FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.06-6766com.
(The FASEB Journal. 2007;21:1665-1674.)
© 2007 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-6766comv1
21/8/1665    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Habib, A.
Right arrow Articles by Badr, K. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Habib, A.
Right arrow Articles by Badr, K. F.

Modulation of COX-2 expression by statins in human monocytic cells

Aïda Habib*,{dagger},1, Ishraq Shamseddeen*, Mona S. Nasrallah*, Tania Abi Antoun*, Georges Nemer*, Jacques Bertoglio{ddagger}, Rami Badreddine* and Kamal F. Badr{dagger}

* Departments of Biochemistry and

{dagger} Internal Medicine, American University of Beirut, Beirut, Lebanon; and

{ddagger} INSERM U749, Faculté de Pharmacie, Chatenay Malabray, France

1Correspondence: Department of Biochemistry, American University of Beirut, P.O. Box 11–236 Beirut, Lebanon. E-mail: ah31{at}aub.edu.lb


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Macrophage cyclooxygenase-2 (COX-2) plays an important role in prostaglandin E2 and thromboxane A2 production. Statins are inhibitors of HMG CoA (3-Hydroxy-3-methylglutaryl coenzyme A) reductases and cholesterol synthesis, which block the expression of several inflammatory proteins independent of their capacity to lower endogenous cholesterol. In the present study, we investigated the effect of simvastatin and mevastatin on COX-2 induction in human monocytic cell line U937 and analyzed the underlying mechanisms. Pretreatment of U937 cells with simvastatin or mevastatin for 24 h resulted in a significant reduction in the lipopolysaccharide (LPS)-dependent induction of prostaglandin E2, thromboxane A2 synthesis, and COX-2 expression. Mevalonate, the direct metabolite of HMG CoA reductase, and farnesyl pyrophosphate and geranylgeranyl-pyrophosphate, intermediates of the mevalonate pathway, significantly reversed the inhibitory effect of statins on COX-2. An inhibitor of geranylgeranyl transferases, GGTI-286 mimicked the effect of statins on COX-2 expression. Cytonecrotic factor-1 increased LPS-dependent expression of COX-2. Treatment of cells with NSC 23766, an inhibitor of Rac, which we demonstrated to block Rac 2 activation, resulted in an inhibition of the LPS-dependent expression of COX-2. Whereas no effect was obtained with RhoA/C blocker, C3 exoenzyme. Gel retardation experiments and NF{kappa}B-p65 transcription factor assay showed that simvastatin and NSC 23766 decrease significantly NF-{kappa}B complex formation. In macrophages, the antiinflammatory effects of statins are mediated in part through the inhibition of COX-2 and prostanoids. Rac GTPase protein is identified as one of the targets of statins in this regulation.—Habib, A., Shamseddeen, I., Nasrallah, M. S., Antoun, T. A., Nemer, G., Bertoglio, J. Badreddine, R., Badr, K. F. Modulation of COX-2 expression by statins in human monocytic cells.


Key Words: inflammation • prenylation • prostaglandin • Rac GTPase • NF-{kappa}B


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
CYCLOOXYGENASES (COX) ARE INVOLVED in the metabolism of arachidonic acid into prostaglandin (PG) and thromboxane (TX). COXs exist as two major isoforms, constitutive COX-1 and an inducible COX-2 isoform responsible for the synthesis of high amounts of prostanoids (1 2 3) . In monocyte/ macrophages, the major metabolites are PGE2 and TXA2, which are mainly formed by COX-2 (4) . It is well established that PGE2 modulates the classical signs of inflammation, hyperthermia, and pain. COX-2 is highly expressed in inflamed tissues and biological fluids, such as joints and synovial fluids of patients with arthritis (5 , 6) .

Atherosclerosis is an inflammatory disease of vessels in which activation of many proinflammatory groups of proteins plays a central role. Cyclooxygenases and prostanoids play an important role in this process (3) . Prostacyclin is important in vascular protection. Basal production of this prostaglandin, along with NO, is important in preventing platelet aggregation, and in the maintenance of vascular homeostasis (7) . COX-2 has been described in atherosclerotic plaques and is localized mainly in macrophages, and to a lesser extent in smooth muscle cells. Recent studies have suggested that vascular COX-2 contributes to the antiatherogenic and antithrombotic effects, mainly via prostacyclin production and its binding to its receptor (8 9 10) , whereas the macrophages present in the atherosclerotic plaques are predominantly involved in the production of PGE2 and the prothrombotic TXA2 (11) .

Statins are selective competitive inhibitors of HMG CoA reductases, the rate- limiting enzyme in the synthesis of cholesterol and are used in the treatment of hypercholesterolemia (12) . Recently, statins were described to have effects other than lowering cholesterol (13 , 14) . These effects were commonly beneficial as antioxidant, antiinflammatory, antithrombotic, or antiatherogenic, and were mainly attributed to the inhibition of isoprene synthesis (14 15 16) . We have shown previously that statins increase COX-2 expression in human aortic smooth muscle cells (20) . This increase was associated with increased prostacyclin production and involved the inhibition of RhoA (17) . In the present study, we addressed the effect of simvastatin and mevastatin on PGE2 synthesis and COX-2 expression in a human monocytic cell line, U937, a well-established model of human macrophages, and investigated the mechanisms involved. We demonstrate that both statins inhibited significantly PGE2 synthesis and COX-2 expression, and that Rac GTPase and NF-{kappa}B inhibition, rather than RhoA/C, are involved in this inhibitory effect.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Material
U937 cells were obtained from American Type Culture Collection (ATCC; Manassas, VA, USA). Cell culture media and reagents, FBS, were from Invitrogen (Carlsbad, CA, USA). Chemicals for electrophoresis, supported nitrocellulose and Bradford reagent were purchased from Bio-Rad Laboratories (Hercules, CA USA). Hydrolyzed simvastatin and mevastatin, pravastatin, FTI-277, GGTI 286, and NSC 23766 inhibitor were from EMD Calbiochem (San Diego, CA, USA). Mevalonic acid, geranylgeranyl pyrophosphate, farnesyl pyrophosphate, squalene, {alpha}-32P-dCTP (6000 Ci/mmol), and {gamma}-32P- ATP (4500 Ci/mmol) were from MP Biomedicals (Costa Mesa, CA, USA). Phorbol myristate acetate (PMA), BSA, monoclonal anti-ß-actin antibody, and LPS were from Sigma Aldrich (St. Louis, MO, USA). Enhanced chemiluminescense (ECL), a ready-to-go kit for DNA labeling, T4 kinase and poly (dI/dC) were from General Electric (Piscataway, NJ, USA). RNA isolation reagent Tripure® was from Roche (Indianapolis, IN, USA). Donkey anti-mouse IgG conjugated to horse radish peroxidase was from Jackson Immunolaboratories (West Grove, PA, USA). A colorimetric Transcription Factor assay for p65 NF{kappa}B was from Chemicon (Millipore, Billerica, MA, USA). Rac 2 activation kit (cat # 17–369) and Rac 1 antibody (cat # 05–389) were from Upstate Biotechnology Inc. (Lake Placid, NY, USA). P65, p50 and RhoA (26C4) antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Glutathione S-transferase (GST)-cytotoxic necrotizing factor-1 (CNF-1) and TAT- C3 exoenzyme were prepared as described earlier (18 , 19) .

Cell culture
Human leukemia U937 cells were cultured in RPMI 1640 medium containing 25 mM HEPES buffer, 10% FBS, 50 U/ml streptomycin, and 50 µg/ml penicillin. In all experiments, cells were differentiated into a macrophage-like phenotype using 10 nM of Phorbol 12-myristate 13-acetate (PMA) for 3 d prior to treatment. Cells were seeded in 12-well plates at a density of 106 cells/ml for 72 h. Cellular toxicity of statins was tested by neutral inclusion and did not show any significant toxic effect (20) .

Treatment of cells
PMA-differentiated cells were incubated in fresh media with 5 µg/ml of LPS (LPS 111:B24). In Preliminary experiments, LPS induced COX-2 with a plateau at 0.3–0.5 µg/ml (data not shown). Since most standard results were obtained at 1–5 µg/ml, cells were treated with 5 µg/ml unless otherwise indicated. Different concentrations of hydrolyzed mevastatin or simvastatin for were added on the cells for 24 h. Since similar results were obtained when treating the cells for 48 h with statins (data not shown), we treated cells with statins for 24 h. In some experiments, cells were pretreated with 100 µM of hydrolyzed mevalonate, 10 µM of squalene, 10 µM of farnesyl pyrophosphate (FPP), or 10 µM of geranylgeranyl pyrophosphate (GGPP) prior to the addition of LPS and statins. At the end of the incubation period, supernatant were collected for prostaglandin E2 measurement. In some experiments, TXB2 was measured as described below. Cells were then lysed on ice in 150 µl of lysis buffer (20 mM Tris/HCl pH 8, containing 1 mM EDTA, 1% Triton 100, and 0.5 mM phenylmethyl sulfonyl fluoride. Protein content was determined using Bradford protein assay with BSA as standard.

Western blotting
Total cell protein (20 µg) was subjected to 8% SDS-PAGE. The proteins were then transferred to supported nitrocellulose. Immunoblot analysis of COX-2 and COX-1 was done as described previously using 1/2000 of the monoclonal antibody (mAb) COX-2–29 for COX-2 protein and COX-1–11 for COX-1 (1/2000) (21 , 22) . Signals were developed by Enhanced chemiluminescence (ECL) according to the manufacturer instructions.

Measurement of prostaglandin E2, TXB2, and 6-keto-PGF1a
PGE2 or TXB2 were determined in the supernatants of cell cultures using enzyme immunoassay (EIA) with acetylcholinesterase-labeled PGE2, TXB2, or 6-keto-PGF1{alpha} as tracers (23) . The concentrations were expressed in ng/ml for 106 cells and fold increase over untreated cells, which was attributed a value of 1, were calculated.

RNA extraction and Northern blot analysis
Northern blot analysis of COX-2 was done as described previously with minor changes. Briefly, 6 x 106 cells in 60 mm dishes were incubated in the absence or presence of LPS and 50 µM of the Rac inhibitor NSC 23766 for 15 h. Cells were harvested in 0.5 ml of Tripure® and extracted according to the manufacturer’s instructions. Northern blot analysis was performed using 10 µg of total RNA. The cDNA probes used were a 2.1 kb human COX-2 cDNA fragment (a gift from Dr. Stephen Prescott, University of Utah, USA) (24) and ß-actin cDNA fragment (BD, Clontech Laboratories Inc., Palo Alto, CA, USA). Membranes were first hybridized with the COX-2 probe (106 cpm/ml). For ß-actin detection, membranes were hybridized with 0.5 x 106 cpm/ml. Signals were quantified using a Storm imager (General Electric) and the ratio of COX-2/ß-actin was determined.

Rac activation assay (25)
We used the Rac 2 activation and the antibody of anti -Rac 1 kit from Upstate Biotech. U937 cells (20x106) were treated and lyzed according to the manufacturer’s instructions. Protein concentration determined. Pull-down assaying was performed using PAK-PBD, a protein that interacts specifically with activate GTP-Rac or GTP- cdc42. The supernatants (0.5 mg) were precleared and further incubated with 5 µg of agarose-GST-PAK-PBD (p21 binding protein) and incubated for 60 min at 4°C. After several washes, Laemmli buffer was added on the agarose beads and Western blot analysis of Rac 2 and Rac 1 was performed using the selective antibodies. In vitro negative and positive controls were done by incubating lysates from cells with either 100 µM of GTP{gamma}S for positive control or 1 mM of GDP for negative control prior to the addition of 5 µg of agarose-GST-PAK-PBD.

RhoA shift
U937 cells were treated with 25 and 50 µg/ml of C3TAT for 90 min and lyzed. Total protein concentration was determined as described previously. SDS-PAGE was performed using 15% special acrylamide gel (30:2 acrylamide/Bis acrylamide ratio) and RhoA. Immunoblot was performed using RhoA antibody (26C4 from Santa Cruz). The RhoA shift is a result of the ADP-ribosylation of RhoA by active C3 exoenzyme. A quality test is done on each new batch of C3 exoenzyme prepared in the laboratory of Dr. Bertoglio (INSERM U 749).

Electrophoretoic mobility shift assays (EMSA)
Gel retardation experiments were performed for the binding of NF-{kappa}B. Cells in 100 mm dishes were pretreated or not with simvastatin or the Rac inhibitor NSC 23766 prior to the addition of LPS for 1 h. Cells were harvested, and nuclear extracts were prepared according to standard protocols (26) . For binding studies, an oligonucleotide for consensus NF-{kappa}B was used (5'AGTTGAGGGGACTTTCCCAGG 3'). The complementary strands were annealed in 10 mM Tris/HCl, pH 8 containing 400 mM NaCl and 1 mM EDTA. The annealed strands were phosphorylated at the 5'-end with {gamma}-32P ATP (4500 Ci/mmol) and T4 polynucleotide kinase (General Electric) and allowed to migrate on polyacrylamide gel. Radioactive double-stranded DNA was extracted from gel. The binding reaction was performed by incubating 5 µg of nuclear protein with the labeled probe in (50 mM Tris-HCl, pH 7.5, 250 mM NaCl, 2.5 mM EDTA, 20% glycerol, 2.5 mM DTT, and 1 µg of poly(dI/dC) in a final vol of 20 µl for 20 min at 25°C. Cold chase was performed with an excess of unlabeled DNA complex of NF-{kappa}B or unrelated DNA complex consisting of cAMP response element (CRE). In supershift experiments, nuclear extract was incubated for 20 min on ice in the presence of 2 µg of rabbit antip50 NF{kappa}B antibody or goat antip65 NF{kappa}B antibody, prior to the addition of the labeled DNA complex. IgG from rabbit or goat was used as control to rule out any nonspecific effect of the antibodies. The samples were submitted to electrophoresis on a 4% nondenaturing polyacrylamide gel. The gel was then dried, and radioactive signals were detected using Storm phosphoimager (General Electrics).

p-65 NF-{kappa}B transcription factor ELISA assay
Nonradioactive NF-{kappa}B for p65 transcription factor assay (Chemicon, cat # SGT520) in 96-well microplate was used according to the manufacturer’s instructions. Briefly, U937 cells (20x106 cells) were treated and nuclear extracts were prepared according to the kit. Protein concentration in the nuclear extracts was determined by the Bradford method using BSA as standard. Protein concentrations were adjusted to 2.5 mg/ml, and 12.5 µg of protein was used for each incubation sample. Nuclear extracts were incubated with the capture NF-{kappa}B probe in an enhanced transcription factor assay buffer. Competition was done by adding an excess of a NF-{kappa}B competitor. Positive control corresponded to TNF-{alpha}-treated Hela cells, and gave strong NF-{kappa}B binding. Negative control corresponds to the binding of nuclear extract in the presence of an unrelated oligonucleotide. After a 2 h incubation at room temperature, the complex was detected using a rabbit p65-antibody and an anti-rabbit coupled to horseradish peroxidase. The TMB/E substrate was added and the absorption measured at 450 nm after the addition of the Stop solution. Results were expressed as optical density (OD) at 450 nm.

Data analyses
Autoradiograms obtained after Western blot analyses were scanned using an Epson 1680 pro scanner and densitometric analysis was performed using Sigma Gel® software [statistical Packages for the Social Sciences (SPSS), Chicago, IL]. Statistics analysis was performed using t-test using Sigma Stat® software.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Effects of statins on cyclooxygenase expression and prostaglandin release
LPS (5 µg/ml) induced COX-2 expression in PMA-differentiated U937 cells. A maximum induction was obtained at 0.3–0.5 µg/ml (data not shown). Exposure of these cells to 5 or 25 µM statins for 24 h in the presence of LPS led to a significant decrease of COX-2 expression. Simvastatin and mevastatin at 25 µM reduced COX-2 expression by 45.2 ± 2.4 (mean±SE, n=11; P<0.001, paired t test) and 34.8 ± 2.3% (n=4, mean±SE, P<0.03, paired t test), respectively (Fig. 1 A). Statins alone did not modify COX-2 expression (Fig. 1A ). No modification of COX-1 was observed by LPS alone as reported previously or after addition of mevastatin or simvastatin (Fig. 1B ). Exposure of U937 cells to LPS resulted in increased production of PGE2 and TXB2, the stable and nonenzymatic derivative of TXA2, over untreated cells of 14.3 ± 1- and 14.4 ± 2.3-fold increase (mean±SE, n=8 for PGE2, and n=6 for TXB2, P<0.001, paired t test). Simvastatin or mevastatin (25 µM) reduced PGE2 significantly by 35% (P<0.01, n=5, paired t test) and 34% (P<0.01, n=6, paired t test), respectively (Fig. 1C ). TXB2 was also reduced by 35% when cells where pretreated with 25 µM simvastatin (P<0.01, n=6, paired t test). In LPS-treated cells, we could detect very low amounts of prostacyclin, as measured by EIA, and its stable metabolite of 6-keto-PGF1{alpha} (0.01 ng/ml for untreated cells and 0.8 ng/ml for LPS-treated cells). This amount represented 5–10% of the amount of PGE2 we generally measure under the same conditions. Moreover, the EIA assay for 6-keto-PGF1a showed a cross-reactivity of ~5%, suggesting that a part of the detected 6-keto-PGF1{alpha} be PGE2, mainly in LPS-treated cells.


Figure 1
View larger version (21K):
[in this window]
[in a new window]

 
Figure 1. Inhibition of LPS-dependent expression of COX-2 and PGE2 release by simvastatin and mevastatin. PMA-differentiated U937 cells in 12-well plates (106 cells/ml/well) were incubated in the presence or absence of 5 µg/ml LPS and 5 or 25 µM simvastatin or mevastatin for 24 h. After incubation, supernatants were collected and assayed for PGE2 by enzyme immunoassay and cells were lysed as described in Material and Methods. Basal refers to unstimulated cells. A) Western blot analysis of COX-2 and ß-actin. Results are similar for 11 experiments for simvastatin and 4 for mevastatin; (B) Western blot of COX-1. Results are similar for two experiments; (C) PGE2 synthesis was measured in the supernatants of cells. Results are reported as fold increase compared to untreated cells (mean±SE, n=8), paired t test was performed. An inhibition of 30 and 25% was described for simvastatin and mevastatin, respectively.

Effect of mevalonate and isoprenoid intermediates on the inhibition COX-2 expression by statins
To determine whether the effect of statins on COX-2 induction by LPS was due to a direct effect of the drug on HMG CoA reductase, we tested the effect of mevalonate, the direct product of HMG CoA reductase. We incubated cells with 5 µg/ml LPS in the presence or absence of 25 µM simvastatin and/or 100 µM mevalonate. The addition of mevalonate overcame the inhibitory effect of simvastatin on COX-2 expression in the presence of LPS) (Fig. 2 A, C). The inhibitory effect of statins was not modified after treatment of the cells with 10 µM squalene, the late metabolite of the cholesterol synthesis pathway (Fig. 2A ). The implication of the deprivation of isoprenoid compounds in the inhibitory effect of statins on COX-2 was further studied by testing the effect of farnesyl pyrophosphate (FPP) or geranylgeranylpyrophosphate (GGPP). As shown in Fig. 2B and C, both 10 µM of FPP or 10µM of GGPP significantly overcame the effect of statins.


Figure 2
View larger version (21K):
[in this window]
[in a new window]

 
Figure 2. Effect of mevalonate and isoprenoid intermediates on LPS-dependent COX-2 induction. A) U937 differentiated cells were cotreated for 24 h in the absence or presence of 5 µg/ml LPS, 25 µM simvastatin, 100 µM mevalonate, or 10 µM squalene. Western blot analysis of COX-2 and ß-actin was performed. Results are representative of 4 separate experiments for mevalonate and 2 for squalene. B) Cells were co-treated for 24 h with 5 µg/ml LPS, 25 µM simvastatin, 10 µM FPP, or 10 µM GGPP. Western blot analysis of COX-2 and ß-actin was performed. Results are representative of 3 experiments. C) Densitometric analysis of COX-2 protein. COX-2 and ß-actin protein bands were scanned, and results were calculated using Sigma Gel software. Statistical analyses were performed using paired t test ($P<0.009; *P<0.05; #P<0.03).

Effects of isoprenyltransferases inhibition on LPS-dependent COX-2 expression
Cotreatment of the cells with 10 µM of GGTI-286, a selective inhibitor of geranylgeranyl transferases, resulted in a statistically significant reduction of 29% in PGE2 formation (19±1.7 compared to 13.5±1.5 of fold increase of control, Mean±SE, n=3, P<0.003, paired t test, for LPS and LPS + GGTI-286 treated cells, respectively). LPS-dependent induction of COX-2 was also inhibited as shown in Fig. 3 . Densitometric analysis COX-2 showed a significant inhibition of COX-2 expression by 3 and 10 µM of GGTI-286 (Fig. 3) . However, the effect of 10 µM of FTI-277, a selective inhibitor of farnesyl-transferases, did not significantly modify COX-2 expression (Fig. 3 , bottom panel) or PGE2 synthesis (18.9 compared to 18.8-fold increase of control cells, for LPS and LPS+FTI-277, respectively, mean, n=2).


Figure 3
View larger version (22K):
[in this window]
[in a new window]

 
Figure 3. Effect of prenyltransferase inhibitors FTI-277 or GGTI-286 on LPS-dependent induction of COX-2. PMA-differentiated U937 cells were cotreated with 3 or 10 µM of FTI-277or GGTI-286 for 24 h in the presence or absence of 5 µg/ml of LPS. Western blot analysis of COX-2 and ß-actin was performed. Results are representative of 3 similar experiments for FTI-277 and 4 for GGTI-286. Statistical analyses were performed using unpaired t-test (*P<0.005).

Effect of Rho GTPases on prostaglandin E2 formation and COX-2 expression
Since some of the Rho GTPase family members are geranylgeranylated proteins that play a role in the regulation of protein expression and since GGTI-286 showed a significant effect on LPS-dependent induction of COX-2, we investigated whether Rho proteins affect COX-2 expression. When cells were incubated in the absence or presence of 1 µg/ml of Escherichia coli cytotoxic necrotizing factor-1 (CNF-1), a selective activator of members of the Rho GTP ase proteins for 6 h, an increase of COX-2 was detected (Fig. 4 A). We next used C3 exoenzyme, a selective inhibitor of geranylgeranylated Rho A/C. Treatment of cells for 6 h with 25 µg/ml of (data not shown) or 24 h with 5 µg/ml (Fig. 4A ) did not modify COX-2 expression. We tested that RhoA was inhibited using the RhoA shift assay, which reflects ADP-ribosylation of Rho A by the C3 exoenzyme. Figure 4B shows a shift in the mobility of RhoA by C3 exoenzyme, which supports the inhibition of RhoA. Next, we analyzed the effect of Rac on COX-2 expression using an inhibitor for Rac 1 and 2, NSC 23766 (27) . It has been demonstrated that U937 cells express mainly Rac 2 (28) . Treatment of cells with 50 and 100 µM NSC 23766 significantly inhibited COX-2 protein expression (33% and 44% inhibition of LPS-induced COX-2 protein for 50 and 100 µM of NSC 23766, respectively) (Fig. 4C ). PGE2 formation was also measured and showed a marked reduction of PGE2 with 50 µM NSC 23766 (13.99±1.37-fold increase of control compared with 7.47±1.45, mean±SE, n=4, P<0.02, t test, for LPS and LPS+50 µM NSC23766, respectively). To find out whether Rac 2 activation was blocked when cells were treated with NSC 23766, we assessed the capacity of active Rac 2 to interact specifically with PBD (p21 binding protein). We tested the effect of the NSC 23766 on this interaction. Pull-down assays were performed using a Rac 2 activation kit (Upstate Biotechnology). As shown in Fig. 4D , LPS (0.5 and 5 µg/ml) showed a significant interaction of Rac 2 with GST-PBD, which was further reduced with 50 µM of NSC 23766. Rac 1 did not show any interaction in response to LPS, or after treatment of the sample with excess of GTP{gamma}S supporting previous reports on the presence of only Rac 2 in U937 cells (28 93).


Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
Figure 4. Effect of modulators of Rho on LPS-dependent expression of COX-2. PMA-differentiated U937 cells were incubated in the absence or presence of (A) 1 µg/ml CNF-1 for 6 h or 5 µg/ml C3 exoenzyme-TAT for 24 h. B) Effect of C3-exoenzyme on the electrophoresis mobility due to ADP-ribosylation of RhoA. U937 cells were treated with 25 and 50 µg/ml of C3-exoenzyme for 90 min and lyzed. Electrophoresis was performed as described in Material and Methods, and immunoblot of RhoA was performed using selective antibody anti-RhoA. Mobility shift was detected and imply the inhibition of RhoA by C3-exoenzyme. C) 50 and 100 µM of Rac inhibitor NSC 23766 for 15 h. LPS 5 µg/ml was added concomitantly. Western blot analysis of COX-2 and ß-actin was performed. Results are representative of 3 experiments for C3-exoenzyme and CNF-1. Lower panel in (C) represents the densitometric analyses of COX-2 expression was evaluated from the ratio of COX-2 to ß-actin The results are expressed as mean ± SE for 4 experiments and analyzed by paired t test. D) Effect of NSC 23766 on Rac activation. The Rac 2 activation was performed in the absence or presence of NSC 23766 and LPS and was tested by the ability of activated Rac 2 to bind its substrate GST-PBD. Cells were treated in the absence or presence of 50 µM of NSC 23766 or 0.5 and 5 µg/ml of LPS for 15 h and Rac 2 activation was performed using a Rac 2 activation kit from Upstate Biotech Inc. LPS-treated cell were incubated with 1 mM of GDP as a negative control or with 100 µM of GTP{gamma}S as a positive control prior to the addition of GST-PAK-PBD and corresponded to a minimal or maximal activation of Rac 2, respectively. Immublot was performed using Rac 2 antibodies. Results are representative of 3 similar experiments.

Effect of Rac inhibitor NSC 23766 on COX-2 mRNA
Northern blot analysis was performed and demonstrated a modulation of COX-2 mRNA by Rac inhibition. Northern blot analysis of COX-2 mRNA was performed with 50 µM of NSC 23766 in the presence or absence of LPS. Cells were cotreated for 15 h with NSC 23766 and 5 µg/ml LPS. Incubation of cells with LPS resulted in a 11.5 ± 1.5-fold increase in the level of COX-2 mRNA in LPS-treated cells compared with untreated cells (mean±SE, n=3). When cells where cotreated with LPS and NSC 23766, COX-2 mRNA increase was only 6.6 ± 0.7-fold compared with control, support a statistically significant inhibition (43%, P<0.05, t test) (Fig. 5 ).


Figure 5
View larger version (17K):
[in this window]
[in a new window]

 
Figure 5. Effect of NSC 23766 on COX-2 mRNA levels. Cells were treated in the absence or presence of 5 µg/ml LPS and 50 µM of NSC 23766 for 15 h. Total mRNA was extracted and Northen blot analysis was performed. COX-2 mRNA was detected after hybridization with [32-P]-{alpha}-dCTP labeled COX-2 DNA probe. Radioactive signals were detected by Storm Phosphoimager (General Electric). mRNA for ß-actin was used to correct for total RNA loading. The lower panel shows the mRNA levels after NSC 23766 treatment. COX-2/ß-actin ratios were calculated, and results were expressed as mean of fold of untreated cells ± SE of 4 experiments and paired t-test was performed.

Effect of simvastatin and Rac inhibition on NF-{kappa}B binding
Finally we analyzed the potential transcription factor that might be involved by assessing the in vitro binding of NF-{kappa}B. NF-{kappa}B was shown to play an important role in LPS-dependent induction of COX-2 (29) . We first performed EMSA. As shown in Fig. 6 A, LPS induced nuclear protein-DNA complexes with a probe containing the NF-{kappa}B binding sequence compared to control. This complex was competed with a 20x excess of cold NF-{kappa}B but not with an excess of the double-stranded oligonucleotides containing CRE. When cells were pretreated with 25 µM of simvastatin for 12 h or 50 µM of NSC 23766, LPS-dependent complex was significantly reduced (Fig. 6A ). The LPS-dependent protein-DNA complex was supershifted with both antibodies specific to the p50 or p65 subunits of NF-{kappa}B (Fig. 6B ). Furthermore, we evaluated the inhibition of NFkB binding by testing a colorimetric NFkB-p65 transcription factor assay (Chemicon) that allowed us to detect in a sensitive manner the interaction of p65- with the DNA complex. Treatment of cells with LPS alone resulted in an increase in the complex formation illustrated by an increase in the OD of the complex biotinylated DNA-p65-antip65 and anti-IgG-HRP. Treatment of the cells with simvastatin or NSC 23766 blocked significantly the formation of the NF{kappa}B-DNA complex (Fig. 6C ).


Figure 6
View larger version (29K):
[in this window]
[in a new window]

 
Figure 6. Gel shift analysis of NF-{kappa}B. A) Cells were incubated in the presence or absence of NSC 23766 (50 µM) or simvastatin (25 µM) prior to the addition of 5 µg/ml LPS for 1 h. Nuclear extracts were prepared and incubated with labeled NF-{kappa}B double stranded DNA as described in Materials and Methods. DNA-protein complexes were detected after migration on nondenatured acrylamide gel. Storm Imager was used to detect radioactive bands. FP = free probe alone. Competition was done with unlabeled NF-{kappa}B or CRE double-stranded DNA added in excess. Results are representative of 3 experiments with similar results for simvastatin and 2 NSC 23766. B) Supershift analysis was performed on cells treated in the absence or presence of LPS. Nuclear extracts were incubated for 20 min in the absence or presence of 2 µg of p50-NF-{kappa}B or p65-NF-{kappa}B antibodies or rabbit or goat IgG prior to the addition of the labeled probe. C) NF-{kappa}B p-65 transcription factor assay was performed using a colorimetric assay (Chemicon). U937 (20x106 cells) were incubated in the absence or presence of 50 µM of NSC 23766 for 15 h or 25 µM of simvastatin for 24 h prior to the addition of 0.5 µg/ml of LPS. Nuclear extracts were prepared, and the assay was performed using 12.5 µg of total nuclear protein according to the manufacturer’s instructions. Competitor probe corresponded to the addition of a mutated NF-{kappa}B double-strand to the LPS-treated samples. Negative probe sample included nuclear extract fro LPS-treated cells in the absence of the specific NF-{kappa}B double-strand capture probe and corresponded to the background. TNF-{alpha}-treated Hela cells were used as a positive control for the kit and showed a high specific NF{kappa}B binding with an OD of 1.2. Results are representative of 3 experiments for NSC 23766 and simvastatin.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
In the present work, we have shown that mevastatin and simvastatin, inhibitors of HMG CoA reductase and cholesterol synthesis, block LPS-dependent expression of COX-2 in the human monocytic cells U937. We confirmed the role of mevalonate in these inhibitory effects and further demonstrated a major role of the geranylgeranylated proteins, since selective inhibitors of geranylgeranyl transferase inhibitors mimicked the effect of statins. Selective activator of the members of the Rho family, the cytonecrotizing factor-1 CNF-1, further supported a role for Rho proteins in COX-2 expression in U937 cells. Our results do not support a major role for farnesylated proteins, such as Ras, in the induction of COX-2, since the farnesyl transferase inhibitor FTI-277 did not show a significant effect on COX-2. We do not understand how the farnesyl-pyrophosphate reversed the effect of statins on COX-2 expression. One explanation is that a part of the excess of farnesyl-pyrophosphate added is used for the biosynthesis of geranylgeranylpyrophosphate.

COX-1 and COX-2 were recently described to play an important role in the development of atherosclerosis (30) . Its regulation will affect the formation of the different prostanoids and their related signaling. The important prostanoids important in vascular biology are PGE2, prostacyclin, and thromboxane A2. Recent studies using prostacylin receptor knockout mice (31) highlighted the crucial role of this prostaglandin and its receptors as the antiatherogenic and in the maintenance of vascular homeostasis. Low concentrations of PGE2 inhibit cAMP generation in platelets and favor platelet aggregation (32) , whereas high concentrations of PGE2 exerts antithrombotic and antiatherogenic effects (33 , 34 ). Very recently, the group of FitzGerald showed that deletion of microsomal prostaglandin E synthase-1 does not affect thromboxane biosynthesis, thrombogenesis, or blood pressure in vivo (35) . Moreover, thromboxane receptor antagonists retard atherogenesis in ApoE-deficient mice (36) . Recently Kinsella and colleagues have shown that human and mouse prostacyclin receptors are farnesylated (37) . They demonstrated that selective inhibitors of farnesyltransferases impair isoprenylation and signaling of these receptors (38 , 39) . However, in vivo clinical data performed by the same group on blood platelets of healthy donors showed no modification of the platelet prostacyclin receptor signaling after atorvastatin administration (40) . Nevertheless, the in vivo effect of statin on the vascular prostacyclin receptor-dependent signaling needs further investigation using farneyl transferase inhibitors selectively. This observation could imply important side effects of statins on the pharmacology of the prostacyclin receptor.

In the present study, we showed that statins block COX-2 in monocytes in a Rac and NF-{kappa}B dependent manner, whereas Rho-inhibition was responsible for the increase of COX-2 in human aortic smooth muscle cells (17) . The fact that TAT-C3 exoenzyme did not result in similar effects on U937 and in human vascular cells (17) may be related to differential expression or activation of the Rho family members and the regulatory exchanger and inhibitory proteins for these small G-proteins between the different cells types, e.g., high Rac2 expression in the hemopoietic-derived U937. We verified that the RhoA selective blocker, C3 exoenzyme, was active in U937 cells (Fig. 4B ). It has been recently shown that CNF-1 activates RhoA/C transiently with a maximal effect at 2 h prior to its degradation (19) , probably via a proteasome-dependent mechanism (41) , whereas Rac and cdc42 remain activated for a much longer period. Therefore, the effect of CNF-1 on COX-2 in U937 cells could be mainly attributed to Rac activation rather than Rho A/C. This possible pathway was further supported by the results of the selective inhibitor of Rac, NSC 23766, which we described to block the Rac2 association with PDB protein, supporting a specific effect of NSC 23766 on Rac 2 in our model (Fig. 4D ). Barbieri et al. showed recently that COX-2 is up-regulated during PMA and that differentiation of U937 cells is blocked by fluvastatin in a Rac-dependent manner (42) . We and other investigators (43 44 45) were unable to detect significant basal expression of COX-2 in PMA-differentiated U937 cells. However, in a mouse macrophage cell line, Chen et al. showed that lovastatin, fluvastatin, and atorvastatin but not pravastatin increased COX-2 in a murine macrophage cell Raw 264.7 in a Ras-dependent manner (46) . In this cell line, Waldeigh et al. showed a different effect of Ras where COX-2 expression by LPS was not dependent on Ras (47) . Moreover, Ongini et al. showed recently that NCS-6550, a particular NO-releasing pravastatin led to an inhibition of COX-2 expression in the same cells (48) . Our results do not exclude a role for cdc42 in this regulation and diverge from the one described by the group of J. Egido showing, in another monocytic cell line, THP-1, that atorvastatin blocks IL-1 + TNF-{alpha}-dependent induction of COX-2 regulation in a Rho A–dependent manner (49) and that COX-2 increases in monocytes/macrophages within the atherosclerotic plaques are associated with an activation of NF-{kappa}B (50) . These discrepancies might result from differences in cell type, (THP-1 vs. U937) and its content in Rho proteins as clarified earlier, the COX-2 activator, (IL-1+TNF-{alpha} vs. LPS), or the type of statin, (atorvastatin vs. simvastatin). It has been shown that statins decrease COX-2 expression in macrophages present in atherosclerotic lesions (50 , 51) .

A potential beneficial effect on the progress of the atherosclerotic plaque could be a combined effect of statins or prenyltransferase inhibitors and NSAIDS or any inhibitors of the prostaglandin E2 synthases. The in vivo role of such treatments on the levels of macrophage and blood platelet PGE2 and TX and in contrary the increase in prostacyclin synthesis for the statin-inhibitor of PGE2 synthase combination could be investigate in animal models of carotid injury.

In summary, we have shown that COX-2 expression is blocked partially by statins and involves Rac and NF-{kappa}B activation. These data stress the beneficial, antiinflammatory effect of statin on NF-{kappa}B and the proinflammatory COX-2 in macrophage cell lines. The effect we described was obtained at high concentrations of simvastatin corresponding to 20–50 times the therapeutic doses. It seems these concentrations are essential for the inhibition of isoprenylation of proteins in cultured cells (52 53 54 55) . Evidence from in vitro and more recently in vivo data in animals showed antiinflammatory and antiatherogenic effects (56 , 57) . The effect of some statins was described on COX-2 in animal models (49 , 51) and in human subjects (58 , 59) . Further investigations are needed to assess the contribution of vascular vs. macrophage COX-2 expression within atherosclerotic lesions and test the effective of selective Rho or Rac inhibitors.


   ACKNOWLEDGMENTS
 
We are grateful for the help of Catherine Crouin for the preparation of GST-CNF-1 and TAT-C3 exoenzyme (INSERM U 749). This work was supported from grants from the American University of Beirut (DTS, URB and MPP) and from the Lebanese National Scientific Council for Research to AH (LNCSR program # 08–08-03). Additional support to (JB) was provided by INSERM and Ligue Nationale contre le Cancer (équipe labelisée).

Received for publication August 1, 2006. Accepted for publication January 4, 2007.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Smith, W. L. (1992) Prostanoid biosynthesis and mechanisms of action. Am. J. Physiol. 263,F181-191[Medline]
  2. FitzGerald, G. A., Cheng, Y., Austin, S. (2001) COX-2 inhibitors and the cardiovascular system. Clin. Exp. Rheumatol. 19,S31-S36[Medline]
  3. FitzGerald, G. A., Austin, S., Egan, K., Cheng, Y., Pratico, D. (2000) Cyclo-oxygenase products and atherothrombosis. Ann. Med. 32(Suppl. 1),21-26[Medline]
  4. Paramo, J. A., Rodriguez, J. A., Beloqui, O., Orbe, J. (2005) Monocyte cyclooxygenase-2 activity: a new therapeutic target for atherosclerosis?. Curr. Drug. Targets. Cardiovasc. Haematol. Disord. 5,303-311[CrossRef][Medline]
  5. Martel-Pelletier, J., Pelletier, J. P., Fahmi, H. (2003) Cyclooxygenase-2 and prostaglandins in articular tissues. Semin. Arthritis. Rheum. 33,155-167[CrossRef][Medline]
  6. Laufer, S. (2003) Role of eicosanoids in structural degradation in osteoarthritis. Curr. Opin. Rheumatol. 15,623-627[CrossRef][Medline]
  7. Grosser, T., Fries, S., FitzGerald, G. A. (2006) Biological basis for the cardiovascular consequences of COX-2 inhibition: therapeutic challenges and opportunities. J. Clin. Invest. 116,4-15[CrossRef][Medline]
  8. Kothapalli, D., Fuki, I., Ali, K., Stewart, S. A., Zhao, L., Yahil, R., Kwiatkowski, D., Hawthorne, E. A., FitzGerald, G. A., Phillips, M. C., Lund-Katz, S., Pure, E., Rader, D. J., Assoian, R. K. (2004) Antimitogenic effects of HDL and APOE mediated by COX-2-dependent IP activation. J. Clin. Invest. 113,609-618[CrossRef][Medline]
  9. Egan, K. M., Lawson, J. A., Fries, S., Koller, B., Rader, D. J., Smyth, E. M., Fitzgerald, G. A. (2004) COX-2-derived prostacyclin confers atheroprotection on female mice. Science 306,1954-1957[Abstract/Free Full Text]
  10. Egan, K. M., Wang, M., Fries, S., Lucitt, M. B., Zukas, A. M., Pure, E., Lawson, J. A., FitzGerald, G. A. (2005) Cyclooxygenases, thromboxane, and atherosclerosis: plaque destabilization by cyclooxygenase-2 inhibition combined with thromboxane receptor antagonism. Circulation 111,334-342[Abstract/Free Full Text]
  11. Cipollone, F., Prontera, C., Pini, B., Marini, M., Fazia, M., De Cesare, D., Iezzi, A., Ucchino, S., Boccoli, G., Saba, V., Chiarelli, F., Cuccurullo, F., Mezzetti, A. (2001) Overexpression of functionally coupled cyclooxygenase-2 and prostaglandin E synthase in symptomatic atherosclerotic plaques as a basis of prostaglandin E(2)-dependent plaque instability. Circulation 104,921-927[Abstract/Free Full Text]
  12. Gotto, A. M., Jr (2003) Treating hypercholesterolemia: looking forward. Clin. Cardiol. 26,I21-28[Medline]
  13. Rosenson, R. S., Tangney, C. C. (1998) Antiatherothrombotic properties of statins: implications for cardiovascular event reduction. JAMA 279,1643-1650[Abstract/Free Full Text]
  14. Corsini, A. (2000) Fluvastatin: effects beyond cholesterol lowering. J. Cardiovasc. Pharmacol. Ther. 5,161-175[Medline]
  15. Shovman, O., Levy, Y., Gilburd, B., Shoenfeld, Y. (2002) Antiinflammatory and immunomodulatory properties of statins. Immunol. Res. 25,271-285[CrossRef][Medline]
  16. Bocan, T. M. (2002) Pleiotropic effects of HMG-CoA reductase inhibitors. Curr. Opin. Investig. Drugs 3,1312-1317[Medline]
  17. Degraeve, F., Bolla, M., Blaie, S., Creminon, C., Quere, I., Boquet, P., Levy-Toledano, S., Bertoglio, J., Habib, A. (2001) Modulation of COX-2 expression by statins in human aortic smooth muscle cells. Involvement of geranylgeranylated proteins. J. Biol. Chem. 276,46849-46855[Abstract/Free Full Text]
  18. Sebbagh, M., Renvoizé, C., Hamelin, J., Riché, N., Bertoglio, J., Bréard, J. (2001) Caspase-3-mediated cleavage of ROCK I induces MLC phosphorylation and apoptotic membrane bebbing. Nat. Cell Biol. 3,346-352[CrossRef][Medline]
  19. Moreau, V., Tatin, F., Varon, C., Genot, E. (2003) Actin can reorganize into podosomes in aortic endothelial cells, a process controlled by Cdc42 and RhoA. Mol. Cell Biol. 23,6809-6822[Abstract/Free Full Text]
  20. Zhang, S., Lipsky, M., Trump, B., Hsu, I. (1990) Neutral red (NR) assay for cell viability and xenobiotic-induced cytotoxicity in primary cultures of human and rat hepatocytes. Cell Biol. Toxicol. 6,219-234[Medline]
  21. Habib, A., Creminon, C., Frobert, Y., Grassi, J., Pradelles, P., Maclouf, J. (1993) Demonstration of an inducible cyclooxygenase in human endothelial cells using antibodies raised against the carboxyl-terminal region of the cyclooxygenase-2. J. Biol. Chem. 268,23448-23454[Abstract/Free Full Text]
  22. Creminon, C., Frobert, Y., Habib, A., Maclouf, J., Pradelles, P., Grassi, J. (1995) Immunological studies of human constitutive cyclooxygenase (COX-1) using enzyme immunometric assay. Biochim. Biophys. Acta. 1254,333-340[Medline]
  23. Pradelles, P., Grassi, J., Maclouf, J. (1985) Enzyme immunoassays of eicosanoids using acetylcholine esterase as label: an alternative to radioimmunoassay. Anal. Chem. 57,1170-1173[Medline]
  24. Jones, D. A., Carlton, D. P., McIntyre, T. M., Zimmerman, G. A., Prescott, S. M. (1993) Molecular cloning of human prostaglandin endoperoxide synthase type II and demonstration of expression in response to cytokines. J. Biol. Chem. 268,9049-9054[Abstract/Free Full Text]
  25. Benard, V., Bohl, B. P., Bokoch, G. M. (1999) Characterization of rac and cdc42 activation in chemoattractant-stimulated human neutrophils using a novel assay for active GTPases. J. Biol. Chem. 274,13198-13204[Abstract/Free Full Text]
  26. Nemer, G., Nemer, M. (2003) Transcriptional activation of BMP-4 and regulation of mammalian organogenesis by GATA-4 and -6. Dev. Biol. 254,131-148[CrossRef][Medline]
  27. Gao, Y., Dickerson, J. B., Guo, F., Zheng, J., Zheng, Y. (2004) Rational design and characterization of a Rac GTPase-specific small molecule inhibitor. Proc. Natl. Acad. Sci. U. S. A. 101,7618-7623[Abstract/Free Full Text]
  28. Didsbury, J., Weber, R. F., Bokoch, G. M., Evans, T., Snyderman, R. (1989) rac, a novel ras-related family of proteins that are botulinum toxin substrates. J. Biol. Chem. 264,16378-16382[Abstract/Free Full Text]
  29. Inoue, H., Tanabe, T. (1998) Transcriptional role of the nuclear factor kappa B site in the induction by lipopolysaccharide and suppression by dexamethasone of cyclooxygenase-2 in U937 cells. Biochem. Biophys. Res. Commun. 244,143-148[CrossRef][Medline]
  30. Fitzgerald, G. A. (2004) Coxibs and cardiovascular disease. N. Engl. J. Med. 351,1709-1711[Free Full Text]
  31. Cheng, Y., Austin, S. C., Rocca, B., Koller, B. H., Coffman, T. M., Grosser, T., Lawson, J. A., FitzGerald, G. A. (2002) Role of prostacyclin in the cardiovascular response to thromboxane A2. Science 296,539-541[Abstract/Free Full Text]
  32. Fabre, J. E., Nguyen, M., Athirakul, K., Coggins, K., McNeish, J. D., Austin, S., Parise, L. K., FitzGerald, G. A., Coffman, T. M., Koller, B. H. (2001) Activation of the murine EP3 receptor for PGE2 inhibits cAMP production and promotes platelet aggregation. J. Clin. Invest 107,603-610[Medline]
  33. Bishop-Bailey, D., Burke-Gaffney, A., Hellewell, P. G., Pepper, J. R., Mitchell, J. A. (1998) Cyclo-oxygenase-2 regulates inducible ICAM-1 and VCAM-1 expression in human vascular smooth muscle cells. Biochem. Biophys. Res. Commun. 249,44-47[CrossRef][Medline]
  34. Bornfeldt, K. E., Campbell, J. S., Koyama, H., Argast, G. M., Leslie, C. C., Raines, E. W., Krebs, E. G., Ross, R. (1997) The mitogen-activated protein kinase pathway can mediate growth inhibition and proliferation in smooth muscle cells. Dependence on the availability of downstream targets. J. Clin. Invest. 100,875-885[Medline]
  35. Cheng, Y., Wang, M., Yu, Y., Lawson, J., Funk, C. D., Fitzgerald, G. A. (2006) Cyclooxygenases, microsomal prostaglandin E synthase-1, and cardiovascular function. J. Clin. Invest. 116,1391-1399[CrossRef][Medline]
  36. Cayatte, A. J., Du, Y., Oliver-Krasinski, J., Lavielle, G., Verbeuren, T. J., Cohen, R. A. (2000) The thromboxane receptor antagonist S18886 but not aspirin inhibits atherogenesis in apo E-deficient mice: evidence that eicosanoids other than thromboxane contribute to atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 20,1724-1728[Abstract/Free Full Text]
  37. Miggin, S. M., Lawler, O. A., Kinsella, B. T. (2003) Palmitoylation of the human prostacyclin receptor. Functional implications of palmitoylation and isoprenylation. J. Biol. Chem. 278,6947-6958[Abstract/Free Full Text]
  38. O’Meara, S. J., Kinsella, B. T. (2004) Investigation of the effect of the farnesyl protein transferase inhibitor R115777 on isoprenylation and intracellular signalling by the prostacyclin receptor. Br. J. Pharmacol. 143,318-330[CrossRef][Medline]
  39. O’Meara, S. J., Kinsella, B. T. (2005) The effect of the farnesyl protein transferase inhibitor SCH66336 on isoprenylation and signalling by the prostacyclin receptor. Biochem. J. 386,177-189[CrossRef][Medline]
  40. O’Meara, S. J., Kinsella, B. T. (2004) Effect of the statin atorvastatin on intracellular signalling by the prostacyclin receptor in vitro and in vivo. Br. J. Pharmacol. 143,292-302[CrossRef][Medline]
  41. Doye, A., Mettouchi, A., Bossis, G., Clement, R., Buisson-Touati, C., Flatau, G., Gagnoux, L., Piechaczyk, M., Boquet, P., Lemichez, E. (2002) CNF1 exploits the ubiquitin-proteasome machinery to restrict Rho GTPase activation for bacterial host cell invasion. Cell 111,553-564[CrossRef][Medline]
  42. Barbieri, S. S., Eligini, S., Brambilla, M., Tremoli, E., Colli, S. (2003) Reactive oxygen species mediate cyclooxygenase-2 induction during monocyte to macrophage differentiation: critical role of NADPH oxidase. Cardiovasc. Res. 60,187-197[Abstract/Free Full Text]
  43. Barry, O. P., Kazanietz, M. G., Pratico, D., FitzGerald, G. A. (1999) Arachidonic acid in platelet microparticles up-regulates cyclooxygenase-2-dependent prostaglandin formation via a protein kinase C/mitogen-activated protein kinase-dependent pathway. J. Biol. Chem. 274,7545-7556[Abstract/Free Full Text]
  44. Demasi, M., Cleland, L. G., Cook-Johnson, R. J., Caughey, G. E., James, M. J. (2003) Effects of hypoxia on monocyte inflammatory mediator production: Dissociation between changes in cyclooxygenase-2 expression and eicosanoid synthesis. J. Biol. Chem. 278,38607-38616[Abstract/Free Full Text]
  45. Penglis, P. S., Cleland, L. G., Demasi, M., Caughey, G. E., James, M. J. (2000) Differential regulation of prostaglandin E2 and thromboxane A2 production in human monocytes: implications for the use of cyclooxygenase inhibitors. J. Immunol. 165,1605-1611[Abstract/Free Full Text]
  46. Chen, J.-C., Wu, W.-T., Lin, W.-W., Huang, K.-C., Wingerd, B. (2004) HMG-CoA reductase inhibitors induce COX-2 gene expression in murine macrophages: Role of MAPK cascades and promoter elements for CREB and C/EBP?. Exper. Cell Res. 301,305-319[CrossRef][Medline]
  47. Wadleigh, D. J., Reddy, S. T., Kopp, E., Ghosh, S., Herschman, H. R. (2000) Transcriptional activation of the cyclooxygenase-2 gene in endotoxin-treated RAW 264.7 macrophages. J. Biol. Chem. 275,6259-6266[Abstract/Free Full Text]
  48. Ongini, E., Impagnatiello, F., Bonazzi, A., Guzzetta, M., Govoni, M., Monopoli, A., Del Soldato, P., Ignarro, L. J. (2004) Nitric oxide (NO)-releasing statin derivatives, a class of drugs showing enhanced antiproliferative and anti-inflammatory properties. Proc. Natl. Acad. Sci. 101,8497-8502[Abstract/Free Full Text]
  49. Gomez-Hernandez, A., Sanchez-Galan, E., Martin-Ventura, J. L., Vidal, C., Blanco-Colio, L. M., Ortego, M., Vega, M., Serrano, J., Ortega, L., Hernandez, G., Tunon, J., Egido, J. (2006) Atorvastatin reduces the expression of prostaglandin E2 receptors in human carotid atherosclerotic plaques and monocytic cells: potential implications for plaque stabilization. J. Cardiovasc. Pharmacol. 47,60-69[CrossRef][Medline]
  50. Martin-Ventura, J. L., Blanco-Colio, L. M., Gomez-Hernandez, A., Munoz-Garcia, B., Vega, M., Serrano, J., Ortega, L., Hernandez, G., Tunon, J., Egido, J. (2005) Intensive treatment with atorvastatin reduces inflammation in mononuclear cells and human atherosclerotic lesions in one month. Stroke 36,1796-1800[Abstract/Free Full Text]
  51. Hernandez-Presa, M. A., Martin-Ventura, J. L., Ortego, M., Gomez-Hernandez, A., Tunon, J., Hernandez-Vargas, P., Blanco-Colio, L. M., Mas, S., Aparicio, C., Ortega, L., Vivanco, F., Gerique, J. G., Diaz, C., Hernandez, G., Egido, J. (2002) Atorvastatin reduces the expression of cyclooxygenase-2 in a rabbit model of atherosclerosis and in cultured vascular smooth muscle cells. Atherosclerosis 160,49-58[CrossRef][Medline]
  52. Finder, J. D., Litz, J. L., Blaskovich, M. A., McGuire, T. F., Qian, Y., Hamilton, A. D., Davies, P., Sebti, S. M. (1997) Inhibition of protein geranylgeranylation causes a superinduction of nitric-oxide synthase-2 by interleukin-1beta in vascular smooth muscle cells. J. Biol. Chem. 272,13484-13488[Abstract/Free Full Text]
  53. Laufs, U., Liao, J. K. (1998) Post-transcriptional regulation of endothelial nitric oxide synthase mRNA stability by Rho GTPase. J. Biol. Chem. 273,24266-24271[Abstract/Free Full Text]
  54. Grosser, N., Hemmerle, A., Berndt, G., Erdmann, K., Hinkelmann, U., Schurger, S., Wijayanti, N., Immenschuh, S., Schroder, H. (2004) The antioxidant defense protein heme oxygenase 1 is a novel target for statins in endothelial cells. Free Radic. Biol. Med. 37,2064-2071[CrossRef][Medline]
  55. Grosser, N., Erdmann, K., Hemmerle, A., Berndt, G., Hinkelmann, U., Smith, G., Schroder, H. (2004) Rosuvastatin upregulates the antioxidant defense protein heme oxygenase-1. Biochem. Biophys. Res. Commun. 325,871-876[CrossRef][Medline]
  56. Liao, J. K. (2002) Beyond lipid lowering: the role of statins in vascular protection. Int. J. Cardiol. 86,5-18[CrossRef][Medline]
  57. Liao, J. K. (2004) Statins: potent vascular anti-inflammatory agents. Int. J. Clin. Pract. Suppl ,41-48
  58. Cipollone, F., Fazia, M., Iezzi, A., Zucchelli, M., Pini, B., De Cesare, D., Ucchino, S., Spigonardo, F., Bajocchi, G., Bei, R., Muraro, R., Artese, L., Piattelli, A., Chiarelli, F., Cuccurullo, F., Mezzetti, A. (2003) Suppression of the functionally coupled cyclooxygenase-2/prostaglandin E synthase as a basis of simvastatin-dependent plaque stabilization in humans. Circulation 107,1479-1485[Free Full Text]
  59. Cipollone, F., Fazia, M., Iezzi, A., Ciabattoni, G., Pini, B., Cuccurullo, C., Ucchino, S., Spigonardo, F., De Luca, M., Prontera, C., Chiarelli, F., Cuccurullo, F., Mezzetti, A. (2004) Balance between PGD synthase and PGE synthase is a major determinant of atherosclerotic plaque instability in humans. Arterioscler. Thromb. Vasc. Biol. 24,1259-1265[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Rheumatology (Oxford)Home page
F. Montecucco, F. Burger, G. Pelli, N. K. Poku, C. Berlier, S. Steffens, and F. Mach
Statins inhibit C-reactive protein-induced chemokine secretion, ICAM-1 upregulation and chemotaxis in adherent human monocytes
Rheumatology, March 1, 2009; 48(3): 233 - 242.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-6766comv1
21/8/1665    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Habib, A.
Right arrow Articles by Badr, K. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Habib, A.
Right arrow Articles by Badr, K. F.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS