|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,1
,1

,




,

,
,
,2
* INSERM, U841, IMRB, Créteil, France;
Université Paris 12, Faculté de Médecine, Créteil, France;
AP-HP, Groupe hospitalier Henri Mondor-Albert Chenevier, Service dHépatologie et de Gastroentérologie, Créteil, France;
AP-HP, Groupe hospitalier Henri Mondor-Albert Chenevier, Département de Pathologie, Créteil, France;
|| Department of Pharmacokinetics and Drug Delivery, University of Groningen, Groningen, Netherlands;
¶ Department of Molecular Biology, Helen L. Dorris Child and Adolescent Neuropsychiatric Disorder Institute, The Scripps Research Institute, La Jolla, California, USA;

INSERM, IFR31, U858, Toulouse, France; and

Université Toulouse III Paul Sabatier, IFR31, Toulouse, France
2Correspondence: INSERM U841, Institut Mondor de Recherche Biomédicale, Hôpital Henri Mondor, 94010 Créteil, France. E-mail: sophie.lotersztajn{at}creteil.inserm.fr
| ABSTRACT |
|---|
|
|
|---|
-actin mRNA and lower induction of TIMP-1, TGF-ß1, and PDGF-BB mRNAs, overall reflecting reduced activation of remodeling in response to liver injury. The wound healing response was similar in S1P3/ and WT mice. In vitro, S1P enhanced proliferation of cultured WT hMF, and PDGF-BB further enhanced the mitogenic effect of S1P. In keeping with these findings, PDGF-BB up-regulated S1P2 and SphK1 mRNAs, increased SphK activity, and S1P2 induced PDGF-BB mRNA. These effects were blunted in S1P2/ cells, and S1P2/ hMF exhibited reduced mitogenic and comitogenic responses to S1P. These results unravel a novel major role of S1P2 in the wound healing response to acute liver injury by a mechanism involving enhanced proliferation of hMF.Serriere-Lanneau, V., Teixeira-Clerc, F., Li, L., Schippers, M., de Wries, W., Julien, B., Tran-Van-Nhieu, J., Manin, S., Poelstra, K., Chun, J., Carpentier, S., Levade, T., Mallat, A., Lotersztajn, S. The sphingosine 1-phosphate receptor S1P2 triggers hepatic wound healing.
Key Words: liver hepatic myofibroblasts
| INTRODUCTION |
|---|
|
|
|---|
Only a few recent studies investigated the function of S1P in liver pathophysiology (15
16
17
18
19
20)
. Thus, it has been shown that S1P inhibits proliferation of cultured hepatocytes via S1P2 (18)
. We recently identified S1P receptors (S1P1, S1P2, and S1P3) in cultured human hepatic myofibroblasts, a population of fibrogenic cells that plays a key role in the wound healing response associated with liver injury (15)
. We also demonstrated that activation of S1P receptors triggers survival of hepatic myofibroblasts (16)
. These results therefore suggested that specific S1P receptors might participate in the wound healing response to liver injury. We explored this hypothesis by using S1P2- and S1P3-deficient mice that were subjected to acute carbon tetrachloride (CCl4) intoxication, an established model of liver injury characterized by acute hepatitis, followed by a wound healing response that associates hepatocyte proliferation and a matrix remodeling process driven by hepatic myofibroblasts.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Animals and experimental design
Mice invalidated for S1P2 or S1P3 receptors (S1P2/ or S1P3/) were generated as described previously (21
, 22)
. S1P2/ or S1P3/ and their wild-type (WT) littermates were generated from heterozygous mice bred for seven generations on a C57Bl/6J background. Animals were housed in temperature- and humidity-controlled rooms, kept on a 12 h light/dark cycle, and provided unrestricted amounts of food and water. Male and female mice aged 812 wk were used. Animal procedures were conducted in accordance with French government policies (Services Vétérinaires de la Santé et de la Production Animale, Ministère de lAgriculture).
Acute liver injury was induced by an intraperitoneal injection of CCl4 [Sigma, St. Louis, MO, USA; 0.5 ml/kg body weight, 1:5 dilution in mineral oil (MO)], as described previously (23)
. Animals were sacrificed 24, 48, or 72 h after treatment. WT (n=22) and S1P2/ (n=14) animals were divided into the following groups: WT/sham (MO, n=5); WT/CCl4 sacrificed either 24 h (n=3), 48 h (n=6), or 72 h (n=8) after CCl4 injection; S1P2//sham (MO, n=3); S1P2//CCl4 sacrificed either 24 h (n=3), 48 h (n=3), or 72 h (n=5) after injection of CCl4. WT (n=17) and S1P3/ (n=11) animals were divided into the following groups: WT/sham (MO, n=4); WT/CCl4 sacrificed 24 h (n=5) or 72 h (n=8) after CCl4 injection; S1P3//sham (MO, n=2); S1P3//CCl4 sacrificed 24 h (n=4) or 72 h (n=5) after CCl4 injection. No mortality was observed throughout treatment. Liver samples were taken from several lobes, fixed in buffered formalin or snap frozen in liquid nitrogen, and stored at 80°C until use.
Liver function tests
Alanine aminotransferase activity (ALT) was measured on an automated analyzer in the Biochemistry Department of Henri Mondor Hospital in Creteil.
Liver histology
Liver specimens were fixed in formalin and embedded in paraffin. Tissue sections (4 µm-thick) were stained with hematoxylin-eosin for routine examination. Histological grading (necrosis and inflammation) was blindly assessed on at least four fragments from different areas of each liver, as described previously (24)
. All samples were scored simultaneously.
Immunostaining
Immunohistochemical staining for smooth muscle
-actin (
-SMA) was performed as described previously (23)
in liver tissue fixed in formalin and embedded in paraffin using a Vector M.O.M. immunodetection kit in accordance with the protocol specified by the manufacturer (Vector Laboratories, Burlingame, CA, USA), with a 1:1000 dilution of a monoclonal antibody to
-SMA (Sigma). The area of positive staining was scored blindly and measured on four or five liver fragments per animal, as described previously (24)
. No staining was observed when omitting the primary antibody.
Western blot analysis of PCNA expression
Western blot analysis of PCNA was performed with 30 µg of lysates, obtained as described previously (25)
, using mouse monoclonal antibody to PCNA (1:1000, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and peroxidase-conjugated goat anti-mouse IgG antibody (1:5000, Jackson Immunoresearch, West Grove, PA, USA) as a secondary antibody. Protein expression was visualized by using an enhanced chemiluminescence (ECL Plus) assay kit according to the manufacturers instructions (Amersham Biosciences, Arlington Heights, IL, USA). Signals were normalized to the ß-actin signals (mouse monoclonal anti-ß-actin antibody, 1:5000, Sigma).
RNA isolation and RT-PCR
Total RNA was extracted from cells using an RNeasy kit (Qiagen, Valencia, CA, USA) and from frozen liver specimens using Tri-Reagent. Real-time PCR was carried out on a LightCycler (Roche Diagnostics), as described previously (24)
, using a Quantitech SYBR Green PCR kit (Qiagen). Oligonucleotide primers (MWG Biotech) for the following mouse genes were S1P1 receptor: S1P1 sense, 5'-ACTTTGCGAGTGAGCTG-3' and S1P1 antisense 5'-AGTGAGCCTTCAGTTACAGC-3'; S1P2 receptor: S1P2 sense, 5'-TTCTGGAGGGTAACACAGTGGT-3' and S1P2 antisense, 5'-ACACCCTTTGTATCAAGTGGCA-3'; S1P3 receptor: S1P3 sense 5'-TGGTGTGCGGCTGTCTAGTCAA-3' and S1P3 antisense, 5'-CACAGCAAGCAGACCTCCAGA-3'. SphK1: SphK1 sense 5'-TGTCACCCATGAACCTGCTGTCCCTGCACA-3' and SphK1 antisense 5'-AGAAGGCACTGGCTCCAGAGGAACAAG-3'; SphK2: SphK2 sense 5'-ACAGAACCATGCCCGTGAG-3' and SphK2 antisense 5'-AGGTCAACACCGACAACCTG-3';
-SMA sense 5'-TCCTCCCTGGAGAAGAGCTAC and
-SMA antisense 5'-TATAGGTGGTTTCGTGGATGC; TGF-ß1 sense 5'-TGCGCTTGCAGAGATTAAAA-3'up and TGF-ß1 antisense 5'-TCACTGGAGTTGTACGGCAG-3';procollagen
1(I): Col
1(I) sense 5'-GAAACCCGAGGTATGCTTGA-3' and Col
1(I) antisense 5'-GACCAGGAGGACCAGGAAGT-3'; PDGF-BB: PDGF-BB sense 5'-GGTGAGAAAGATTGAGATTGT-3' and PDGF-BB antisense5'-GAGCTTGAGGCGTCTTGGCT-3'; TIMP-1: TIMP-1 sense 5'-GCATCTCTGGCATCTGGCATC-3' and TIMP-1 antisense 5'-GCGGTTCTGGGACTTGTGGGC-3', TNF-
: TNF-
sense: AATGGCCTCCCTCTCATCAGTT and TNF-
antisense: CCACTTGGTGGTTTGCTACGA; ß2-microglobulin was used as the reference gene for quantification of data from in vivo experiments, and 18S for quantification of cell culture experiments: ß2-microglobulin sense 5'-ATGCTGAAGAACGGGAAAAA-3' and ß2-microglobulin antisense 5'-CGGCCATACTGTCATGCTTA-3'; 18S sense 5'-GTAACCCGTTGAACCCCATT-3' and 18S antisense 5'-CCATCCAATCGGTAGTAGCG-3'. The PCR-amplified products were analyzed on a 2% agarose gel and sequenced.
Isolation and culture of murine hepatic myofibroblasts
Murine hepatic myofibroblasts were isolated from WT (n=3) and S1P2/ (n=3) animals by collagenase perfusion and purified by density gradient in Nicodenz, as described previously (23)
. After isolation, cells were cultured in DMEM medium containing 20% FCS. One day after isolation, cell debris and nonadherent cells were removed by washing and the cells were further cultured in DMEM medium containing 10% FCS. Cells were used between the fourth and ninth passage and expressed characteristic markers of hepatic myofibroblasts were found in situ in the fibrotic liver,
-SMA, fibulin-2, and interleukin-6 (26)
.
DNA synthesis and cell proliferation assays
DNA synthesis was measured in triplicate wells by incorporation of [3H]-thymidine, as described previously (25)
. Confluent serum-starved mouse myofibroblasts were starved for 24 h in the presence of 0.02% BSA, and further stimulated for 24 h with 20 ng/ml PDGF-BB and 0.02% BSA. S1P (0 to 10 µM) was added to cells 30 min before PDGF-BB incubations. [3H]-Thymidine (0.5 µCi/well) was added during the last 20 h of incubation. Cell proliferation was assessed as described previously (27)
in 60 mm plates. Cells (200 000 cells/plate) were allowed to attach overnight in DMEM medium containing 10% FCS, washed in serum-free DMEM, and further incubated with or without 20 ng/ml PDGF-BB in the presence of 5 µM S1P or vehicle. After 3 days, cells were trypsinized and counted with a hemocytometer.
Sphingosine kinase assay
Sphingosine kinase activity was determined essentially as described in ref. 28
, with minor modifications. Confluent hepatic myofibroblasts were made quiescent in serum-free medium for 24 h. Cells were further incubated for the indicated periods with the effectors, washed twice in ice-cold PBS, harvested, and cell pellets were frozen at 80°C. Cells were lysed in 500 µl of sphingosine kinase buffer (20 mM Tris buffer pH 7.4 containing 20% glycerol, 1 mM ß-mercaptoethanol, 1 mM EDTA, 1 mM sodium orthovanadate, 15 mM NaF, 10 µg/ml leupeptin and aprotinin, 1 mM PMSF, 0.5 mM 4-deoxypyridoxine, and 40 mM ß-glycerophosphate) and the lysates were centrifuged for 1 h at 100,000 g at 4°C. Lysates from liver samples were prepared under the same conditions. The kinase assay was performed by mixing protein extracts (50100 µg) with 10 µl of 1 mM sphingosine (dissolved in 5% Triton X-100) and 10 µl of [
32P]ATP (10 µCi, 20 mM) containing 200 mM MgCl2. After incubation for 30 min at 37°C, the reaction was stopped by addition of 20 µl of 1 N HCl and the [
32P]ATP-labeled S1P was extracted, isolated by thin-layer chromatography, and quantified after scraping by liquid scintillation.
Statistics
Results are expressed as mean ± SE of n experiments. Results were analyzed by Mann Whitney test or 1-way analysis of variance (ANOVA), followed by Bonferronis post test, when appropriate. Statistical analysis of the quantitative RT-PCR data was performed using the REST© program (29)
. P < 0.05 was taken as the minimum level of significance.
| RESULTS |
|---|
|
|
|---|
-SMA after 72 h (30)
|
Reduced hepatic wound healing response in S1P2/ but not in S1P3/ mice
We next assessed the impact of S1P2 receptors on liver injury and wound healing response owing to the use of S1P2/ animals. As expected, S1P2/ mice did not express S1P2 mRNA (Fig. 2
A). After acute CCl4 injury, WT and S1P2/ mice showed no differences in either the kinetics of transaminase (alanine aminotransferase, ALT) elevation (Fig. 2B
), histological staging of hepatic necrosis and inflammation (Fig. 2C, D
), or hepatic induction of TNF-
, a marker of inflammation (Fig. 2E
). We also assessed hepatocyte proliferation by proliferating cell nuclear antigen (PCNA) expression. PCNA expression was maximally induced 48 h after CCl4 administration in hepatocytes of WT mice, as demonstrated by immunohistochemistry (not shown). By Western blot analysis, PCNA expression was similarly enhanced in S1P2/ and WT mice, indicating that S1P2 does not affect hepatic regeneration after acute liver injury (Fig. 2F
).
|
The matrix remodeling process was subsequently evaluated by several parameters. As expected, CCl4 administration triggered an increase in hepatic myofibroblast accumulation in WT mice after 72 h, as shown by an 8.4-fold up-regulation of
-SMA mRNA and a 7.4 increase in
-SMA immunostaining (Fig. 3
A). Accordingly, accumulation of hepatic myofibroblasts was associated with a strong induction of hepatic TGF-ß1, PDGF-BB, procollagen
1(I), and TIMP-1 mRNAs (Fig. 3B
). In contrast, CCl4-treated S1P2/ animals showed a significantly lower induction of
-SMA mRNA expression and
-SMA immunostaining, indicating that S1P2 inactivation decreases hepatic myofibroblast accumulation after acute liver injury (Fig. 3A
). Inductions of TGF-ß1, PDGF-BB, and TIMP-1 were also significantly reduced in S1P2/ animals compared with WT counterparts (Fig. 3B
), whereas there were no differences in
1(I) (Fig. 3B
) and
1(III) (not shown) procollagen mRNA inductions between groups, suggesting that S1P2 decreases hepatic matrix remodeling by shutting down matrix degradation rather than stimulating matrix synthesis.
|
We also investigated the function of S1P3 receptors owing to the use of S1P3/ animals. As expected, S1P3 mRNA was undetectable in the liver of S1P3/ mice (Fig. 4
A). The extent and time course of transaminase elevation were similar in WT and S1P3/ animals, peaking after 24 h (not shown), while the severity of hepatitis at 24 h was similar in both groups of animals, as assessed by histological staging of necrosis and inflammation (not shown). Finally, there were no significant differences in the wound healing response in S1P3/ and WT animals, as shown by similar inductions of
-SMA and TGF-ß1 mRNAs 72 h after CCl4 treatment (Fig. 4B
).
|
Cultured S1P2/ hepatic myofibroblasts show reduced mitogenic properties
Further experiments were conducted to characterize the mechanisms whereby genetic invalidation of S1P2 reduces accumulation of hepatic myofibroblasts. We focused on the regulation of their proliferation, using cultured hepatic myofibroblasts isolated from WT and S1P2/ mice. As expected, S1P2 mRNA was undetectable in cells isolated from S1P2/ livers, in contrast to hepatic myofibroblasts obtained from WT livers (Fig. 5
A). S1P stimulated DNA synthesis and cell proliferation of hepatic myofibroblasts from WT mice, but did not affect proliferation of S1P2/ cells (Fig. 5B
). Since PDGF-BB expression was down-regulated in the liver of CCl4-treated S1P2/ animals (see Fig. 3B
), we also examined the effects of this potent mitogen for hepatic myofibroblasts (30)
. In keeping with in vivo data, PDGF-BB mRNA expression was lowered in S1P2/ cells compared with WT cells (Fig. 5C
). In WT cells, PDGF-BB strongly up-regulated the S1P system, eliciting a 3.8-fold and 2.7-fold increase in S1P2 mRNA and SphK1 mRNA expression without affecting SphK2 mRNA expression (Fig. 5C
). Induction of SphK1 mRNA by PDGF-BB was associated with an increase in SphK activity (Fig. 5C
, inset). In contrast, S1P2/ hepatic myofibroblasts exhibited a marked down-regulation of basal and PDGF-BB-stimulated SphK1 mRNA levels whereas SphK2 was unaffected (Fig. 5C
). Accordingly, activation of SphK activity by PDGF-BB was blunted in S1P2/ cells; however, there was no significant change in total (i.e., contributed by SphK1 and 2) basal SphK activity of S1P2/ cells compared with WT counterparts (Fig. 5C
, inset). Functional studies showed that in addition to its mitogenic properties (Fig. 5D
, E), PDGF-BB potentiated the mitogenic effect of S1P in WT cells (Fig. 5D
, E). Hepatic myofibroblasts isolated from S1P2/ mice displayed enhanced proliferation in response to PDGF-BB alone (Fig. 5D
, E), but its comitogenic effect with S1P was blunted (Fig. 5D
, E). Reduction in SphK1 and PDGF-BB expression was associated with a decrease in basal and PDGF-BB stimulated DNA synthesis in S1P2/ hepatic myofibroblasts compared with WT cells (Fig. 5B
, D).
|
| DISCUSSION |
|---|
|
|
|---|
It is well known that acute liver injury triggers a wound healing process that is associated with hepatic regeneration after the proliferation of hepatocytes and matrix remodeling. The matrix remodeling process results from both the hepatic induction of fibrogenic cytokines such as TGF-ß1 and PDGF-BB, and the proliferation of hepatic myofibroblasts that overexpress matrix genes and inhibitors of matrix metalloproteinases (TIMPs) (30)
. Here we show a strong up-regulation of the S1P system during hepatic wound healing, as reflected by a rise in S1P2, S1P3, SphK1, and SphK2 mRNAs after acute administration of CCl4. We also demonstrate that S1P2 is a key mediator of the wound healing process that triggers matrix remodeling without affecting hepatocyte regeneration. Indeed, WT and S1P2/ mice display similar regenerative capacities, in contrast to a previous report showing that S1P inhibits both proliferation of cultured rat hepatocytes and liver regeneration after partial hepatectomy (18)
. The authors suggested that the growth inhibitory effect of S1P in hepatocytes relies on S1P2 based on the use of a selective S1P2 agonist in vitro; however, the study did not include experiments demonstrating S1P2 receptor dependency on the growth inhibitory effect of S1P in vivo. In contrast, we unravel a major selective role of S1P2 in matrix remodeling after acute liver injury. Thus, S1P2/ mice show reduced accumulation of hepatic myofibroblasts and decreased hepatic induction of TGF-ß1, PDGF-BB, and TIMP-1, all of which are synthesized, albeit not exclusively, by hepatic myofibroblasts (30)
. In contrast, S1P3/ mice show similar induction of matrix remodeling in response to acute liver injury. Culture experiments of hepatic myofibroblasts shed light on the mechanisms mediating the regulatory effects of S1P2 on hepatic myofibroblast accumulation. Thus, we demonstrate that WT myofibroblasts display enhanced proliferation in response to S1P, whereas the mitogenic effect is blunted in S1P2/ cells. Taken together, these data demonstrate that S1P promotes proliferation of hepatic myofibroblasts via S1P2 in vivo and in vitro. It should be noted that two recent studies showed opposite S1P2-dependent growth inhibitory effects of S1P in vitro in cultured myoblasts and embryonic fibroblasts (14
, 31)
. Therefore, these data suggest that the overall effect of S1P2 on cell proliferation may result from the balance between simultaneous positive and negative signals within a given cell.
As SphK1 has been shown to promote cell proliferation and survival (1
, 32)
, we investigated whether Sphk1 may also participate in the S1P2-dependent mitogenic response of hepatic myofibroblasts found in vivo. We found that SphK1 mRNA is down-regulated in S1P2/ hepatic myofibroblasts whereas SphK2 mRNA, an isoform with growth inhibitory and apoptotic properties (33
, 34)
, is unchanged. These results suggest the presence of a regulatory loop whereby S1P2 up-regulates SphK1, the latter in turn leading to constitutive activation of S1P2 by endogenous production of S1P (Fig. 6
). The mechanism by which intracellularly generated S1P may be released from hepatic myofibroblasts remains to be elucidated, but could involve ABCC1, a protein recently identified as an S1P exporter (35)
. Finally, as shown in dermal fibroblasts (19
, 36)
, SphK1 could also contribute to the mitogenic effect of S1P2 by up-regulating TIMP-1, an inhibitor of metalloproteinase with mitogenic effects in hepatic myofibroblasts (19
, 36)
that shows reduced expression in S1P2/ mice. However, this hypothesis is unlikely, since TIMP-1 mRNA levels were similar in S1P2/ and WT hepatic myofibroblasts (not shown). Therefore, down-regulation of TIMP-1 in S1P2/ mice after acute liver injury probably reflects the reduced number of hepatic myofibroblasts rather than direct regulation of TIMP-1 expression via S1P2/SphK1.
|
In addition to its mitogenic effect, S1P2 also triggers an autocrine positive feedback loop responsible for a comitogenic effect of S1P and PDGF-BB. Indeed, S1P2 up-regulates PDGF-BB and PDGF-BB up-regulates S1P2 as well as Sphk1, in keeping with previous studies (14)
, thereby enhancing the mitogenic effect of S1P (Fig. 6)
. Cross-talk between PDGF receptors and S1P2 could account for this comitogenic effect, as reported in several instances for tyrosine kinase and G-protein-coupled receptors, such as S1P receptors (14
, 37)
.
In summary, acute liver injury is associated with a marked hepatic induction of S1P2 and S1P3 and with a parallel up-regulation of SphK1 and SphK2 and of sphingosine kinase activity, strongly suggesting an increase in S1P production. Our data demonstrate that S1P2 up-regulates SphK1 expression and mediates the mitogenic effect of S1P in hepatic myofibroblasts. They also reveal a multistep positive feedback loop initiated by an S1P2-dependent increase in SphK1 and PDGF-BB expression, followed by a PDGF-BB-dependent up-regulation of S1P2 expression, ultimately leading to an enhanced mitogenic effect of S1P (Fig. 6)
. Our study also unravels a novel specific role of S1P2 in matrix remodeling during acute hepatic wound healing and illustrates the emerging concept of specific functions triggered by distinct S1P receptors. A recent study pointed out another S1P2-dependent specific liver function of S1P, namely, regulation of intrahepatic resistance (20)
. Altogether, these results invite investigation into whether S1P2 may be a mediator of liver fibrogenesis and portal hypertension during chronic liver injury.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Received for publication July 25, 2006. Accepted for publication January 25, 2007.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
F. Cencetti, C. Bernacchioni, P. Nincheri, C. Donati, and P. Bruni Transforming Growth Factor-{beta}1 Induces Transdifferentiation of Myoblasts into Myofibroblasts via Up-Regulation of Sphingosine Kinase-1/S1P3 Axis Mol. Biol. Cell, March 15, 2010; 21(6): 1111 - 1124. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Li, X. Jiang, L. Yang, X. Liu, S. Yue, and L. Li Involvement of Sphingosine 1-Phosphate (SIP)/S1P3 Signaling in Cholestasis-Induced Liver Fibrosis Am. J. Pathol., October 1, 2009; 175(4): 1464 - 1472. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gellings Lowe, J. S. Swaney, K. M. Moreno, and R. A. Sabbadini Sphingosine-1-phosphate and sphingosine kinase are critical for transforming growth factor-{beta}-stimulated collagen production by cardiac fibroblasts Cardiovasc Res, May 1, 2009; 82(2): 303 - 312. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Means and J. H. Brown Sphingosine-1-phosphate receptor signalling in the heart Cardiovasc Res, May 1, 2009; 82(2): 193 - 200. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ikeda, N. Watanabe, I. Ishii, T. Shimosawa, Y. Kume, T. Tomiya, Y. Inoue, T. Nishikawa, N. Ohtomo, Y. Tanoue, et al. Sphingosine 1-phosphate regulates regeneration and fibrosis after liver injury via sphingosine 1-phosphate receptor 2 J. Lipid Res., March 1, 2009; 50(3): 556 - 564. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Means, S. Miyamoto, J. Chun, and J. H. Brown S1P1 Receptor Localization Confers Selectivity for Gi-mediated cAMP and Contractile Responses J. Biol. Chem., May 2, 2008; 283(18): 11954 - 11963. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |