES detection of energy stores present in adipose tissue, and concomitant regulation of feeding behavior and energy expenditure in order to keep those stores constant. Energy homeostasis is thus a complex physiological system, often involving multiple tissues and overlapping regulated pathways. Characterization of monogenic obesity mutants in the mouse and candidate gene approaches have led to identification of several dozen genes that play important roles in energy homeostasis. Given the complexity of the process, there are likely to be hundreds. The relatively recent discovery of the adipostatic hormone leptin (1) and the hunger factor, ghrelin (2 3 4) , for example, suggest we are still at an early stage of discovery in this field. Clearly, the development of simple vertebrate model systems for the analysis of energy homeostasis would be a highly valuable approach, since entire collections of genes physiologically involved in the process could be identified in an unbiased fashion, perhaps even identifying entirely new regulatory pathways.

Relative to mammals, less is known about energy homeostasis in the fish. Some species, such as Takifugu rubripes, store triglycerides in the liver (5 , 6) whereas others, such as salmonids, store triglycerides in visceral, intramuscular, and subcutaneous adipocyte depots. Even less is known about leptin in the fish. Intracerebroventricular administration of mammalian leptin in the goldfish inhibits food intake (7) . However, a putative leptin gene identified in teleosts, based on analysis of a syntenic region shared by mammals and the pufferfish (5) , shares only 21% amino acid identity with the mammalian protein and has not yet been functionally characterized.

Several of the neuropeptidergic circuits involved in feeding and metabolism in mammals appear to be conserved in teleosts. Proopiomelanocortin (POMC) has been cloned from several fish (8 9 10) , and POMC immunoreactivity was detected in pituitary and lateral tuberal nucleus (NLT) of the hypothalamus, believed to be a homologous structure to the mammalian arcuate nucleus (11) . Receptors for the melanocortin peptides cleaved from POMC have been cloned from fugu fish (MC1, 2, 4, and 5) and zebrafish (MC1–5R) (12 , 13) ; they also appear to be highly conserved. Recently goldfish melanocortin receptor 4 was cloned and the distribution in the brain was mapped by in situ hybridization (14) to the NLT, lateral septal nucleus, suprachiasmatic nucleus (SCN), and paraventricular nucleus. Intracerebroventricular administration of the synthetic melanocortin agonist, MTII, in the goldfish inhibited feeding (14) while the synthetic MC4-R antagonist HS024 stimulated food intake; these data strongly argue that the central melanocortin system regulates food intake in fish. The endogenous melanococortin antagonist, AgRP, has also been cloned from goldfish and demonstrated to be regulated by metabolic state in this species (15) . In the zebrafish, AgRP mRNA levels increase by 3-fold after a fast (16) . Reduction of MC4-R signaling, caused by mutations in either the POMC or MC4-R genes or by overexpression of MC4-R antagonists like agouti or AgRP, causes obesity in mammals, demonstrating a role for the circuit in regulating energy homeostasis (17 18 19) . To ascertain the role of the endogenous melanocortin system in energy homeostasis in teleosts and in an attempt to create a genetic model of obesity in this simple vertebrate system, we have developed transgenic zebrafish expressing the zebrafish AgRP gene under the control of a constitutive zebrafish promoter.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Fish strains and culture
Tab 14 strain zebrafish were raised and bred at 26–28°C under a 13.5 h light/10.5 h dark cycle. The embryos were obtained by natural mating and the larval stage was determined according to Kimmel et al. (20) . The fish were fed twice a day, at ~9:30 AM and 4:30 PM. Fish aged from 5 dpf to 10 dpf were fed rotifers and baby powder, fish from 10 dpf to 15 dpf were fed rotifer supplemented with uncapsulated brine shrimp, and fish from 15 dpf to 1 month or older were fed uncapsulated brine shrimp. For adult fish, food was prepared by mixing 4 parts of tropical flakes (Aquatic Eco-systems, Inc., Apopka, FL, USA) and 1 part of brine shrimp (Brine Shrimp Direct, Ogden, UT, USA) in system water. Feeding amount was determined based on previous observations of amounts fish can consume within 5 min after feeding. Fish food composition was fish flakes: protein 46%, fat 8%, crude fiber 4%, and moisture 10%, brine shrimp: protein 55%, fat 14%, ash 8.1%, and moisture 7%. Approximate adult food composition was protein 48%, fat 9%.

Generation of stable transfectants
Zebrafish melanocortin receptor 3 was kindly provided by Dr. Darren Logan (Edinburgh, Scotland) and subcloned into the pcDNA3.1+vector. Zebrafish melanocortin receptor 4 and 5b were independently cloned from a zebrafish cDNA library, then subcloned into pcDNA3.1+. Orientation and sequences of all constructs were verified by PCR and sequencing. HEK-293 cells were used to generate stable transfectants expressing zebrafish melanocortin receptors. Transfection was performed according to the manufacturer’s instruction. In brief, the day before transfection, HEK-293 cells were plated at ~80–100% confluency in 100 mm dishes without an antibiotic. About 20 µg of DNA was used for transfection with 40 µl of either lipofectamine or lipofectamine2000 (Invitrogen, Carlsbad, CA, USA) in Optimem medium (Invitrogen). Five hours after transfection, 20% FBS/DMEM medium was supplied; 24 h after transfection, transfectants were split into two or three 100 mm dishes in 10% FBS/DMEM and incubated for another 24 h. Medium was replaced with 1000 µg/ml concentration of G418 medium. Fresh G418 medium was supplied every 3 or 4 days. Two to 3 wk later, when enough colonies had been grown, whole populations of individual transfectants were split, pooled, and selected by G418 medium again until no dead cells were observed in drug selection.

cAMP assay
Zebrafish melanocortin receptor activity was measured using a cAMP EIA assay kit (Cayman Chemical, Ann Arbor, MI, USA). Stable transfectants expressing zebrafish melanocortin receptors or control HEK-293 cells were plated in 96-well plate with 5 x 104 cells per well. Twenty-four hours after plating, cells were incubated with serially diluted concentrations of {alpha}-MSH in the presence or absence of mouse AgRP (82–131) (Phoenix Peptides, Burlingame, CA, USA) in a 50 µl volume of 0.1 mM IBMX, 0.01% BSA in DMEM at 37°C for 30 min. After a wash with PBS, cells were lysed in 40 µl of 0.1M HCl for 20 min at room temperature. Collected cell lysates were used for the assay according to the manufacturer’s instruction. Color development was measured at 405 nm with a Benchmark Plus plate spectrophotometer (Bio-Rad, Hercules, CA, USA). Each condition was examined in triplicate.

Construction of transgenic zebrafish
ß-Actin-EGFP constructs (21) were digested with BamHI and full-length zebrafish AGRP containing 5' UTR, coding sequence, stop codon and 3' UTR sequence was inserted between the zebrafish ß-actin promoter and a nonfunctional EGFP sequence. To remove any RNA contamination, plasmid DNA constructs was gel purified and resuspended in ddH2O at 100 ng/µl concentration. Injection needles were prepared by two-step pulling of the glass micropipette (Cat.# BF100–58-10, Sutter Instrument Co., Movato, CA, USA), first at 66°C and ~10 s later at 82°C, using a vertical pipette puller (Model PP83, Narishige, Japan). A micropipette beveler (Model# BV-10, Sutter Instrument Co.) was used to bevel the glass micropipette so that the tip of the micropipette was at 30°, with a smooth surface. About 2–3 µl of DNA was loaded into the micropipette using a microloader (Cat.# 5242 956.003, Eppendorf) and air pressure was adjusted using the microscope micrometer; ~1 nl of DNA was injected in each embryo.

The night before the day of injection, female and male fish were separated. On the day of injection, when the light was on, natural mating was performed by placing male and female fish together. Embryos were embedded in wedged-shaped troughs made with 1.5% agarose, as described in the zebrafish book (22) . DNA was injected into the middle of the cell (not into the yolk cell) of one or two cell-stage embryos using the MPPI-2 pressure injector and dissecting microscope (Model# SMZ645, Nikon). Injected embryos were transferred to 100 ml of fresh system water or 0.4 x Danieau solution. Unfertilized embryos were sorted out within 6 h after injection and fertilized embryos were raised until adult stages. To identify F0 founders capable of germline transmission, natural crosses were set between injected fish and wild-type fish. About 20–50 F1 embryos from mating were collected randomly at 72 hpf and subjected to genomic DNA PCR. Germline transmission rate varied between 4% and 30%, depending on the F0 founder. Male or female fish that showed positive results from genomic DNA PCR were saved and crossed with a couple of wild-type Tab 14 female or male fish, respectively. Collected embryos were raised until adult stage and tail fin genotyping PCR was performed to screen the heterozygote F1 carriers. Of ~300 F0 fish injected and raised to the adult stage, we found ~eight transgenic fish capable of germline transmission; all experiments in this paper used fish from the F2 or F3 generations from three independent founder lines.

Genotyping fish
Either embryos or fin clipped tissues were incubated in genomic DNA lysis buffer (10 mM Tris-HCl, ph8.0, 2 mM EDTA, 0.2% Tween20) at 50°C from 6 h to overnight. The material was heat inactivated at 95°C for 10 min, centrifuged at 14000 rpm for 2 min, and 5 µl of supernatant part was used directly for genotyping PCR. Two sets of genotyping PCR were performed with forward primers specific to the C-terminal region of ß-actin promoter (CAAAACAGGAAGTTGACTCC) and with two individual N-terminal region-specific AgRP reverse primers (AGATTACTGTGTTCAGCATCAT and CTGAGTTTATTTCAAGGTGCTCC). Each individual PCR gives 150 bp and 250 bp PCR products, respectively.

In situ hybridization of AgRP transgenic embryos
AgRP transgenic F1 founders were naturally mated with WT Table 14 strain, then F2 embryos were collected at 5dpf, fixed, and whole-mount in situ hybridized with dig-zAgRP cRNA probes. Expression of zAgRP was visualized by incubation with sheep alkaline phosphatase-conjugated anti-dig antibody (Roche, Nutley, NJ, USA), followed by NBT/BCIP (Roche) staining as described previously (16) .

Weight growth curves
Some F1 heterozygotes that carry the ß-actin-AgRP transgene were mated with wild-type Table 14 fish; all fertilized F2 embryos were raised in a half-gallon tank for a month or two. At 1 or 2 months of age, equal numbers of fish were separated into individual half-gallon tanks. Fish were randomly housed so each tank had both wild-type and transgenic fish. For founder #127, four tanks of 12 fish per each half-gallon tank were raised; for founder #221, two tanks of 9 fish per each half-gallon tank were raised. When 4 or 5 months old, fish were tail clipped for genotyping, weighed, and returned to the original tank. The clipped fin tail was subjected to genomic DNA PCR. Weight was measured to two decimal points in grams and statistical analyses were done by unpaired t test.

Total triglyceride quantification
Whole F2 or F3 fish were homogenized with mortar and pestle and extracted with 10 ml chloroform:methanol (2:1) and filtered into a 25 ml centrifuge tube. Two more extractions were performed, each with 5 ml chloroform:methanol (2:1). Two milliliters of 0.58% NaCl was added and vortexed for 30 s and incubated overnight at 4°C. The fat extract was centrifuged for 10 min at 2000 rpm, and bottom layer was transferred into new tube. One milliliter of lipid extract was dried under nitrogen and redissolved in 0.5 ml of isopropyl alcohol. Triglyceride content was measured according to the BMC triglyceride/GPO reagent (Roche Diagnostics) and read using a Hitachi 704 chemistry analyzer. Statistical analyses were done by unpaired t test

Analysis of zebrafish adipocytes
Female transgenic F3 AgRP fish (from founders 284 and 221) and female wild-type tank mates were sacrificed at 9 months and fixed in 10% formalin solution (Sigma, St. Louis, MO, USA). Whole fish were paraffin embedded, then 5 µm sections were prepared and stained with hematoxylin and eosin. All images were taken and stored digitally by Openlab or Image-pro plus software. The total number of visceral adipocytes, along with visceral adipocyte size, was determined using the NIH Image J program. Briefly, the density of cells in each section was measured by generating a random grid of lines [for first set 2000 pixel2 (2170 µm2) and the second set 5000 pixel2 (2551 µm2)] and counting the visceral adipocyte cell number using stereology counting rules (23) . Adipocyte cell density in each section was calculated as total number of cells divided by the area counted. Adipocyte cell size in each section was calculated as area [2000 pixel2 (2170 µm2) or 5000 pixel2 (2551 µm2)] divided by cell density. To determine adipocyte cell number, the area occupied by adipocytes was estimated by overlaying a random grid of points over the image and counting the number of points that fall over adipocytes. Adipocyte cell number was then calculated by multiplying the area occupied by the random grid of points by cell density of each section analyzed (23) . For both analyses, sections were randomly chosen every 300–900 µm. Statistical analyses were done by unpaired t test.

Determining fish length
Wild-type and transgenic F2 fish were sacrificed and fish length was measured from tip to the end of the tail, then weighed and genotyped as described. Statistical analyses were done by unpaired t test.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Characterization of the response of the zebrafish melanocortin receptors to AgRP
The AgRP and melanocortin receptor genes are highly conserved in zebrafish (13 , 16) , but the ability of AgRP to act as a functional melanocortin antagonist has not been demonstrated. Thus, we subcloned zebrafish MC3-R, MC4-R, and MC5b-R cDNA sequences into expression vectors, and used these to create cells stably expressing these receptors (Fig. 1 ). Control nontransfected 293 cells did not respond to {alpha}-MSH (data not shown). However, {alpha}-MSH activated adenylyl cyclase in each transfected cell population with an EC50 of ~2 x 10–10 (MC3-R), 5 x 10–10 (MC4-R), and 2 x 10–9 (MC5b-R). The mouse AgRP (82–131) protein acted as a competitive antagonist at each of these central zebrafish melanocortin receptors, with an apparent rank order of antagonist potency of MC4-R>MC3-R> MC5b-R (Fig. 1) .


Figure 1
View larger version (15K):
[in this window]
[in a new window]

 
Figure 1. Inhibition of zebrafish melanocortin receptors by mouse AgRP (83–131) peptide. The panels show dose-response curves of A) zebrafish melanocortin receptor 3, B) zebrafish melanocortin receptor 4, and C) zebrafish melanocortin receptor 5b for {alpha}-MSH in the presence of 10–7 M (square), 10–8 M (triangle) or absence (diamond) of mAgRP (82–131) peptide. {alpha}-MSH stimulated activity of zebrafish melanocortin receptors was monitored by cAMP production. cAMP content was shown as a percent of maximum spectrophotometer reading. Experiments were performed in triplicate, and graphs were drawn and analyzed by Prism.

Creation of transgenic zebrafish with constitutive ectopic expression of AgRP mRNA
Transgenic zebrafish were created by injecting embryos with plasmids containing a zebrafish AgRP cDNA transgene under the control of the zebrafish ß-actin promoter (Fig. 2 A). Transgene-positive male and female fish were separated and crossed with wild-type female or male fish, respectively. Embryos from the matings were raised to adult stage and tail fin genotyping was performed to screen the heterozygote carriers. Whole-mount in situ hybridization demonstrated extensive expression of AgRP mRNA in transgenic, but not control, fish at 5dpf (Fig. 2B ).


Figure 2
View larger version (70K):
[in this window]
[in a new window]

 
Figure 2. Creation of a transgenic zebrafish overexpressing zAgRP. A) Schematic diagram and partial restriction map of ß-actin-zAgRP transgene construct. Full-length cDNA sequence of zAGRP containing 5' UTR, coding region, and 3'UTR was inserted between ß-actin promoter and a spacer sequence containing an unexpressed EGFP gene. B) Expression pattern of ß-actin-derived zebrafish AgRP by whole-mount in situ hybridization. F1 transgenic heterozygote carriers were mated with weight strain and all embryos were whole-mount in situ hybridized with zAgRP cRNA probes. Upper panel shows weight type and bottom panel shows transgenic embryos. The ratio of weight and transgenic was approximately a Mendelian inheritance pattern. Scale bar = 100 µm.

Growth of transgenic zebrafish with constitutive ectopic expression of AgRP
Growth rates were determined using male or female offspring from three different transgenic founders. Clutches, derived from mating heterozygous transgenic founders with wild-type fish, were cultured together in tanks at a same density of 9–12 fish per tank. Fish were weighed, as described in Materials and Methods, at multiple times from 4 to 12 months, and genotyped immediately after each weighing by polymerase chain reaction using tail fin tissue. Weights were averaged among all the transgenic or wild-type fish in the clutch. Transgenic fish from all three founders were significantly heavier than their wild-type tank mates by 4–6 months postfertilization. The increased rate of weight gain appeared greatest in the period from 4 to 6 months postfertilization (Fig. 3 A, B), then diminished to wild-type levels in the male offspring of founder 127 (Fig. 3A ). At 6 months postfertilization, the transgenic fish were 20–100% heavier than their wild-type tank mates, depending on the founder and/or sex of the offspring. Male offspring of founder 127 showed the smallest increase in weight of ~20% (Fig. 3A ), while female offspring of either founder 221 (Fig. 3B ) or founder 284 (not shown) were approximately twice as heavy as their wild-type female tank mates.


Figure 3
View larger version (9K):
[in this window]
[in a new window]

 
Figure 3. Overexpression of zAgRP causes an increased rate of weight gain in the zebrafish. Weight growth curves of A) male, founder AgRP-127 (WT n=22, TG (+/–) n=11), and B) female, founder AGRP-221 (WT n=5, TG (+/–) n=8. Heterozygote transgenic carriers (+/–) were mated with weight strain (–/–), and the progeny were raised in one tank together. One to 2 months later, equal numbers of fish were randomly distributed to multiple half-gallon aquariums. Beginning at 4 to 5 months of age, fish were tail clipped, body weights were measured, and fish were returned to their original tank. The procedure was repeated monthly thereafter. Results are expressed as mean ± SEM, and statistical analyses were done by unpaired t test. *P < 0.05; **P < 0.01; ***P < 0.001.

Transgenic zebrafish with constitutive ectopic expression of AgRP become obese
In both mice and humans, defective melanocortin signaling leads to an increase in adipose mass. To determine whether constitutive AgRP expression leads to obesity in the zebrafish, we cultured clutches of mixed transgenic and wild-type fish as described above, then determined total triglyceride content using the method of Wahlefeld (24) after homogenization and extraction of lipids from whole fish with chloroform/methanol. In both 1-year-old male fish (strain 127, Fig. 4 A, B), and 6-month-old female fish (strain 221, Fig. 4C, D ), total triglycerides were increased 42% and 141%, respectively, compared to wild-type clutch mates.


Figure 4
View larger version (7K):
[in this window]
[in a new window]

 
Figure 4. Overexpression of zAgRP causes obesity in the zebrafish. Total triglyceride content of A) 1-year-old males, founder AgRP-127 (WT n=22, TG (+/–) n=11), and C) 6-month-old females, founder AgRP-221 (WT n=5, TG (+/–) n=8). Corresponding percent triglycerides content per body weight of B) males, founder AgRP-127, and D) females, founder AgRP-221. Total fat was extracted from individual whole fish using a chloroform/methanol method and the amount of total triglyceride was determined using the Wahlefeld method. Results are expressed as mean ± SEM, and statistical analyses were done by unpaired t test. *P < 0.05; **P < 0.01.

Adipocyte hypertrophy in transgenic zebrafish with constitutive ectopic expression of AgRP
The distribution of lipids and adipocytes in the zebrafish has not been previously described in the literature. To determine whether obesity in the zebrafish produces an increase in lipid storage in visceral adipocytes, and thus adipocyte hypertrophy, we examined the distribution, size, and number of adipocytes in two randomly selected wild-type and AgRP transgenic fish 9 months of age. The transgenic fish were derived, one each, from strain 284 and 221; as with fish derived from founder 127 and 221, fish derived from founder 284 showed increased weight, length, and total triglyceride content (data not shown). Paraffin-embedded sections were prepared for histological analysis, extending from just behind the operculum to the urogenital opening. Similar to salmonids, zebrafish were found to store triglycerides in visceral, intramuscular, and subcutaneous adipocyte depots (Fig. 5 A–C, representative images from a wild-type fish) but not in liver (Fig. 5D ). A quantitative analysis of visceral adipocytes across the entire region examined showed that the AgRP transgenic fish derived from either strain 284 or 221 had significantly larger visceral adipocytes than the wild-type tank mate (Fig. 5E ). A significant increase in the number of visceral adipocytes was detected in strain 221 but not strain 284 (Fig. 5F ).


Figure 5
View larger version (84K):
[in this window]
[in a new window]

 
Figure 5. Overexpression of zAgRP causes visceral adipocyte hypertrophy in representative transgenic and wild-type zebrafish tank mates. Zebrafish adipocytes are found in A) visceral, B) intermuscle, and C) subcutaneous depots, but not in D) liver of wild-type zebrafish. Overexpression of zAgRP caused a significant increase of visceral adipocyte cell size in strains 284 and 221 (E, left and right pair of bars, respectively), and increased visceral adipocyte cell number in strain 221 but not strain 284 (F, right and left pair of bars, respectively). A) Bar = 50 µm. Results are expressed as mean ± SEM, and statistical analyses were done by unpaired t test. **P < 0.01.

Increased linear growth in transgenic zebrafish with constitutive ectopic expression of AgRP
The increase in triglycerides shown in Fig. 4 cannot account for the entirety of the weight gain in the AgRP transgenic fish. In mice and humans, defective MC4-R signaling also causes a significant increase in lean mass and linear growth (17) . We examined linear growth in clutches of transgenic and wild-type fish, cultured as described above for measurement of triglyceride mass, by carefully measuring fish from the tip to the end of the tail fin. Genotyping was once again performed after measurements were taken. An increase in linear growth, measured to the nearest mM, was observed from ~5% in 1-year-old males from founder 127 (3.8cM vs. 4.0cM, Fig. 6 A) to almost 14% in 6-month-old females from founder 221 (3.6 cM vs. 4.1 cM, Fig. 6B ).


Figure 6
View larger version (7K):
[in this window]
[in a new window]

 
Figure 6. Overexpression of AgRP causes increased linear growth in the zebrafish. Length of A) 1-year-old males, founder AgRP-127 (WT n=22, TG (+/–) n=11), and B) 6-month-old females, founder AgRP-221 (WT n=5, TG (+/–) n=8). Length of zebrafish was measured from tip to end of tail. Results are expressed as mean ± SEM, and statistical analyses were done by unpaired t test. *P < 0.05; **P < 0.01; ***P < 0.001.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Data suggest that the central melanocortin system acts like a rheostat on energy storage, and genetic models in the mouse demonstrate that a multitude of different lesions in the system, including deletion of either MC4-R (17) or MC3-R (25) , deletion of the POMC gene (26) , the source of melanocortin agonist, or overexpression of either agouti or AgRP (27 , 28) , endogenous antagonists of both central melanocortin receptors, leads to obesity. Evidence that the melanocortin obesity syndrome can occur in humans was first demonstrated by the discovery of null mutations in the proopiomelanocortin (POMC) gene (29) . These data demonstrated for the first time that the central melanocortin circuitry regulates energy homeostasis in humans much as it does in the mouse. Shortly thereafter, two laboratories published the first reports of heterozygous mutations in MC4R (both frameshifts) associated with nonsyndromic obesity in two separate families (18 , 19) . Additional reports (30 31 32) show that haploinsufficiency of the MC4-R in humans is the most common monogenic cause of severe obesity at the present time, accounting for up to 5% of cases. Remarkably, the syndrome is virtually identical to that reported for the mouse (17 , 33 , 34) , with increased adipose mass, increased linear growth and lean mass, hyperinsulinemia greater than that seen in matched obese controls, and severe hyperphagia.

While the data above suggest that this central circuit is highly functionally conserved from mice to humans, previous data have demonstrated acute effects of melanocortin agonists and antagonists on feeding behavior in the fish, but have not proved functional conservation of this component of the adipostat in regulating energy homeostasis in nonmammalian vertebrates. We showed previously that POMC and AgRP circuits are neuroanatomically conserved in the zebrafish and that AgRP mRNA is significantly up-regulated by fasting (16) . We demonstrate here that the mouse AgRP protein is a competitive antagonist of the central zebrafish MC3-R, MC4-R, and MC5b-R. Furthermore, as is the case in mammals, prolonged blockade of melanocortin signaling in the fish causes an obesity syndrome characterized by an early onset of increased weight gain, increased total triglycerides, and increased linear growth. We presume, as is the case in mammals, that blockade of melanocortin signaling in the central nervous system (CNS) is the most salient feature of the transgenic obesity model characterized here, although tissue-specific overexpression of AgRP in the CNS of the zebrafish would be necessary to formally prove this point. These data demonstrate that several functional roles of the central melanocortin system are conserved in teleosts and thus are probably important to energy homeostasis throughout all vertebrates. Our preliminary analysis of adipocyte size and distribution in two representative weight and transgenic fish suggests that lipid storage in visceral adipocytes, a hallmark of mammalian obesity, may also be seen in this teleost obesity model. Additional work is needed to validate this finding in both sexes and across different founder strains. It will also be of interest to quantitate adipocyte size and number in the subcutaneous and muscle depots as well.

We also note some possible sexual dimorphism in the effects of central melanocortin blockade in the fish. This has also been noted in the mouse (17) , but appears to be more exaggerated in the zebrafish. However, additional work is required to determine whether the differences in weight gain in the offspring of the three founders characterized here are truly due to sexually dimorphic effects of AgRP. They may also be due to integration site effects on the transgene or to the inherent variability in founders resulting from the fact that the laboratory strains of zebrafish are not inbred.

Finally, a demonstration that AgRP is regulated by metabolic state in the zebrafish (16) and that prolonged overexpression increases energy storage and lean mass argues that mechanisms by which energy availability is signaled to the CNS are highly conserved across vertebrates. While a leptin-like molecule has only recently been identified in fish (5) , we suggest that this molecule is likely to access the teleost CNS and signal energy state in part by controlling AgRP levels, as in mammals (35) . In light of the likely conservation of adipostatic function in the zebrafish, the development of a melanocortin obesity model in the zebrafish provides a valuable tool for suppressor analysis to identify genes downstream of AgRP required for function of the adipostat.


   ACKNOWLEDGMENTS
 
This work was supported by a Freedom to Discover Grant from the Bristol-Myers Squibb Foundation and by NIH R56DK075721 (R.D.C.). The authors would like to thank Dr. Wenbiao Chen (Vollum Institute) for advice, Dr. Anda Cornea for the advice about adipocyte cell sizing, and Rob Duncan for technical assistance.

Received for publication October 6, 2006. Accepted for publication January 25, 2007.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Zhang, Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., Friedman, J. M. (1994) Positional cloning of the mouse obese gene and its human homologue. Nature 372,425-432[CrossRef][Medline]
  2. Kojima, M., Hosoda, H., Date, Y., Nakazato, M., Matsuo, H., Kangawa, K. (1999) Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 402,656-660[CrossRef][Medline]
  3. Wren, A. M., Small, C. J., Ward, H. L., Murphy, K. G., Dakin, C. L., Taheri, S., Kennedy, A. R., Roberts, G. H., Morgan, D. G., Ghatei, M. A., Bloom, S. R. (2000) The novel hypothalamic peptide ghrelin stimulates food intake and growth hormone secretion. Endocrinology 141,4325-4328[Abstract/Free Full Text]
  4. Tschop, M., Smiley, D. L., Heiman, M. L. (2000) Ghrelin induces adiposity in rodents. Nature 407,908-913[CrossRef][Medline]
  5. Kurokawa, T., Uji, S., Suzuki, T. (2005) Identification of cDNA coding for a homologue to mammalian leptin from pufferfish, Takifugu rubripes. Peptides 26,745-750[CrossRef][Medline]
  6. Akiyoshi, H., Inoue, A. (2004) Comparative histological study of teleost livers in relation to phylogeny. Zool. Sci. 21,841-850[CrossRef][Medline]
  7. Volfoff, H., Eykelbosh, A. J., Peter, R. E. (2003) Role of leptin in the control of feeding of goldfish Carassius auratus: interactions with cholecystokinin, neuropeptide Y and orexin A, and modulation by fasting. Brain Res. 972,90-109[CrossRef][Medline]
  8. Takahashi, A., Amemiya, Y., Sarashi, M., Sower, S. A., Kawauchi, H. (1995) Melanotropin and corticotropin are encoded on two distinct genes in the lamprey, the earliest evolved extant vertebrate. Biochem. Biophys. Res. Commun. 213,490-498[CrossRef][Medline]
  9. Dores, R. M. (1990) The proopiomelanocortin family. Prog. Clin. Biol. Res. 342,22-27[Medline]
  10. Hansen, I. A., To, T. T., Wortmann, S., Burmester, T., Winkler, C., Meyer, S. R., Neuner, C., Fassnacht, M., Allolio, B. (2003) The pro-opiomelanocortin gene of the zebrafish (Danio rerio). Biochem. Biophys. Res. Commun. 303,1121-1128[CrossRef][Medline]
  11. Chiba, A. (2001) Marked distributional difference of alpha-melanocyte-stimulating hormone (alpha-MSH) -like immunoreactivity in the brain between two elasmobranchs (Scyliorhinus torazame and Etmopterus brachyurus): an immunohistochemical study. Gen. Comp. Endocrinol. 122,287-295[CrossRef][Medline]
  12. Logan, D. W., Bryson-Richardson, R. J., Pagan, K. E., Taylor, M. S., Currie, P. D., Jackson, I. J. (2003) The structure and evolution of the melanocortin and MCH receptors in fish and mammals. Genomics 81,184-191[CrossRef][Medline]
  13. Ringholm, A., Fredriksson, R., Poliakova, N., Yan, Y. L., Postlethwait, J. H., Larhammar, D., Schioth, H. B. (2002) One melanocortin 4 and two melanocortin 5 receptors from zebrafish show remarkable conservation in structure and pharmacology. J. Neurochem. 82,6-18[CrossRef][Medline]
  14. Cerda-Reverter, J. M., Ringholm, A., Schioth, H. B., Peter, R. E. (2003) Molecular cloning, pharmacological characterization, and brain mapping of the melanocortin 4 receptor in the goldfish: involvement in the control of food intake. Endocrinology 144,2336-2349[Abstract/Free Full Text]
  15. Cerda-Reverter, J. M., Peter, R. E. (2003) Endogenous melanocortin antagonist in fish: structure, brain mapping, and regulation by fasting of the goldfish agouti-related protein gene. Endocrinology 144,4552-4561[Abstract/Free Full Text]
  16. Song, Y., Golling, G., Thacker, T. L., Cone, R. D. (2003) Agouti-related protein (AGRP) is conserved and regulated by metabolic state in the zebrafish, Danio rerio. Endocrine 22,257-265[CrossRef][Medline]
  17. Huszar, D., Lynch, C. A., Fairchild-Huntress, V., Dunmore, J. H., Fang, Q., Berkemeier, L. R., Gu, W., Kesterson, R. A., Boston, B. A., Cone, R. D., et al (1997) Targeted disruption of the melanocortin-4 receptor results in obesity in mice. Cell 88,131-141[CrossRef][Medline]
  18. Yeo, G. S. H., Farooqi, I. S., Aminian, S., Halsall, D. J., Stanhope, R. G., O’Rahilly, S. (1998) A frameshift mutation in MC4R associated with dominantly inherited human obesity. Nat. Genet. 20,111-112[CrossRef][Medline]
  19. Vaisse, C., Clement, K., Guy-Grand, B., Froguel, P. (1998) A frameshift mutation in human MC4R is associated with a dominant form of obesity. Nat. Genet. 20,113-114[CrossRef][Medline]
  20. Kimmel, C. B., Ballard, W. W., Kimmel, S. R., Ullmann, B., Schilling, T. F. (1995) Stages of embryonic development of the zebrafish. Dev. Dyn. 203,253-310[Medline]
  21. Higashijima, S., Okamoto, H., Ueno, N., Hotta, Y., Eguchi, G. (1997) High-frequency generation of transgenic zebrafish which reliably express GFP in whole muscles or the whole body by using promoters of zebrafish origin. Dev. Biol. 192,289-299[CrossRef][Medline]
  22. Westerfield, M. (2000) The Zebrafish Book. A Guide for the Laboratory Use of Zebrafish (Danio rerio) 4th Ed University of Oregon Press Eugene.
  23. Howard, V., Reed, M. G. (2005) Unbiased Stereology: Three-Dimensional Measurement in Microscopy BIOS Scientific Publisher Abingdon.
  24. Nagele, U., Hagele, E. O., Sauer, G., Wiedemann, E., Lehmann, P., Wahlefeld, A. W., Gruber, W. (1984) Reagent for the enzymatic detection of serum total triglycerides with improved lipolytic efficiency. J. Clin. Chem. Clin. Biochem. 22,165-174[Medline]
  25. Butler, A. A., Kesterson, R. A., Khong, K., Cullen, M. J., Pelleymounter, M. A., Dekoning, J., Baetscher, M., Cone, R. D. (2000) A unique metabolic syndrome causes obesity in the melanocortin-3 receptor-deficient mouse. Endocrinology 141,3518-3521[Abstract/Free Full Text]
  26. Yaswen, L., Diehl, N., Brennan, M. B., Hochgeschwender, U. (1999) Obesity in the mouse model of pro-opiomelanocortin deficiency responds to peripheral melanocortin. Nat. Med. 5,1066-1017[CrossRef][Medline]
  27. Ollmann, M. M., Wilson, B. D., Yang, Y.-K., Kerns, J. A., Chen, Y., Gantz, I., Barsh, G. S. (1997) Antagonism of central melanocortin receptors in vitro and in vivo by agouti-related protein. Science 278,135-137[Abstract/Free Full Text]
  28. Graham, M., Shuttre, J. R., Sarmiento, U., Sarosi, I., Stark, K. L. (1997) Overexpression of Agrt leads to obesity in transgenic mice. Nat. Genet. 17,273-274[CrossRef][Medline]
  29. Krude, H., Biebermann, H., Luck, W., Horn, R., Brabant, G., Gruters, A. (1998) Severe early-onset obesity, adrenal insufficiency and red hair pigmentation caused by POMC mutations in humans. Nat. Genet. 19,155-157[CrossRef][Medline]
  30. Hinney, A., Schmidt, A., Nottebom, K., Heibult, O., Becker, I., Ziegler, A., Gerber, G., Sina, M., Gorg, T., Mayer, H., et al (1999) Several mutations in the melanocortin-4 receptor gene including a nonsense and a frameshift mutation associated with dominantly inherited obesity in humans. J. Clin. Endocrinol. Metab. 84,1483-1486[Abstract/Free Full Text]
  31. Farooqi, I. S., Yeo, G. S., Keogh, J. M., Aminian, S., Jebb, S. A., Butler, G., Cheetham, T., O’Rahilly, S. (2000) Dominant and recessive inheritance of morbid obesity associated with melanocortin 4 receptor deficiency. J. Clin. Invest. 106,271-279[Medline]
  32. Vaisse, C., Clement, K., Durand, E., Hercberg, S., Guy-Grand, B., Froguel, P. (2000) Melanocortin-4 receptor mutations are a frequent and heterogenous cause of morbid obesity. J. Clin. Invest. 106,253-262[Medline]
  33. Butler, A. A., Marks, D. L., Fan, W., Kuhn, C. M., Bartolome, M., Cone, R. D. (2001) Melanocortin-4 receptor is required for acute homeostatic responses to increased dietary fat. Nat. Neurosci. 4,605-611[CrossRef][Medline]
  34. Fan, W., Dinulescu, D. M., Butler, A. A., Zhou, J., Marks, D. L., Cone, R. D. (2000) The central melanocortin system can directly regulate serum insulin levels. Endocrinology 141,3072-3079[Abstract/Free Full Text]
  35. Mizuno, T. M., Mobbs, C. V. (1999) Hypothalamic agouti-related protein messenger ribonucleic acid is inhibited by leptin and stimulated by fasting. Endocrinology 140,814-817[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
E. Sanchez, V. C. Rubio, D. Thompson, J. Metz, G. Flik, G. L. Millhauser, and J. M. Cerda-Reverter
Phosphodiesterase inhibitor-dependent inverse agonism of agouti-related protein on melanocortin 4 receptor in sea bass (Dicentrarchus labrax)
Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2009; 296(5): R1293 - R1306.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-7503comv1
21/9/2042    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Song, Y.
Right arrow Articles by Cone, R. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Song, Y.
Right arrow Articles by Cone, R. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS