FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.06-6889com.
(The FASEB Journal. 2007;21:2005-2013.)
© 2007 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-6889comv1
21/9/2005    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Serriere-Lanneau, V.
Right arrow Articles by Lotersztajn, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Serriere-Lanneau, V.
Right arrow Articles by Lotersztajn, S.

The sphingosine 1-phosphate receptor S1P2 triggers hepatic wound healing

Valérie Serriere-Lanneau*,{dagger},1, Fatima Teixeira-Clerc*,{dagger},1, Liying Li*,{dagger}, Marlies Schippers*,||, Willie de Wries*,||, Boris Julien*,{dagger}, Jeanne Tran-Van-Nhieu*,{dagger},§, Sylvie Manin*,{dagger}, Klaas Poelstra||, Jerold Chun, Stéphane Carpentier{dagger}{dagger}, Thierry Levade{dagger}{dagger},{ddagger}{ddagger}, Ariane Mallat*,{dagger},{ddagger} and Sophie Lotersztajn*,{dagger},{ddagger},2

* INSERM, U841, IMRB, Créteil, France;

{dagger} Université Paris 12, Faculté de Médecine, Créteil, France;

{ddagger} AP-HP, Groupe hospitalier Henri Mondor-Albert Chenevier, Service d’Hépatologie et de Gastroentérologie, Créteil, France;

§ AP-HP, Groupe hospitalier Henri Mondor-Albert Chenevier, Département de Pathologie, Créteil, France;

|| Department of Pharmacokinetics and Drug Delivery, University of Groningen, Groningen, Netherlands;

Department of Molecular Biology, Helen L. Dorris Child and Adolescent Neuropsychiatric Disorder Institute, The Scripps Research Institute, La Jolla, California, USA;

{dagger}{dagger} INSERM, IFR31, U858, Toulouse, France; and

{ddagger}{ddagger} Université Toulouse III Paul Sabatier, IFR31, Toulouse, France

2Correspondence: INSERM U841, Institut Mondor de Recherche Biomédicale, Hôpital Henri Mondor, 94010 Créteil, France. E-mail: sophie.lotersztajn{at}creteil.inserm.fr


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Sphingosine 1-phosphate (S1P) is a bioactive sphingolipid produced by sphingosine kinase (SphK1 and 2). We previously showed that S1P receptors (S1P1, S1P2, and S1P3) are expressed in hepatic myofibroblasts (hMF), a population of cells that triggers matrix remodeling during liver injury. Here we investigated the function of these receptors in the wound healing response to acute liver injury elicited by carbon tetrachloride, a process that associates hepatocyte proliferation and matrix remodeling. Acute liver injury was associated with the induction of S1P2, S1P3, SphK1, and SphK2 mRNAs and increased SphK activity, with no change in S1P1 expression. Necrosis, inflammation, and hepatocyte regeneration were similar in S1P2–/– and wild-type (WT) mice. However, compared with WT mice, S1P2–/– mice displayed reduced accumulation of hMF, as shown by lower induction of smooth muscle {alpha}-actin mRNA and lower induction of TIMP-1, TGF-ß1, and PDGF-BB mRNAs, overall reflecting reduced activation of remodeling in response to liver injury. The wound healing response was similar in S1P3–/– and WT mice. In vitro, S1P enhanced proliferation of cultured WT hMF, and PDGF-BB further enhanced the mitogenic effect of S1P. In keeping with these findings, PDGF-BB up-regulated S1P2 and SphK1 mRNAs, increased SphK activity, and S1P2 induced PDGF-BB mRNA. These effects were blunted in S1P2–/– cells, and S1P2–/– hMF exhibited reduced mitogenic and comitogenic responses to S1P. These results unravel a novel major role of S1P2 in the wound healing response to acute liver injury by a mechanism involving enhanced proliferation of hMF.—Serriere-Lanneau, V., Teixeira-Clerc, F., Li, L., Schippers, M., de Wries, W., Julien, B., Tran-Van-Nhieu, J., Manin, S., Poelstra, K., Chun, J., Carpentier, S., Levade, T., Mallat, A., Lotersztajn, S. The sphingosine 1-phosphate receptor S1P2 triggers hepatic wound healing.


Key Words: liver • hepatic myofibroblasts


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
SPHINGOSINE 1-PHOSPHATE (S1P) IS A BIOACTIVE sphingolipid metabolite of ceramide that is produced after phosphorylation of sphingosine by sphingosine kinase (SphK) types 1 and 2 (1) . The lipid was originally identified as an intracellular messenger that regulates cell survival and differentiation, but its actions are also mediated by a family of G-protein-coupled receptors referred to as S1P1–5 (1 2 3 4 5 6 7) . Delineation of specific intracellular or receptor-dependent functions of S1P is still limited by the lack of selective receptor agonists and antagonists. Nevertheless, some specific S1P receptor-dependent functions have emerged, owing to the recent availability of S1P1, S1P2, and S1P3 receptor knockout mice. Thus, S1P1-dependent functions include regulation of S1P signaling, fertility, angiogenesis and vascular maturation, and lymphocyte development and trafficking (1 2 3 4 5 , 8 9 10) . S1P2 promotes myogenic differentiation whereas S1P3 regulates angiogenesis, heart rate, triggers vasoactive effects, and compromises lung barrier integrity (9 , 11 12 13) . Finally, S1P1, S1P2, and S1P3 are implicated in cytoskeletal reorganization, cell migration, proliferation, differentiation, and survival (1 2 3 4 , 14) .

Only a few recent studies investigated the function of S1P in liver pathophysiology (15 16 17 18 19 20) . Thus, it has been shown that S1P inhibits proliferation of cultured hepatocytes via S1P2 (18) . We recently identified S1P receptors (S1P1, S1P2, and S1P3) in cultured human hepatic myofibroblasts, a population of fibrogenic cells that plays a key role in the wound healing response associated with liver injury (15) . We also demonstrated that activation of S1P receptors triggers survival of hepatic myofibroblasts (16) . These results therefore suggested that specific S1P receptors might participate in the wound healing response to liver injury. We explored this hypothesis by using S1P2- and S1P3-deficient mice that were subjected to acute carbon tetrachloride (CCl4) intoxication, an established model of liver injury characterized by acute hepatitis, followed by a wound healing response that associates hepatocyte proliferation and a matrix remodeling process driven by hepatic myofibroblasts.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Materials
Collagenase was from Roche (Nutley, NJ, USA), culture media and reagents were from Life Technologies, Inc. (Carlsbad, CA, USA), fetal calf serum (FCS) was from JBio Laboratories (Les Ulis, France), platelet-derived growth factor-BB came from PreproTech Inc. (Rocky Hill, NJ, USA), Nicodenz was from Abcys (Paris, France), and S1P was from Biomol (Hamburg, Germany). A stock solution of S1P was prepared in methanol and stored at –80°C. Freshly made dilutions were prepared in 0.4% fatty acid-free bovine serum albumin after evaporation of methanol, resuspension in 0.4% fatty acid-free bovine serum albumin, and sonication. [methyl-3H]Thymidine (25 Ci/mmol) was purchased from ICN (Irvine, CA, USA).

Animals and experimental design
Mice invalidated for S1P2 or S1P3 receptors (S1P2–/– or S1P3–/–) were generated as described previously (21 , 22) . S1P2–/– or S1P3–/– and their wild-type (WT) littermates were generated from heterozygous mice bred for seven generations on a C57Bl/6J background. Animals were housed in temperature- and humidity-controlled rooms, kept on a 12 h light/dark cycle, and provided unrestricted amounts of food and water. Male and female mice aged 8–12 wk were used. Animal procedures were conducted in accordance with French government policies (Services Vétérinaires de la Santé et de la Production Animale, Ministère de l’Agriculture).

Acute liver injury was induced by an intraperitoneal injection of CCl4 [Sigma, St. Louis, MO, USA; 0.5 ml/kg body weight, 1:5 dilution in mineral oil (MO)], as described previously (23) . Animals were sacrificed 24, 48, or 72 h after treatment. WT (n=22) and S1P2–/– (n=14) animals were divided into the following groups: WT/sham (MO, n=5); WT/CCl4 sacrificed either 24 h (n=3), 48 h (n=6), or 72 h (n=8) after CCl4 injection; S1P2–/–/sham (MO, n=3); S1P2–/–/CCl4 sacrificed either 24 h (n=3), 48 h (n=3), or 72 h (n=5) after injection of CCl4. WT (n=17) and S1P3–/– (n=11) animals were divided into the following groups: WT/sham (MO, n=4); WT/CCl4 sacrificed 24 h (n=5) or 72 h (n=8) after CCl4 injection; S1P3–/–/sham (MO, n=2); S1P3–/–/CCl4 sacrificed 24 h (n=4) or 72 h (n=5) after CCl4 injection. No mortality was observed throughout treatment. Liver samples were taken from several lobes, fixed in buffered formalin or snap frozen in liquid nitrogen, and stored at –80°C until use.

Liver function tests
Alanine aminotransferase activity (ALT) was measured on an automated analyzer in the Biochemistry Department of Henri Mondor Hospital in Creteil.

Liver histology
Liver specimens were fixed in formalin and embedded in paraffin. Tissue sections (4 µm-thick) were stained with hematoxylin-eosin for routine examination. Histological grading (necrosis and inflammation) was blindly assessed on at least four fragments from different areas of each liver, as described previously (24) . All samples were scored simultaneously.

Immunostaining
Immunohistochemical staining for smooth muscle {alpha}-actin ({alpha}-SMA) was performed as described previously (23) in liver tissue fixed in formalin and embedded in paraffin using a Vector M.O.M. immunodetection kit in accordance with the protocol specified by the manufacturer (Vector Laboratories, Burlingame, CA, USA), with a 1:1000 dilution of a monoclonal antibody to {alpha}-SMA (Sigma). The area of positive staining was scored blindly and measured on four or five liver fragments per animal, as described previously (24) . No staining was observed when omitting the primary antibody.

Western blot analysis of PCNA expression
Western blot analysis of PCNA was performed with 30 µg of lysates, obtained as described previously (25) , using mouse monoclonal antibody to PCNA (1:1000, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and peroxidase-conjugated goat anti-mouse IgG antibody (1:5000, Jackson Immunoresearch, West Grove, PA, USA) as a secondary antibody. Protein expression was visualized by using an enhanced chemiluminescence (ECL Plus) assay kit according to the manufacturer’s instructions (Amersham Biosciences, Arlington Heights, IL, USA). Signals were normalized to the ß-actin signals (mouse monoclonal anti-ß-actin antibody, 1:5000, Sigma).

RNA isolation and RT-PCR
Total RNA was extracted from cells using an RNeasy kit (Qiagen, Valencia, CA, USA) and from frozen liver specimens using Tri-Reagent. Real-time PCR was carried out on a LightCycler (Roche Diagnostics), as described previously (24) , using a Quantitech SYBR Green PCR kit (Qiagen). Oligonucleotide primers (MWG Biotech) for the following mouse genes were S1P1 receptor: S1P1 sense, 5'-ACTTTGCGAGTGAGCTG-3' and S1P1 antisense 5'-AGTGAGCCTTCAGTTACAGC-3'; S1P2 receptor: S1P2 sense, 5'-TTCTGGAGGGTAACACAGTGGT-3' and S1P2 antisense, 5'-ACACCCTTTGTATCAAGTGGCA-3'; S1P3 receptor: S1P3 sense 5'-TGGTGTGCGGCTGTCTAGTCAA-3' and S1P3 antisense, 5'-CACAGCAAGCAGACCTCCAGA-3'. SphK1: SphK1 sense 5'-TGTCACCCATGAACCTGCTGTCCCTGCACA-3' and SphK1 antisense 5'-AGAAGGCACTGGCTCCAGAGGAACAAG-3'; SphK2: SphK2 sense 5'-ACAGAACCATGCCCGTGAG-3' and SphK2 antisense 5'-AGGTCAACACCGACAACCTG-3'; {alpha}-SMA sense 5'-TCCTCCCTGGAGAAGAGCTAC and {alpha}-SMA antisense 5'-TATAGGTGGTTTCGTGGATGC; TGF-ß1 sense 5'-TGCGCTTGCAGAGATTAAAA-3'up and TGF-ß1 antisense 5'-TCACTGGAGTTGTACGGCAG-3';procollagen {alpha}1(I): Col {alpha}1(I) sense 5'-GAAACCCGAGGTATGCTTGA-3' and Col {alpha}1(I) antisense 5'-GACCAGGAGGACCAGGAAGT-3'; PDGF-BB: PDGF-BB sense 5'-GGTGAGAAAGATTGAGATTGT-3' and PDGF-BB antisense5'-GAGCTTGAGGCGTCTTGGCT-3'; TIMP-1: TIMP-1 sense 5'-GCATCTCTGGCATCTGGCATC-3' and TIMP-1 antisense 5'-GCGGTTCTGGGACTTGTGGGC-3', TNF-{alpha}: TNF-{alpha} sense: AATGGCCTCCCTCTCATCAGTT and TNF-{alpha} antisense: CCACTTGGTGGTTTGCTACGA; ß2-microglobulin was used as the reference gene for quantification of data from in vivo experiments, and 18S for quantification of cell culture experiments: ß2-microglobulin sense 5'-ATGCTGAAGAACGGGAAAAA-3' and ß2-microglobulin antisense 5'-CGGCCATACTGTCATGCTTA-3'; 18S sense 5'-GTAACCCGTTGAACCCCATT-3' and 18S antisense 5'-CCATCCAATCGGTAGTAGCG-3'. The PCR-amplified products were analyzed on a 2% agarose gel and sequenced.

Isolation and culture of murine hepatic myofibroblasts
Murine hepatic myofibroblasts were isolated from WT (n=3) and S1P2–/– (n=3) animals by collagenase perfusion and purified by density gradient in Nicodenz, as described previously (23) . After isolation, cells were cultured in DMEM medium containing 20% FCS. One day after isolation, cell debris and nonadherent cells were removed by washing and the cells were further cultured in DMEM medium containing 10% FCS. Cells were used between the fourth and ninth passage and expressed characteristic markers of hepatic myofibroblasts were found in situ in the fibrotic liver, {alpha}-SMA, fibulin-2, and interleukin-6 (26) .

DNA synthesis and cell proliferation assays
DNA synthesis was measured in triplicate wells by incorporation of [3H]-thymidine, as described previously (25) . Confluent serum-starved mouse myofibroblasts were starved for 24 h in the presence of 0.02% BSA, and further stimulated for 24 h with 20 ng/ml PDGF-BB and 0.02% BSA. S1P (0 to 10 µM) was added to cells 30 min before PDGF-BB incubations. [3H]-Thymidine (0.5 µCi/well) was added during the last 20 h of incubation. Cell proliferation was assessed as described previously (27) in 60 mm plates. Cells (200 000 cells/plate) were allowed to attach overnight in DMEM medium containing 10% FCS, washed in serum-free DMEM, and further incubated with or without 20 ng/ml PDGF-BB in the presence of 5 µM S1P or vehicle. After 3 days, cells were trypsinized and counted with a hemocytometer.

Sphingosine kinase assay
Sphingosine kinase activity was determined essentially as described in ref. 28 , with minor modifications. Confluent hepatic myofibroblasts were made quiescent in serum-free medium for 24 h. Cells were further incubated for the indicated periods with the effectors, washed twice in ice-cold PBS, harvested, and cell pellets were frozen at –80°C. Cells were lysed in 500 µl of sphingosine kinase buffer (20 mM Tris buffer pH 7.4 containing 20% glycerol, 1 mM ß-mercaptoethanol, 1 mM EDTA, 1 mM sodium orthovanadate, 15 mM NaF, 10 µg/ml leupeptin and aprotinin, 1 mM PMSF, 0.5 mM 4-deoxypyridoxine, and 40 mM ß-glycerophosphate) and the lysates were centrifuged for 1 h at 100,000 g at 4°C. Lysates from liver samples were prepared under the same conditions. The kinase assay was performed by mixing protein extracts (50–100 µg) with 10 µl of 1 mM sphingosine (dissolved in 5% Triton X-100) and 10 µl of [{gamma}32P]ATP (10 µCi, 20 mM) containing 200 mM MgCl2. After incubation for 30 min at 37°C, the reaction was stopped by addition of 20 µl of 1 N HCl and the [{gamma} 32P]ATP-labeled S1P was extracted, isolated by thin-layer chromatography, and quantified after scraping by liquid scintillation.

Statistics
Results are expressed as mean ± SE of n experiments. Results were analyzed by Mann Whitney test or 1-way analysis of variance (ANOVA), followed by Bonferroni’s post test, when appropriate. Statistical analysis of the quantitative RT-PCR data was performed using the REST© program (29) . P < 0.05 was taken as the minimum level of significance.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Acute liver injury promotes activation of the hepatic S1P system
We first investigated whether acute CCl4 injury is associated with up-regulation of the hepatic S1P system. This liver injury model is characterized by development of acute hepatitis after 24 h, followed by a wound healing response that associates both hepatocyte proliferation after 48 h and matrix remodeling triggered by hepatic myofibroblasts expressing {alpha}-SMA after 72 h (30) . S1P1 receptor mRNA expression was not modified by CCl4-induced acute liver injury. In contrast, hepatic S1P2 and S1P3 receptor mRNAs were markedly induced from 24 h through 72 h (Fig. 1 A). In addition, there was a strong hepatic induction of mRNAs encoding SphK1 and SphK2 (Fig. 1B ), the rate-limiting enzymes for S1P biosynthesis, and an increase in SphK enzyme activity (Fig. 1C ). This coordinated up-regulation of the hepatic S1P system strongly suggested a role for S1P in the wound healing response to acute liver injury.


Figure 1
View larger version (19K):
[in this window]
[in a new window]

 
Figure 1. Expression of S1P receptors and sphingosine kinase after acute hepatic injury. Mice injected with a single dose of CCl4 or mineral oil (MO) were sacrificed after 24 h [CCl4-treated mice (n=3) and MO-treated mice (n=3)], 48 h [CCl4-treated mice (n=3) and MO-treated mice (n=3)], or 72 h [CCl4-treated mice (n=8) and MO-treated mice (n=3)]. Relative hepatic levels of A) S1P1, S1P2, S1P3 mRNAs, and B) SphK1 and SphK2 mRNAs were measured by quantitative RT-PCR, as described in Materials and Methods. C) Sphingosine kinase activity was assayed on liver extracts prepared as described in Materials and Methods. *P < 0.05 vs. MO-treated mice.

Reduced hepatic wound healing response in S1P2–/– but not in S1P3–/– mice
We next assessed the impact of S1P2 receptors on liver injury and wound healing response owing to the use of S1P2–/– animals. As expected, S1P2–/– mice did not express S1P2 mRNA (Fig. 2 A). After acute CCl4 injury, WT and S1P2–/– mice showed no differences in either the kinetics of transaminase (alanine aminotransferase, ALT) elevation (Fig. 2B ), histological staging of hepatic necrosis and inflammation (Fig. 2C, D ), or hepatic induction of TNF-{alpha}, a marker of inflammation (Fig. 2E ). We also assessed hepatocyte proliferation by proliferating cell nuclear antigen (PCNA) expression. PCNA expression was maximally induced 48 h after CCl4 administration in hepatocytes of WT mice, as demonstrated by immunohistochemistry (not shown). By Western blot analysis, PCNA expression was similarly enhanced in S1P2–/– and WT mice, indicating that S1P2 does not affect hepatic regeneration after acute liver injury (Fig. 2F ).


Figure 2
View larger version (20K):
[in this window]
[in a new window]

 
Figure 2. Genetic inactivation of S1P2 does not affect liver injury and hepatocyte proliferation in response to carbon tetrachloride. A) S1P2 is not expressed in S1P2–/– mice. A band of 271 bp corresponding to the expected size of the S1P2 receptor PCR product was identified in the liver of WT mice but not in the liver of S1P2–/– mice. B, C) Similar liver injury in WT and S1P2–/– mice after CCl4 treatment. B) Alanine aminotransferase (ALT) and C) histological estimation of hepatic necrosis area were assessed 24 h (n=3 WT, n=3 S1P2–/–), 48 h (n=6 WT, n=3 S1P2–/–), and 72 h (n=8 WT, n=5 S1P2–/–) after CCl4 or MO treatment, as described in Materials and Methods. P < 0.05 for WT and S1P2–/– vs. MO-treated mice; n.s for WT vs. S1P2–/– CCl4-treated mice. D, E) Similar inflammation in WT and S1P2–/– mice after CCl4 treatment. D) Histological grading of liver inflammation and E) hepatic TNF-{alpha} mRNA were assessed as described in Materials and Methods. P < 0.05 vs. MO-treated mice; n.s for WT vs. S1P2–/– CCl4-treated mice. F) WT and S1P2–/– mice show similar hepatic regeneration after CCl4 treatment. Western blot analysis of PCNA in liver extracts from WT and S1P2–/– mice 48 h after injection of CCl4 or MO (left panel). Results were normalized to ß-actin expression (right panel). P < 0.05 vs. MO-treated mice; n.s for WT vs. S1P2–/– CCl4-treated mice.

The matrix remodeling process was subsequently evaluated by several parameters. As expected, CCl4 administration triggered an increase in hepatic myofibroblast accumulation in WT mice after 72 h, as shown by an 8.4-fold up-regulation of {alpha}-SMA mRNA and a 7.4 increase in {alpha}-SMA immunostaining (Fig. 3 A). Accordingly, accumulation of hepatic myofibroblasts was associated with a strong induction of hepatic TGF-ß1, PDGF-BB, procollagen {alpha}1(I), and TIMP-1 mRNAs (Fig. 3B ). In contrast, CCl4-treated S1P2–/– animals showed a significantly lower induction of {alpha}-SMA mRNA expression and {alpha}-SMA immunostaining, indicating that S1P2 inactivation decreases hepatic myofibroblast accumulation after acute liver injury (Fig. 3A ). Inductions of TGF-ß1, PDGF-BB, and TIMP-1 were also significantly reduced in S1P2–/– animals compared with WT counterparts (Fig. 3B ), whereas there were no differences in {alpha}1(I) (Fig. 3B ) and {alpha}1(III) (not shown) procollagen mRNA inductions between groups, suggesting that S1P2 decreases hepatic matrix remodeling by shutting down matrix degradation rather than stimulating matrix synthesis.


Figure 3
View larger version (22K):
[in this window]
[in a new window]

 
Figure 3. Reduced wound healing in S1P2–/– mice. WT or S1P2–/– mice injected with a single dose of CCl4 or mineral oil were sacrificed 72 h after injection [CCl4-treated WT mice (n=8) and MO-treated WT mice (n=5); CCl4-treated S1P2–/– mice (n=5) and MO-treated S1P2–/– mice (n=3)]. A) Hepatic expression of {alpha}-SMA in WT and S1P2–/– mice during wound healing. Expression of {alpha}-SMA mRNA was determined by quantitative RT-PCR, as described in Materials and Methods. *P < 0.05 vs. MO-treated mice; #P < 0.05 vs. CCl4-treated WT mice. {alpha}-SMA protein was detected by immunohistochemical staining, and representative hepatic staining of {alpha}-SMA from CCl4-treated WT and S1P2–/– mice is shown. Quantification was performed on 4–5 liver tissue sections per animal as described in Materials and Methods. #P < 0.05 vs. CCl4-treated WT mice. B) Hepatic expression of TGFß-1, PDGF-BB, procollagen {alpha}1(I) (Col {alpha}1(I)), and TIMP-1 mRNA expression during wound healing. Expression of mRNAs was determined by quantitative RT-PCR. *P < 0.05 vs. MO-treated mice. #P < 0.05 vs. CCl4-treated WT mice.

We also investigated the function of S1P3 receptors owing to the use of S1P3–/– animals. As expected, S1P3 mRNA was undetectable in the liver of S1P3–/– mice (Fig. 4 A). The extent and time course of transaminase elevation were similar in WT and S1P3–/– animals, peaking after 24 h (not shown), while the severity of hepatitis at 24 h was similar in both groups of animals, as assessed by histological staging of necrosis and inflammation (not shown). Finally, there were no significant differences in the wound healing response in S1P3–/– and WT animals, as shown by similar inductions of {alpha}-SMA and TGF-ß1 mRNAs 72 h after CCl4 treatment (Fig. 4B ).


Figure 4
View larger version (11K):
[in this window]
[in a new window]

 
Figure 4. S1P3–/– and WT mice elicit similar responses to acute liver injury. A) S1P3 is expressed in WT mice but not in S1P3–/– mice. A band of 305 bp corresponding to the expected size of the S1P3 receptor PCR product was identified in the liver of WT mice, but not in the liver of S1P3–/– mice. B) Expression of hepatic {alpha}-SMA and TGF-ß1 in WT and S1P3–/– after acute liver injury. Mice injected with a single dose of CCl4 or mineral oil were sacrificed 72 h after injection [CCl4-treated mice (n=5) and MO-treated mice (n=3)]. Expression of mRNAs was determined by quantitative RT-PCR, as described in Materials and Methods. *P < 0.05 vs. MO-treated mice; n.s. for WT vs. S1P3–/– CCl4-treated mice.

Cultured S1P2–/– hepatic myofibroblasts show reduced mitogenic properties
Further experiments were conducted to characterize the mechanisms whereby genetic invalidation of S1P2 reduces accumulation of hepatic myofibroblasts. We focused on the regulation of their proliferation, using cultured hepatic myofibroblasts isolated from WT and S1P2–/– mice. As expected, S1P2 mRNA was undetectable in cells isolated from S1P2–/– livers, in contrast to hepatic myofibroblasts obtained from WT livers (Fig. 5 A). S1P stimulated DNA synthesis and cell proliferation of hepatic myofibroblasts from WT mice, but did not affect proliferation of S1P2–/– cells (Fig. 5B ). Since PDGF-BB expression was down-regulated in the liver of CCl4-treated S1P2–/– animals (see Fig. 3B ), we also examined the effects of this potent mitogen for hepatic myofibroblasts (30) . In keeping with in vivo data, PDGF-BB mRNA expression was lowered in S1P2–/– cells compared with WT cells (Fig. 5C ). In WT cells, PDGF-BB strongly up-regulated the S1P system, eliciting a 3.8-fold and 2.7-fold increase in S1P2 mRNA and SphK1 mRNA expression without affecting SphK2 mRNA expression (Fig. 5C ). Induction of SphK1 mRNA by PDGF-BB was associated with an increase in SphK activity (Fig. 5C , inset). In contrast, S1P2–/– hepatic myofibroblasts exhibited a marked down-regulation of basal and PDGF-BB-stimulated SphK1 mRNA levels whereas SphK2 was unaffected (Fig. 5C ). Accordingly, activation of SphK activity by PDGF-BB was blunted in S1P2–/– cells; however, there was no significant change in total (i.e., contributed by SphK1 and 2) basal SphK activity of S1P2–/– cells compared with WT counterparts (Fig. 5C , inset). Functional studies showed that in addition to its mitogenic properties (Fig. 5D , E), PDGF-BB potentiated the mitogenic effect of S1P in WT cells (Fig. 5D , E). Hepatic myofibroblasts isolated from S1P2–/– mice displayed enhanced proliferation in response to PDGF-BB alone (Fig. 5D , E), but its comitogenic effect with S1P was blunted (Fig. 5D , E). Reduction in SphK1 and PDGF-BB expression was associated with a decrease in basal and PDGF-BB stimulated DNA synthesis in S1P2–/– hepatic myofibroblasts compared with WT cells (Fig. 5B , D).


Figure 5
View larger version (38K):
[in this window]
[in a new window]

 
Figure 5. S1P stimulates DNA synthesis in mice hepatic myofibroblasts via an S1P2-dependent pathway. A) S1P2 is expressed in WT but not in S1P2–/– hepatic myofibroblasts. A band of 271 bp corresponding to the expected size of the S1P2 receptor PCR product was identified in WT but not in S1P2–/– hepatic myofibroblasts. B) Effects of S1P on DNA synthesis and cell proliferation in WT and S1P2–/– mice. Left panel: DNA synthesis was measured after stimulation of cells for 30 h with varying concentrations of S1P (see Materials and Methods). Results (mean ± SE, n=10) are expressed as percent of control, and were obtained from three WT and three S1P2–/– cell preparations. P < 0.05 for S1P vs. control in WT myofibroblasts; *significant effects of S1P were obtained for concentrations of > 0.1 µM. P < 0.05 for S1P2–/– vs. WT myofibroblasts. Right panel: effects of S1P on proliferation of WT and S1P2–/– hepatic myofibroblasts. Cells were incubated over a period of 3 days with 5 µM S1P or vehicle. Cell number was determined at day 0 and day 3. Results are expressed as fold increase in cell number at day 0; *P < 0.05 for S1P vs. control in WT cells. #P < 0.05 vs. hepatic myofibroblasts. C) Regulation of the S1P system and PDGF-BB expression in WT and S1P2–/– hepatic myofibroblasts. WT and S1P2–/– hepatic myofibroblasts were treated for 8 h with 20 ng/ml of PDGF-BB or vehicle as indicated, and S1P2, SphK1, SphK2, and PDGF-BB mRNA expressions were measured by quantitative RT-PCR analysis. Data are the mean ± SE of three determinations obtained in three WT and three S1P2–/– cell preparations. *P < 0.05 vs. untreated cells. #P < 0.05 for S1P2–/– vs. WT myofibroblasts. Inset: time course of the effect of PDGF-BB on SphK activity. WT and S1P2–/– hepatic myofibroblasts were incubated for various periods with 20 ng/ml PDGF-BB. Sphingosine kinase activity was measured in cell lysates, as described in Materials and Methods. *P < 0.05 vs. untreated cells. #P < 0.05 for S1P2–/– vs. WT myofibroblasts. Data are the mean ± SE of six determinations obtained in two WT and two S1P2–/– cell preparations. D) Effects of S1P on PDGF-BB-stimulated DNA synthesis in WT and S1P2–/– mice. Cells were stimulated for 30 h with varying concentrations of S1P with 20 ng/ml of PDGF-BB. Results (mean ± SE, n=10) are expressed as percent of control and were obtained from three WT and three S1P2–/– cell preparations. *P < 0.05 for S1P vs. control in WT myofibroblasts; significant effects of S1P were obtained for concentrations of > 0.1 µM. P < 0.05 for S1P2–/– vs. WT myofibroblasts. Inset: effect of PDGF-BB on DNA synthesis in WT and S1P2–/– hepatic myofibroblasts. Results are expressed as percent above respective control levels in WT and S1P2–/– cells. P < 0.05 for PDGF-BB vs. basal in WT and S1P2–/– cells. E) Effects of S1P on PDGF-BB-stimulated proliferation WT and S1P2–/– hepatic myofibroblasts. Cells were incubated over a period of 3 days with 5 µM S1P or vehicle. Cell number was determined on day 0 and day 3. Results are expressed as fold increase in cell number on day 0; *P < 0.05 for PDGF-BB vs. control in WT and S1P2–/– cells. #P < 0.05 vs. WT.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The present study unravels a major role of S1P2 in the wound healing response to acute liver injury. Indeed, we show herein that S1P2–/– mice display decreased activation of hepatic matrix remodeling by a mechanism involving reduced proliferation of hepatic myofibroblasts.

It is well known that acute liver injury triggers a wound healing process that is associated with hepatic regeneration after the proliferation of hepatocytes and matrix remodeling. The matrix remodeling process results from both the hepatic induction of fibrogenic cytokines such as TGF-ß1 and PDGF-BB, and the proliferation of hepatic myofibroblasts that overexpress matrix genes and inhibitors of matrix metalloproteinases (TIMPs) (30) . Here we show a strong up-regulation of the S1P system during hepatic wound healing, as reflected by a rise in S1P2, S1P3, SphK1, and SphK2 mRNAs after acute administration of CCl4. We also demonstrate that S1P2 is a key mediator of the wound healing process that triggers matrix remodeling without affecting hepatocyte regeneration. Indeed, WT and S1P2–/– mice display similar regenerative capacities, in contrast to a previous report showing that S1P inhibits both proliferation of cultured rat hepatocytes and liver regeneration after partial hepatectomy (18) . The authors suggested that the growth inhibitory effect of S1P in hepatocytes relies on S1P2 based on the use of a selective S1P2 agonist in vitro; however, the study did not include experiments demonstrating S1P2 receptor dependency on the growth inhibitory effect of S1P in vivo. In contrast, we unravel a major selective role of S1P2 in matrix remodeling after acute liver injury. Thus, S1P2–/– mice show reduced accumulation of hepatic myofibroblasts and decreased hepatic induction of TGF-ß1, PDGF-BB, and TIMP-1, all of which are synthesized, albeit not exclusively, by hepatic myofibroblasts (30) . In contrast, S1P3–/– mice show similar induction of matrix remodeling in response to acute liver injury. Culture experiments of hepatic myofibroblasts shed light on the mechanisms mediating the regulatory effects of S1P2 on hepatic myofibroblast accumulation. Thus, we demonstrate that WT myofibroblasts display enhanced proliferation in response to S1P, whereas the mitogenic effect is blunted in S1P2–/– cells. Taken together, these data demonstrate that S1P promotes proliferation of hepatic myofibroblasts via S1P2 in vivo and in vitro. It should be noted that two recent studies showed opposite S1P2-dependent growth inhibitory effects of S1P in vitro in cultured myoblasts and embryonic fibroblasts (14 , 31) . Therefore, these data suggest that the overall effect of S1P2 on cell proliferation may result from the balance between simultaneous positive and negative signals within a given cell.

As SphK1 has been shown to promote cell proliferation and survival (1 , 32) , we investigated whether Sphk1 may also participate in the S1P2-dependent mitogenic response of hepatic myofibroblasts found in vivo. We found that SphK1 mRNA is down-regulated in S1P2–/– hepatic myofibroblasts whereas SphK2 mRNA, an isoform with growth inhibitory and apoptotic properties (33 , 34) , is unchanged. These results suggest the presence of a regulatory loop whereby S1P2 up-regulates SphK1, the latter in turn leading to constitutive activation of S1P2 by endogenous production of S1P (Fig. 6 ). The mechanism by which intracellularly generated S1P may be released from hepatic myofibroblasts remains to be elucidated, but could involve ABCC1, a protein recently identified as an S1P exporter (35) . Finally, as shown in dermal fibroblasts (19 , 36) , SphK1 could also contribute to the mitogenic effect of S1P2 by up-regulating TIMP-1, an inhibitor of metalloproteinase with mitogenic effects in hepatic myofibroblasts (19 , 36) that shows reduced expression in S1P2–/– mice. However, this hypothesis is unlikely, since TIMP-1 mRNA levels were similar in S1P2–/– and WT hepatic myofibroblasts (not shown). Therefore, down-regulation of TIMP-1 in S1P2–/– mice after acute liver injury probably reflects the reduced number of hepatic myofibroblasts rather than direct regulation of TIMP-1 expression via S1P2/SphK1.


Figure 6
View larger version (12K):
[in this window]
[in a new window]

 
Figure 6. Proposed mechanism for S1P2-mediated mitogenic effects of S1P in hepatic myofibroblasts. Two regulatory loops contribute to the mitogenic effect of S1P2. On the one hand, S1P2 up-regulates SphK1, the latter in turn leading to constitutive activation of S1P2 by endogenous production of S1P. On the other hand, S1P2 up-regulates PDGF-BB and PDGF-BB up-regulates S1P2 as well as Sphk1, thereby enhancing the mitogenic effect of S1P.

In addition to its mitogenic effect, S1P2 also triggers an autocrine positive feedback loop responsible for a comitogenic effect of S1P and PDGF-BB. Indeed, S1P2 up-regulates PDGF-BB and PDGF-BB up-regulates S1P2 as well as Sphk1, in keeping with previous studies (14) , thereby enhancing the mitogenic effect of S1P (Fig. 6) . Cross-talk between PDGF receptors and S1P2 could account for this comitogenic effect, as reported in several instances for tyrosine kinase and G-protein-coupled receptors, such as S1P receptors (14 , 37) .

In summary, acute liver injury is associated with a marked hepatic induction of S1P2 and S1P3 and with a parallel up-regulation of SphK1 and SphK2 and of sphingosine kinase activity, strongly suggesting an increase in S1P production. Our data demonstrate that S1P2 up-regulates SphK1 expression and mediates the mitogenic effect of S1P in hepatic myofibroblasts. They also reveal a multistep positive feedback loop initiated by an S1P2-dependent increase in SphK1 and PDGF-BB expression, followed by a PDGF-BB-dependent up-regulation of S1P2 expression, ultimately leading to an enhanced mitogenic effect of S1P (Fig. 6) . Our study also unravels a novel specific role of S1P2 in matrix remodeling during acute hepatic wound healing and illustrates the emerging concept of specific functions triggered by distinct S1P receptors. A recent study pointed out another S1P2-dependent specific liver function of S1P, namely, regulation of intrahepatic resistance (20) . Altogether, these results invite investigation into whether S1P2 may be a mediator of liver fibrogenesis and portal hypertension during chronic liver injury.


   ACKNOWLEDGMENTS
 
We thank F. Pecker for her helpful and constant guidance, G. Guellaën for helpful discussions and permanent support, and C. Pavoine for critical reading of the manuscript. This work was supported by the INSERM, the Université Paris-Val-de-Marne and by grants (to S.L) of the Association pour la Recherche sur le Cancer and the Ligue départementale du Val de Marne de la Recherche contre le Cancer, and National Institutes of Health grants NS048478 and DA019674 (to J.C.). V.S-L. was supported by a grant from AFEF-Scherring-Plough and B.J. by a fellowship from the Ministère de la Recherche et de la Technologie.


   FOOTNOTES
 
1 These authors contributed equally to this work.

Received for publication July 25, 2006. Accepted for publication January 25, 2007.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Spiegel, S., Milstien, S. (2003) Sphingosine-1-phosphate: an enigmatic signalling lipid. Nat. Rev. Mol. Cell. Biol. 4,397-407[CrossRef][Medline]
  2. Pyne, S., Pyne, N. J. (2000) Sphingosine 1-phosphate signalling in mammalian cells. Biochem. J. 349,385-402[CrossRef][Medline]
  3. Hla, T. (2004) Physiological and pathological actions of sphingosine 1-phosphate. Semin. Cell. Dev. Biol. 15,513-520[CrossRef][Medline]
  4. Rosen, H., Goetzl, E. J. (2005) Sphingosine 1-phosphate and its receptors: an autocrine and paracrine network. Nat. Rev. Immunol. 5,560-570[CrossRef][Medline]
  5. Taha, T. A., Argraves, K. M., Obeid, L. M. (2004) Sphingosine-1-phosphate receptors: receptor specificity versus functional redundancy. Biochim. Biophys. Acta 1682,48-55[Medline]
  6. Ishii, I., Fukushima, N., Ye, X., Chun, J. (2004) Lysophospholipid receptors: signaling and biology. Annu. Rev. Biochem. 73,321-354[CrossRef][Medline]
  7. Fukushima, N., Ishii, I., Contos, J. J., Weiner, J. A., Chun, J. (2001) Lysophospholipid receptors. Annu. Rev. Pharmacol. Toxicol. 41,507-534[CrossRef][Medline]
  8. Liu, Y., Wada, R., Yamashita, T., Mi, Y., Deng, C. X., Hobson, J. P., Rosenfeldt, H. M., Nava, V. E., Chae, S. S., Lee, M. J., et al (2000) Edg-1, the G protein-coupled receptor for sphingosine-1-phosphate, is essential for vascular maturation. J. Clin. Invest. 106,951-961[Medline]
  9. Lee, M. J., Thangada, S., Claffey, K. P., Ancellin, N., Liu, C. H., Kluk, M., Volpi, M., Sha’afi, R. I., Hla, T. (1999) Vascular endothelial cell adherens junction assembly and morphogenesis induced by sphingosine-1-phosphate. Cell 99,301-312[CrossRef][Medline]
  10. Chae, S. S., Paik, J. H., Furneaux, H., Hla, T. (2004) Requirement for sphingosine 1-phosphate receptor-1 in tumor angiogenesis demonstrated by in vivo RNA interference. J. Clin. Invest. 114,1082-1089[CrossRef][Medline]
  11. Nofer, J. R., van der Giet, M., Tolle, M., Wolinska, I., von Wnuck Lipinski, K., Baba, H. A., Tietge, U. J., Godecke, A., Ishii, I., et al (2004) HDL induces NO-dependent vasorelaxation via the lysophospholipid receptor S1P3. J. Clin. Invest. 113,569-581[CrossRef][Medline]
  12. Sanna, M. G., Liao, J., Jo, E., Alfonso, C., Ahn, M. Y., Peterson, M. S., Webb, B., Lefebvre, S., Chun, J., Gray, N., Rosen, H. (2004) Sphingosine 1-phosphate (S1P) receptor subtypes S1P1 and S1P3, respectively, regulate lymphocyte recirculation and heart rate. J. Biol. Chem. 279,13839-13848[Abstract/Free Full Text]
  13. Gon, Y., Wood, M. R., Kiosses, W. B., Jo, E., Sanna, M. G., Chun, J., Rosen, H. (2005) S1P3 receptor-induced reorganization of epithelial tight junctions compromises lung barrier integrity and is potentiated by TNF. Proc. Natl. Acad. Sci. U. S. A. 102,9270-9275[Abstract/Free Full Text]
  14. Goparaju, S. K., Jolly, P. S., Watterson, K. R., Bektas, M., Alvarez, S., Sarkar, S., Mel, L., Ishii, I., Chun, J., Milstien, S., Spiegel, S. (2005) The S1P2 receptor negatively regulates platelet-derived growth factor-induced motility and proliferation. Mol. Cell. Biol. 25,4237-4249[Abstract/Free Full Text]
  15. Davaille, J., Gallois, C., Habib, A., Li, L., Mallat, A., Tao, J., Levade, T., Lotersztajn, S. (2000) Antiproliferative properties of sphingosine 1-phosphate in human hepatic myofibroblasts. A cyclooxygenase-2 mediated pathway. J. Biol. Chem. 275,34628-34633[Abstract/Free Full Text]
  16. Davaille, J., Li, L., Mallat, A., Lotersztajn, S. (2002) Sphingosine 1-phosphate triggers both apoptotic and survival signals for human hepatic myofibroblasts. J. Biol. Chem. 277,37323-37330[Abstract/Free Full Text]
  17. Im, D. S., Fujioka, T., Katada, T., Kondo, Y., Ui, M., Okajima, F. (1997) Characterization of sphingosine 1-phosphate-induced actions and its signaling pathways in rat hepatocytes. Am. J. Physiol. 272,G1091-G1099[Medline]
  18. Ikeda, H., Satoh, H., Yanase, M., Inoue, Y., Tomiya, T., Arai, M., Tejima, K., Nagashima, K., Maekawa, H., Yahagi, N., et al (2003) Antiproliferative property of sphingosine 1-phosphate in rat hepatocytes involves activation of Rho via Edg-5. Gastroenterology 124,459-469[CrossRef]
  19. Osawa, Y., Hannun, Y. A., Proia, R. L., Brenner, D. A. (2005) Roles of AKT and sphingosine kinase in the antiapoptotic effects of bile duct ligation in mouse liver. Hepatology 42,1320-1328[CrossRef]
  20. Ikeda, H., Nagashima, K., Yanase, M., Tomiya, T., Arai, M., Inoue, Y., Tejima, K., Nishikawa, T., Watanabe, N., Omata, M., Fujiwara, K. (2004) Sphingosine 1-phosphate enhances portal pressure in isolated perfused liver via S1P2 with Rho activation. Biochem. Biophys. Res. Commun. 320,754-759[CrossRef][Medline]
  21. Ishii, I., Ye, X., Friedman, B., Kawamura, S., Contos, J. J., Kingsbury, M. A., Yang, A. H., Zhang, G., Brown, J. H., Chun, J. (2002) Marked perinatal lethality and cellular signaling deficits in mice null for the two sphingosine 1-phosphate (S1P) receptors, S1P(2)/LP(B2)/EDG-5 and S1P(3)/LP(B3)/EDG-3. J. Biol. Chem. 277,25152-25159[Abstract/Free Full Text]
  22. Ishii, I., Friedman, B., Ye, X., Kawamura, S., McGiffert, C., Contos, J. J., Kingsbury, M. A., Zhang, G., Heller Brown, J., Chun, J. (2001) Selective loss of sphingosine 1-phosphate signaling with no obvious phenotypic abnormality in mice lacking its G protein-coupled receptor, LP(B3)/EDG-3. J. Biol. Chem. 276,33697-33704[Abstract/Free Full Text]
  23. Teixeira-Clerc, F., Julien, B., Grenard, P., Tran-Van-Nhieu, J., Deveaux, V., Serriere-Lanneau,, Li, L., Mallat, A., Lotersztajn, S. (2006) CB1 cannabinoid receptor antagonism: a novel strategy for the treatment of liver fibrosis. Nat. Med. 12,671-676[CrossRef][Medline]
  24. Julien, B., Grenard, P., Teixeira-Clerc, F., Tran-Van-Nhieu, J., Li, L., Karzak, M., Zimmer, A., Mallat, A., Lotersztajn, S. (2005) Antifibrogenic role of the cannabinoid receptor CB2 in the liver. Gastroenterology 128,742-755[CrossRef]
  25. Li, L., Grenard, P., Nhieu, J. T., Julien, B., Mallat, A., Habib, A., Lotersztajn, S. (2003) Heme oxygenase-1 is an antifibrogenic protein in human hepatic myofibroblasts. Gastroenterology 125,460-469[CrossRef][Medline]
  26. Li, L., Tao, J., Davaille, J., Feral, C., Mallat, A., Rieusset, J., Vidal, H., Lotersztajn, S. (2001) 15-Deoxy-delta 12,14-prostaglandin j2 induces apoptosis of human hepatic myofibroblasts. a pathway involving oxidative stress independently of peroxisome-proliferator-activated receptors. J. Biol. Chem. 276,38152-38158[Abstract/Free Full Text]
  27. Mallat, A., Fouassier, L., Préaux, A. M., Serradeil-Le Gal, C., Raufaste, D., Rosenbaum, J., Dhumeaux, D., Jouneaux, C., Mavier, P., Lotersztajn, S. (1995) Growth inhibitory properties of endothelins in human hepatic myofibroblastic Ito cells: an ETB-mediated pathway. J. Clin. Invest. 96,42-49[Medline]
  28. Olivera, A., Barlow, K. D., Spiegel, S. (2000) Assaying sphingosine kinase activity. Methods Enzymol. 311,215-223[Medline]
  29. Pfaffl, M. W., Horgan, G. W., Dempfle, L. (2002) Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30,e36[Abstract/Free Full Text]
  30. Lotersztajn, S., Julien, B., Teixeira-Clerc, F., Grenard, P., Mallat, A. (2005) Hepatic fibrosis: molecular mechanisms and drug targets. Ann. Rev. Pharmacol. Toxicol. 45,605-628[CrossRef][Medline]
  31. Donati, C., Meacci, E., Nuti, F., Becciolini, L., Farnararo, M., Bruni, P. (2005) Sphingosine 1-phosphate regulates myogenic differentiation: a major role for S1P2 receptor. FASEB J. 19,449-451[Abstract/Free Full Text]
  32. Wu, W., Mosteller, R. D., Broek, D. (2004) Sphingosine kinase protects lipopolysaccharide-activated macrophages from apoptosis. Mol. Cell. Biol. 24,7359-7369[Abstract/Free Full Text]
  33. Liu, H., Toman, R. E., Goparaju, S. K., Maceyka, M., Nava, V. E., Sankala, H., Payne, S. G., Bektas, M., Ishii, I., Chun, J., et al (2003) Sphingosine kinase type 2 is a putative BH3-only protein that induces apoptosis. J. Biol. Chem. 278,40330-40336[Abstract/Free Full Text]
  34. Igarashi, N., Okada, T., Hayashi, S., Fujita, T., Jahangeer, S., Nakamura, S. (2003) Sphingosine kinase 2 is a nuclear protein and inhibits DNA synthesis. J. Biol. Chem. 278,46832-46839[Abstract/Free Full Text]
  35. Mitra, P., Oskeritzian, C. A., Payne, S. G., Beaven, M. A., Milstien, S., Spiegel, S. (2006) Role of ABCC1 in export of sphingosine-1-phosphate from mast cells. Proc. Natl. Acad. Sci. U. S. A. 103,16394-16399[Abstract/Free Full Text]
  36. Yamanaka, M., Shegogue, D., Pei, H., Bu, S., Bielawska, A., Bielawski, J., Pettus, B., Hannun, Y. A., Obeid, L., Trojanowska, M. (2004) Sphingosine kinase 1 (SPHK1) is induced by transforming growth factor-beta and mediates TIMP-1 up-regulation. J. Biol. Chem. 279,53994-54001[Abstract/Free Full Text]
  37. Hobson, J. P., Rosenfeldt, H. M., Barak, L. S., Olivera, A., Poulton, S., Caron, M. G., Milstien, S., Spiegel, S. (2001) Role of the sphingosine-1-phosphate receptor EDG-1 in PDGF-induced cell motility. Science 291,1800-1803[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
C. K. Means, S. Miyamoto, J. Chun, and J. H. Brown
S1P1 Receptor Localization Confers Selectivity for Gi-mediated cAMP and Contractile Responses
J. Biol. Chem., May 2, 2008; 283(18): 11954 - 11963.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-6889comv1
21/9/2005    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Serriere-Lanneau, V.
Right arrow Articles by Lotersztajn, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Serriere-Lanneau, V.
Right arrow Articles by Lotersztajn, S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS