|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,1

* Departments of Biochemistry and
Internal Medicine, American University of Beirut, Beirut, Lebanon; and
INSERM U749, Faculté de Pharmacie, Chatenay Malabray, France
1Correspondence: Department of Biochemistry, American University of Beirut, P.O. Box 11236 Beirut, Lebanon. E-mail: ah31{at}aub.edu.lb
| ABSTRACT |
|---|
|
|
|---|
B-p65 transcription factor assay showed that simvastatin and NSC 23766 decrease significantly NF-
B complex formation. In macrophages, the antiinflammatory effects of statins are mediated in part through the inhibition of COX-2 and prostanoids. Rac GTPase protein is identified as one of the targets of statins in this regulation.Habib, A., Shamseddeen, I., Nasrallah, M. S., Antoun, T. A., Nemer, G., Bertoglio, J. Badreddine, R., Badr, K. F. Modulation of COX-2 expression by statins in human monocytic cells.
Key Words: inflammation prenylation prostaglandin Rac GTPase NF-
B
| INTRODUCTION |
|---|
|
|
|---|
Atherosclerosis is an inflammatory disease of vessels in which activation of many proinflammatory groups of proteins plays a central role. Cyclooxygenases and prostanoids play an important role in this process (3)
. Prostacyclin is important in vascular protection. Basal production of this prostaglandin, along with NO, is important in preventing platelet aggregation, and in the maintenance of vascular homeostasis (7)
. COX-2 has been described in atherosclerotic plaques and is localized mainly in macrophages, and to a lesser extent in smooth muscle cells. Recent studies have suggested that vascular COX-2 contributes to the antiatherogenic and antithrombotic effects, mainly via prostacyclin production and its binding to its receptor (8
9
10)
, whereas the macrophages present in the atherosclerotic plaques are predominantly involved in the production of PGE2 and the prothrombotic TXA2 (11)
.
Statins are selective competitive inhibitors of HMG CoA reductases, the rate- limiting enzyme in the synthesis of cholesterol and are used in the treatment of hypercholesterolemia (12)
. Recently, statins were described to have effects other than lowering cholesterol (13
, 14)
. These effects were commonly beneficial as antioxidant, antiinflammatory, antithrombotic, or antiatherogenic, and were mainly attributed to the inhibition of isoprene synthesis (14
15
16)
. We have shown previously that statins increase COX-2 expression in human aortic smooth muscle cells (20)
. This increase was associated with increased prostacyclin production and involved the inhibition of RhoA (17)
. In the present study, we addressed the effect of simvastatin and mevastatin on PGE2 synthesis and COX-2 expression in a human monocytic cell line, U937, a well-established model of human macrophages, and investigated the mechanisms involved. We demonstrate that both statins inhibited significantly PGE2 synthesis and COX-2 expression, and that Rac GTPase and NF-
B inhibition, rather than RhoA/C, are involved in this inhibitory effect.
| MATERIALS AND METHODS |
|---|
|
|
|---|
-32P-dCTP (6000 Ci/mmol), and
-32P- ATP (4500 Ci/mmol) were from MP Biomedicals (Costa Mesa, CA, USA). Phorbol myristate acetate (PMA), BSA, monoclonal anti-ß-actin antibody, and LPS were from Sigma Aldrich (St. Louis, MO, USA). Enhanced chemiluminescense (ECL), a ready-to-go kit for DNA labeling, T4 kinase and poly (dI/dC) were from General Electric (Piscataway, NJ, USA). RNA isolation reagent Tripure® was from Roche (Indianapolis, IN, USA). Donkey anti-mouse IgG conjugated to horse radish peroxidase was from Jackson Immunolaboratories (West Grove, PA, USA). A colorimetric Transcription Factor assay for p65 NF
B was from Chemicon (Millipore, Billerica, MA, USA). Rac 2 activation kit (cat # 17369) and Rac 1 antibody (cat # 05389) were from Upstate Biotechnology Inc. (Lake Placid, NY, USA). P65, p50 and RhoA (26C4) antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Glutathione S-transferase (GST)-cytotoxic necrotizing factor-1 (CNF-1) and TAT- C3 exoenzyme were prepared as described earlier (18
Cell culture
Human leukemia U937 cells were cultured in RPMI 1640 medium containing 25 mM HEPES buffer, 10% FBS, 50 U/ml streptomycin, and 50 µg/ml penicillin. In all experiments, cells were differentiated into a macrophage-like phenotype using 10 nM of Phorbol 12-myristate 13-acetate (PMA) for 3 d prior to treatment. Cells were seeded in 12-well plates at a density of 106 cells/ml for 72 h. Cellular toxicity of statins was tested by neutral inclusion and did not show any significant toxic effect (20)
.
Treatment of cells
PMA-differentiated cells were incubated in fresh media with 5 µg/ml of LPS (LPS 111:B24). In Preliminary experiments, LPS induced COX-2 with a plateau at 0.30.5 µg/ml (data not shown). Since most standard results were obtained at 15 µg/ml, cells were treated with 5 µg/ml unless otherwise indicated. Different concentrations of hydrolyzed mevastatin or simvastatin for were added on the cells for 24 h. Since similar results were obtained when treating the cells for 48 h with statins (data not shown), we treated cells with statins for 24 h. In some experiments, cells were pretreated with 100 µM of hydrolyzed mevalonate, 10 µM of squalene, 10 µM of farnesyl pyrophosphate (FPP), or 10 µM of geranylgeranyl pyrophosphate (GGPP) prior to the addition of LPS and statins. At the end of the incubation period, supernatant were collected for prostaglandin E2 measurement. In some experiments, TXB2 was measured as described below. Cells were then lysed on ice in 150 µl of lysis buffer (20 mM Tris/HCl pH 8, containing 1 mM EDTA, 1% Triton 100, and 0.5 mM phenylmethyl sulfonyl fluoride. Protein content was determined using Bradford protein assay with BSA as standard.
Western blotting
Total cell protein (20 µg) was subjected to 8% SDS-PAGE. The proteins were then transferred to supported nitrocellulose. Immunoblot analysis of COX-2 and COX-1 was done as described previously using 1/2000 of the monoclonal antibody (mAb) COX-229 for COX-2 protein and COX-111 for COX-1 (1/2000) (21
, 22)
. Signals were developed by Enhanced chemiluminescence (ECL) according to the manufacturer instructions.
Measurement of prostaglandin E2, TXB2, and 6-keto-PGF1a
PGE2 or TXB2 were determined in the supernatants of cell cultures using enzyme immunoassay (EIA) with acetylcholinesterase-labeled PGE2, TXB2, or 6-keto-PGF1
as tracers (23)
. The concentrations were expressed in ng/ml for 106 cells and fold increase over untreated cells, which was attributed a value of 1, were calculated.
RNA extraction and Northern blot analysis
Northern blot analysis of COX-2 was done as described previously with minor changes. Briefly, 6 x 106 cells in 60 mm dishes were incubated in the absence or presence of LPS and 50 µM of the Rac inhibitor NSC 23766 for 15 h. Cells were harvested in 0.5 ml of Tripure® and extracted according to the manufacturers instructions. Northern blot analysis was performed using 10 µg of total RNA. The cDNA probes used were a 2.1 kb human COX-2 cDNA fragment (a gift from Dr. Stephen Prescott, University of Utah, USA) (24)
and ß-actin cDNA fragment (BD, Clontech Laboratories Inc., Palo Alto, CA, USA). Membranes were first hybridized with the COX-2 probe (106 cpm/ml). For ß-actin detection, membranes were hybridized with 0.5 x 106 cpm/ml. Signals were quantified using a Storm imager (General Electric) and the ratio of COX-2/ß-actin was determined.
Rac activation assay (25)![]()
We used the Rac 2 activation and the antibody of anti -Rac 1 kit from Upstate Biotech. U937 cells (20x106) were treated and lyzed according to the manufacturers instructions. Protein concentration determined. Pull-down assaying was performed using PAK-PBD, a protein that interacts specifically with activate GTP-Rac or GTP- cdc42. The supernatants (0.5 mg) were precleared and further incubated with 5 µg of agarose-GST-PAK-PBD (p21 binding protein) and incubated for 60 min at 4°C. After several washes, Laemmli buffer was added on the agarose beads and Western blot analysis of Rac 2 and Rac 1 was performed using the selective antibodies. In vitro negative and positive controls were done by incubating lysates from cells with either 100 µM of GTP
S for positive control or 1 mM of GDP for negative control prior to the addition of 5 µg of agarose-GST-PAK-PBD.
RhoA shift
U937 cells were treated with 25 and 50 µg/ml of C3TAT for 90 min and lyzed. Total protein concentration was determined as described previously. SDS-PAGE was performed using 15% special acrylamide gel (30:2 acrylamide/Bis acrylamide ratio) and RhoA. Immunoblot was performed using RhoA antibody (26C4 from Santa Cruz). The RhoA shift is a result of the ADP-ribosylation of RhoA by active C3 exoenzyme. A quality test is done on each new batch of C3 exoenzyme prepared in the laboratory of Dr. Bertoglio (INSERM U 749).
Electrophoretoic mobility shift assays (EMSA)
Gel retardation experiments were performed for the binding of NF-
B. Cells in 100 mm dishes were pretreated or not with simvastatin or the Rac inhibitor NSC 23766 prior to the addition of LPS for 1 h. Cells were harvested, and nuclear extracts were prepared according to standard protocols (26)
. For binding studies, an oligonucleotide for consensus NF-
B was used (5'AGTTGAGGGGACTTTCCCAGG 3'). The complementary strands were annealed in 10 mM Tris/HCl, pH 8 containing 400 mM NaCl and 1 mM EDTA. The annealed strands were phosphorylated at the 5'-end with
-32P ATP (4500 Ci/mmol) and T4 polynucleotide kinase (General Electric) and allowed to migrate on polyacrylamide gel. Radioactive double-stranded DNA was extracted from gel. The binding reaction was performed by incubating 5 µg of nuclear protein with the labeled probe in (50 mM Tris-HCl, pH 7.5, 250 mM NaCl, 2.5 mM EDTA, 20% glycerol, 2.5 mM DTT, and 1 µg of poly(dI/dC) in a final vol of 20 µl for 20 min at 25°C. Cold chase was performed with an excess of unlabeled DNA complex of NF-
B or unrelated DNA complex consisting of cAMP response element (CRE). In supershift experiments, nuclear extract was incubated for 20 min on ice in the presence of 2 µg of rabbit antip50 NF
B antibody or goat antip65 NF
B antibody, prior to the addition of the labeled DNA complex. IgG from rabbit or goat was used as control to rule out any nonspecific effect of the antibodies. The samples were submitted to electrophoresis on a 4% nondenaturing polyacrylamide gel. The gel was then dried, and radioactive signals were detected using Storm phosphoimager (General Electrics).
p-65 NF-
B transcription factor ELISA assay
Nonradioactive NF-
B for p65 transcription factor assay (Chemicon, cat # SGT520) in 96-well microplate was used according to the manufacturers instructions. Briefly, U937 cells (20x106 cells) were treated and nuclear extracts were prepared according to the kit. Protein concentration in the nuclear extracts was determined by the Bradford method using BSA as standard. Protein concentrations were adjusted to 2.5 mg/ml, and 12.5 µg of protein was used for each incubation sample. Nuclear extracts were incubated with the capture NF-
B probe in an enhanced transcription factor assay buffer. Competition was done by adding an excess of a NF-
B competitor. Positive control corresponded to TNF-
-treated Hela cells, and gave strong NF-
B binding. Negative control corresponds to the binding of nuclear extract in the presence of an unrelated oligonucleotide. After a 2 h incubation at room temperature, the complex was detected using a rabbit p65-antibody and an anti-rabbit coupled to horseradish peroxidase. The TMB/E substrate was added and the absorption measured at 450 nm after the addition of the Stop solution. Results were expressed as optical density (OD) at 450 nm.
Data analyses
Autoradiograms obtained after Western blot analyses were scanned using an Epson 1680 pro scanner and densitometric analysis was performed using Sigma Gel® software [statistical Packages for the Social Sciences (SPSS), Chicago, IL]. Statistics analysis was performed using t-test using Sigma Stat® software.
| RESULTS |
|---|
|
|
|---|
(0.01 ng/ml for untreated cells and 0.8 ng/ml for LPS-treated cells). This amount represented 510% of the amount of PGE2 we generally measure under the same conditions. Moreover, the EIA assay for 6-keto-PGF1a showed a cross-reactivity of
5%, suggesting that a part of the detected 6-keto-PGF1
be PGE2, mainly in LPS-treated cells.
|
Effect of mevalonate and isoprenoid intermediates on the inhibition COX-2 expression by statins
To determine whether the effect of statins on COX-2 induction by LPS was due to a direct effect of the drug on HMG CoA reductase, we tested the effect of mevalonate, the direct product of HMG CoA reductase. We incubated cells with 5 µg/ml LPS in the presence or absence of 25 µM simvastatin and/or 100 µM mevalonate. The addition of mevalonate overcame the inhibitory effect of simvastatin on COX-2 expression in the presence of LPS) (Fig. 2
A, C). The inhibitory effect of statins was not modified after treatment of the cells with 10 µM squalene, the late metabolite of the cholesterol synthesis pathway (Fig. 2A
). The implication of the deprivation of isoprenoid compounds in the inhibitory effect of statins on COX-2 was further studied by testing the effect of farnesyl pyrophosphate (FPP) or geranylgeranylpyrophosphate (GGPP). As shown in Fig. 2B
and C, both 10 µM of FPP or 10µM of GGPP significantly overcame the effect of statins.
|
Effects of isoprenyltransferases inhibition on LPS-dependent COX-2 expression
Cotreatment of the cells with 10 µM of GGTI-286, a selective inhibitor of geranylgeranyl transferases, resulted in a statistically significant reduction of 29% in PGE2 formation (19±1.7 compared to 13.5±1.5 of fold increase of control, Mean±SE, n=3, P<0.003, paired t test, for LPS and LPS + GGTI-286 treated cells, respectively). LPS-dependent induction of COX-2 was also inhibited as shown in Fig. 3
. Densitometric analysis COX-2 showed a significant inhibition of COX-2 expression by 3 and 10 µM of GGTI-286 (Fig. 3)
. However, the effect of 10 µM of FTI-277, a selective inhibitor of farnesyl-transferases, did not significantly modify COX-2 expression (Fig. 3
, bottom panel) or PGE2 synthesis (18.9 compared to 18.8-fold increase of control cells, for LPS and LPS+FTI-277, respectively, mean, n=2).
|
Effect of Rho GTPases on prostaglandin E2 formation and COX-2 expression
Since some of the Rho GTPase family members are geranylgeranylated proteins that play a role in the regulation of protein expression and since GGTI-286 showed a significant effect on LPS-dependent induction of COX-2, we investigated whether Rho proteins affect COX-2 expression. When cells were incubated in the absence or presence of 1 µg/ml of Escherichia coli cytotoxic necrotizing factor-1 (CNF-1), a selective activator of members of the Rho GTP ase proteins for 6 h, an increase of COX-2 was detected (Fig. 4
A). We next used C3 exoenzyme, a selective inhibitor of geranylgeranylated Rho A/C. Treatment of cells for 6 h with 25 µg/ml of (data not shown) or 24 h with 5 µg/ml (Fig. 4A
) did not modify COX-2 expression. We tested that RhoA was inhibited using the RhoA shift assay, which reflects ADP-ribosylation of Rho A by the C3 exoenzyme. Figure 4B
shows a shift in the mobility of RhoA by C3 exoenzyme, which supports the inhibition of RhoA. Next, we analyzed the effect of Rac on COX-2 expression using an inhibitor for Rac 1 and 2, NSC 23766 (27)
. It has been demonstrated that U937 cells express mainly Rac 2 (28)
. Treatment of cells with 50 and 100 µM NSC 23766 significantly inhibited COX-2 protein expression (33% and 44% inhibition of LPS-induced COX-2 protein for 50 and 100 µM of NSC 23766, respectively) (Fig. 4C
). PGE2 formation was also measured and showed a marked reduction of PGE2 with 50 µM NSC 23766 (13.99±1.37-fold increase of control compared with 7.47±1.45, mean±SE, n=4, P<0.02, t test, for LPS and LPS+50 µM NSC23766, respectively). To find out whether Rac 2 activation was blocked when cells were treated with NSC 23766, we assessed the capacity of active Rac 2 to interact specifically with PBD (p21 binding protein). We tested the effect of the NSC 23766 on this interaction. Pull-down assays were performed using a Rac 2 activation kit (Upstate Biotechnology). As shown in Fig. 4D
, LPS (0.5 and 5 µg/ml) showed a significant interaction of Rac 2 with GST-PBD, which was further reduced with 50 µM of NSC 23766. Rac 1 did not show any interaction in response to LPS, or after treatment of the sample with excess of GTP
S supporting previous reports on the presence of only Rac 2 in U937 cells (28 93).
|
Effect of Rac inhibitor NSC 23766 on COX-2 mRNA
Northern blot analysis was performed and demonstrated a modulation of COX-2 mRNA by Rac inhibition. Northern blot analysis of COX-2 mRNA was performed with 50 µM of NSC 23766 in the presence or absence of LPS. Cells were cotreated for 15 h with NSC 23766 and 5 µg/ml LPS. Incubation of cells with LPS resulted in a 11.5 ± 1.5-fold increase in the level of COX-2 mRNA in LPS-treated cells compared with untreated cells (mean±SE, n=3). When cells where cotreated with LPS and NSC 23766, COX-2 mRNA increase was only 6.6 ± 0.7-fold compared with control, support a statistically significant inhibition (43%, P<0.05, t test) (Fig. 5
).
|
Effect of simvastatin and Rac inhibition on NF-
B binding
Finally we analyzed the potential transcription factor that might be involved by assessing the in vitro binding of NF-
B. NF-
B was shown to play an important role in LPS-dependent induction of COX-2 (29)
. We first performed EMSA. As shown in Fig. 6
A, LPS induced nuclear protein-DNA complexes with a probe containing the NF-
B binding sequence compared to control. This complex was competed with a 20x excess of cold NF-
B but not with an excess of the double-stranded oligonucleotides containing CRE. When cells were pretreated with 25 µM of simvastatin for 12 h or 50 µM of NSC 23766, LPS-dependent complex was significantly reduced (Fig. 6A
). The LPS-dependent protein-DNA complex was supershifted with both antibodies specific to the p50 or p65 subunits of NF-
B (Fig. 6B
). Furthermore, we evaluated the inhibition of NFkB binding by testing a colorimetric NFkB-p65 transcription factor assay (Chemicon) that allowed us to detect in a sensitive manner the interaction of p65- with the DNA complex. Treatment of cells with LPS alone resulted in an increase in the complex formation illustrated by an increase in the OD of the complex biotinylated DNA-p65-antip65 and anti-IgG-HRP. Treatment of the cells with simvastatin or NSC 23766 blocked significantly the formation of the NF
B-DNA complex (Fig. 6C
).
|
| DISCUSSION |
|---|
|
|
|---|
COX-1 and COX-2 were recently described to play an important role in the development of atherosclerosis (30)
. Its regulation will affect the formation of the different prostanoids and their related signaling. The important prostanoids important in vascular biology are PGE2, prostacyclin, and thromboxane A2. Recent studies using prostacylin receptor knockout mice (31)
highlighted the crucial role of this prostaglandin and its receptors as the antiatherogenic and in the maintenance of vascular homeostasis. Low concentrations of PGE2 inhibit cAMP generation in platelets and favor platelet aggregation (32)
, whereas high concentrations of PGE2 exerts antithrombotic and antiatherogenic effects (33
, 34
). Very recently, the group of FitzGerald showed that deletion of microsomal prostaglandin E synthase-1 does not affect thromboxane biosynthesis, thrombogenesis, or blood pressure in vivo (35)
. Moreover, thromboxane receptor antagonists retard atherogenesis in ApoE-deficient mice (36)
. Recently Kinsella and colleagues have shown that human and mouse prostacyclin receptors are farnesylated (37)
. They demonstrated that selective inhibitors of farnesyltransferases impair isoprenylation and signaling of these receptors (38
, 39)
. However, in vivo clinical data performed by the same group on blood platelets of healthy donors showed no modification of the platelet prostacyclin receptor signaling after atorvastatin administration (40)
. Nevertheless, the in vivo effect of statin on the vascular prostacyclin receptor-dependent signaling needs further investigation using farneyl transferase inhibitors selectively. This observation could imply important side effects of statins on the pharmacology of the prostacyclin receptor.
In the present study, we showed that statins block COX-2 in monocytes in a Rac and NF-
B dependent manner, whereas Rho-inhibition was responsible for the increase of COX-2 in human aortic smooth muscle cells (17)
. The fact that TAT-C3 exoenzyme did not result in similar effects on U937 and in human vascular cells (17)
may be related to differential expression or activation of the Rho family members and the regulatory exchanger and inhibitory proteins for these small G-proteins between the different cells types, e.g., high Rac2 expression in the hemopoietic-derived U937. We verified that the RhoA selective blocker, C3 exoenzyme, was active in U937 cells (Fig. 4B
). It has been recently shown that CNF-1 activates RhoA/C transiently with a maximal effect at 2 h prior to its degradation (19)
, probably via a proteasome-dependent mechanism (41)
, whereas Rac and cdc42 remain activated for a much longer period. Therefore, the effect of CNF-1 on COX-2 in U937 cells could be mainly attributed to Rac activation rather than Rho A/C. This possible pathway was further supported by the results of the selective inhibitor of Rac, NSC 23766, which we described to block the Rac2 association with PDB protein, supporting a specific effect of NSC 23766 on Rac 2 in our model (Fig. 4D
). Barbieri et al. showed recently that COX-2 is up-regulated during PMA and that differentiation of U937 cells is blocked by fluvastatin in a Rac-dependent manner (42)
. We and other investigators (43
44
45)
were unable to detect significant basal expression of COX-2 in PMA-differentiated U937 cells. However, in a mouse macrophage cell line, Chen et al. showed that lovastatin, fluvastatin, and atorvastatin but not pravastatin increased COX-2 in a murine macrophage cell Raw 264.7 in a Ras-dependent manner (46)
. In this cell line, Waldeigh et al. showed a different effect of Ras where COX-2 expression by LPS was not dependent on Ras (47)
. Moreover, Ongini et al. showed recently that NCS-6550, a particular NO-releasing pravastatin led to an inhibition of COX-2 expression in the same cells (48)
. Our results do not exclude a role for cdc42 in this regulation and diverge from the one described by the group of J. Egido showing, in another monocytic cell line, THP-1, that atorvastatin blocks IL-1 + TNF-
-dependent induction of COX-2 regulation in a Rho Adependent manner (49)
and that COX-2 increases in monocytes/macrophages within the atherosclerotic plaques are associated with an activation of NF-
B (50)
. These discrepancies might result from differences in cell type, (THP-1 vs. U937) and its content in Rho proteins as clarified earlier, the COX-2 activator, (IL-1+TNF-
vs. LPS), or the type of statin, (atorvastatin vs. simvastatin). It has been shown that statins decrease COX-2 expression in macrophages present in atherosclerotic lesions (50
, 51)
.
A potential beneficial effect on the progress of the atherosclerotic plaque could be a combined effect of statins or prenyltransferase inhibitors and NSAIDS or any inhibitors of the prostaglandin E2 synthases. The in vivo role of such treatments on the levels of macrophage and blood platelet PGE2 and TX and in contrary the increase in prostacyclin synthesis for the statin-inhibitor of PGE2 synthase combination could be investigate in animal models of carotid injury.
In summary, we have shown that COX-2 expression is blocked partially by statins and involves Rac and NF-
B activation. These data stress the beneficial, antiinflammatory effect of statin on NF-
B and the proinflammatory COX-2 in macrophage cell lines. The effect we described was obtained at high concentrations of simvastatin corresponding to 2050 times the therapeutic doses. It seems these concentrations are essential for the inhibition of isoprenylation of proteins in cultured cells (52
53
54
55)
. Evidence from in vitro and more recently in vivo data in animals showed antiinflammatory and antiatherogenic effects (56
, 57)
. The effect of some statins was described on COX-2 in animal models (49
, 51)
and in human subjects (58
, 59)
. Further investigations are needed to assess the contribution of vascular vs. macrophage COX-2 expression within atherosclerotic lesions and test the effective of selective Rho or Rac inhibitors.
| ACKNOWLEDGMENTS |
|---|
Received for publication August 1, 2006. Accepted for publication January 4, 2007.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Saratzis, G. D. Kitas, N. Saratzis, and N. Melas Can Statins Suppress the Development of Abdominal Aortic Aneurysms? A Review of the Current Evidence Angiology, February 1, 2010; 61(2): 137 - 144. [Abstract] [PDF] |
||||
![]() |
M. Massaro, A. Zampolli, E. Scoditti, M. A. Carluccio, C. Storelli, A. Distante, and R. De Caterina Statins inhibit cyclooxygenase-2 and matrix metalloproteinase-9 in human endothelial cells: anti-angiogenic actions possibly contributing to plaque stability Cardiovasc Res, December 30, 2009; (2009) cvp375v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Montecucco, F. Burger, G. Pelli, N. K. Poku, C. Berlier, S. Steffens, and F. Mach Statins inhibit C-reactive protein-induced chemokine secretion, ICAM-1 upregulation and chemotaxis in adherent human monocytes Rheumatology, March 1, 2009; 48(3): 233 - 242. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |