FASEB J. FASEB
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.06-7719com.
(The FASEB Journal. 2007;21:1565-1574.)
© 2007 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.06-7719comv1
21/7/1565    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Patel, H. H.
Right arrow Articles by Roth, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Patel, H. H.
Right arrow Articles by Roth, D. M.

Mechanisms of cardiac protection from ischemia/reperfusion injury: a role for caveolae and caveolin-1

Hemal H. Patel*,1, Yasuo M. Tsutsumi*,1, Brian P. Head*, Ingrid R. Niesman{dagger}, Michelle Jennings*, Yousuke Horikawa*, Diane Huang*, Ana L. Moreno*, Piyush M. Patel*,§, Paul A. Insel{ddagger} and David M. Roth*,§,2

* Department of Anesthesiology,

{dagger} Cellular and Molecular Medicine,

{ddagger} Pharmacology, University of California, San Diego, CA, USA; and

§ Veterans Affairs San Diego Healthcare System, San Diego, California, USA

2Correspondence: VASDHS (125), 3350 La Jolla Village Dr., San Diego, CA 92161, USA. E-mail: droth{at}ucsd.edu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Caveolae, small invaginations in the plasma membrane, contain caveolins (Cav) that scaffold signaling molecules including the tyrosine kinase Src. We tested the hypothesis that cardiac protection involves a caveolin-dependent mechanism. We used in vitro and in vivo models of ischemia-reperfusion injury, electron microscopy (EM), transgenic mice, and biochemical assays to address this hypothesis. We found that Cav-1 mRNA and protein were expressed in mouse adult cardiac myocytes (ACM). The volatile anesthetic, isoflurane, protected ACM from hypoxia-induced cell death and increased sarcolemmal caveolae. Hearts of wild-type (WT) mice showed rapid phosphorylation of Src and Cav-1 after isoflurane and ischemic preconditioning. The Src inhibitor PP2 reduced phosphorylation of Src (Y416) and Cav-1 in the heart and abolished isoflurane-induced cardiac protection in WT mice. Infarct size (percent area at risk) was reduced by isoflurane in WT (30.5±4 vs. 44.2±3, n=7, P<0.05) but not Cav-1–/– mice (46.6±5 vs. 41.7±3, n=7). Cav-1–/– mice exposed to isoflurane showed significant alterations in Src phosphorylation and recruitment of C-terminal Src kinase, a negative regulator of Src, when compared to WT mice. The results indicate that isoflurane modifies cardiac myocyte sarcolemmal membrane structure and composition and that activation of Src and phosphorylation of Cav-1 contribute to cardiac protection. Accordingly, therapies targeted to post-translational modification of Src and Cav-1 may provide a novel approach for such protection.—Patel, H. H., Tsutsumi, Y. M., Head, B. P., Niesman, I. R., Jennings, M., Horikawa, Y. Huang, D., Moreno, A. L., Patel, P. M., Insel, P. A., Roth, D. M. Mechanisms of cardiac protection from ischemia/reperfusion injury: a role for caveolae and caveolin-1.


Key Words: protein tyrosine kinase • Src • phosphorylation • heart


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
THE SIGNAL TRANSDUCTION pathways involved in cardiac protection are complex. Since the original description of such protection (1) , increasing emphasis has been placed on cardiac protective mechanisms as putative triggers, mediators, or end effectors. Current ideas emphasize triggering via a G-protein coupled receptor (GPCR)-dependent mechanism, which initiates a downstream signaling cascade involving protein tyrosine kinases (PTK, e.g., Src), prosurvival kinases (including phosphatidylinositol-3-kinase and Akt/protein kinase B), nitric oxide synthase (NOS), activation of ATP-dependent mitochondrial K+ channels, generation of reactive oxygen species (ROS), activation of several other protein kinases (including PKG and PKC isoforms, glycogen synthase kinase, and mitogen-activated protein kinases), and inhibition of the opening of the mitochondrial permeability transition pore (2 , 3) . Though these numerous components are thought to be involved in cardiac protection, there is ambiguity as to how signaling networks interact spatially and temporally in producing such protection. In particular, little is known about the regions to which proteins translocate and the molecules with which they interact.

Caveolae are small (100 nm in diameter), flask-like invaginations that create signaling microdomains of the plasma membrane (4 , 5) , thereby providing spatial and temporal organization of cellular signaling events (6 7 8 9) . Disruption of caveolae in cardiac myocytes abolishes cardiac protection produced by ischemia and opioids (10) . Caveolins (Cav), structural proteins found in caveolae, serve as scaffolds and regulators of signaling proteins (11 12 13 14 15 16) . Three members of the caveolin gene family have been described previously: Cav-1, -2, and -3, all of which are expressed in cardiac myocytes (17 18 19 20) . Signaling molecules involved in cardiac protection, including GPCRs and the protein tyrosine kinase Src, compartmentalize within caveolae and interact with the scaffolding domain of caveolins (21) . The potential role of caveolins in cardiac protection is not known and is the subject of this study.

The PTK, Src, contributes to cardiac protection induced by short bouts of ischemia/reperfusion (ischemic preconditioning) (22) or isoflurane exposure (23) . In embryonic fibroblasts, oxidative stress results in activation of Src kinases, phosphorylation of Cav-1 and recruitment of C-terminal Src kinase (Csk) to Src with resultant phosphorylation of a negative regulatory site (Y527) and deactivation of Src (24) . The feedback regulation of Src by phosphorylated Cav-1 and Csk also occurs after GCPR activation in human embryonic kidney cells (25) . Isoflurane-treated microvascular endothelial cells show activation of Src kinase (Y416 autophosphorylation) and phosphorylation of Cav-1. Because activation of Src kinase and phosphorylation of Cav-1 may be a signaling mechanism involved in cardiac protection, we used isoflurane as a pharmacological tool to study the role of caveolae and Cav-1 in protection of cardiac myocytes in vitro and the intact heart in vivo. The studies thus test and the results support the hypothesis that Cav-1 is an essential protein in the signaling cascade involved in cardiac protection.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Animals
All animals were treated in compliance with the Guide for the Care and Use of Laboratory Animals (National Academy of Science); animal use protocols were approved by the Veterans Affairs San Diego Healthcare System Institutional Animal Care and Use Committee. Male C57BL/6 or Cav-1 knockout mice (Cav-1–/–; 8–10 wk old, 24–26 g body wt) were purchased from Jackson Laboratory (Bar Harbor, ME, USA). The animals were kept on a 12 h light-dark cycle in a temperature-controlled room.

Adult mouse cardiac myocyte isolation and simulated ischemia/reperfusion
Mouse adult cardiac myocytes (ACM) isolated from collagenase-perfused hearts and maintained in 1% BSA Media 199 as described previously (26) were exposed to isoflurane or air (control) in a 37°C metabolic chamber (1.4%, 0.165±0.003 mM isoflurane, as confirmed by liquid-liquid extraction analysis using capillary-gas chromatography with detection on a Hewlett-Packard 5990 Series 2 gas chromatograph). Delivery of isoflurane to the metabolic chamber was continuously monitored with a Datex Capnomac (SOMA Technology, Inc., Cheshire, CT, USA) capnograph. ACM under basal conditions remained in a 5% CO2 humidified incubator or were exposed to isoflurane or air for 30 min and then to hypoxia (95% N2/5% CO2) and glucose deprivation (glucose free Dulbecco’s modified Eagle’s medium) for 1 h followed by 1 h reoxygenation in 1% BSA Media 199. Cell death was assessed by trypan blue uptake.

Real-time polymerase chain reaction analysis of gene expression
Total RNA was isolated from ACM using a RNeasy Mini Kit (Qiagen, Valencia, CA, USA). First strand cDNA synthesis (Superscript First Strand Synthesis System for reverse transcriptase-polymerase chain reaction (RT-PCR; Invitrogen, Carlsbad, CA, USA) was performed using random hexamers on 1–2 µg of total RNA. The concentration of cDNA was determined and adjusted to 50 ng/µl for real-time PCR analysis, which was performed on a MJ Research Opticon 2 (Bio-Rad, Hercules, CA, USA) in triplicate using the QPCR Mastermix Plus SYBR Green Kit (Eurogentec North America, Inc., San Diego, CA, USA) with 100 ng cDNA and 0.5 µM forward/reverse primer mix in 20 µl final reaction volume. Primer sequences were caveolin-1 forward: ACGACGACGTGGTCAAGATT, reverse: GTGCAGGAAAGAGAGGATGG; caveolin-2 forward: CTTCATTGCGGGTATCCTGT, reverse: TTCAGTCATGGCTCAGTTGC; caveolin-3 forward: ACACCACTTTCACCGTCTCC, reverse: TGCACTGGATCTCAATCAGG. Thermal cycle conditions were as follows: 94°C-10 min (1 cycle); 94°C-20 s, 55°C-20 s, and 72°C-30 s (40 cycles). Resulting PCR products were confirmed by melt curve analysis and agarose gel electrophoresis. Analysis of cycle threshold (Ct) was performed using Opticon 2 analysis software (Bio-Rad); normalized values were obtained for each group by subtracting matched glyceraldehyde-3-phosphate dehyodrogenase (GAPDH) Ct values.

Immunoblot analysis
Proteins in whole cell lysates (5 µg) or cellular fractions were separated by SDS-PAGE using 10% polyacrylamide precast gels (Invitrogen) and transferred to polyvinylidene difluoride membranes by electroelution. Membranes were blocked in 20 mM PBS Tween (1%) containing 1.5% nonfat dry milk and incubated with primary antibody overnight at 4°C (Cav-1-AbCam: Cambridge, MA, USA; Src antibodies: Cell Signaling, Danvers, MA; Csk, Cav-2, and Cav-3: BD Bioscience, San Jose, CA, USA). Bound primary antibodies were visualized using secondary antibodies conjugated with horseradish peroxidase from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and ECL reagent from Amersham Pharmacia Biotechnology (Piscataway, NJ, USA). All displayed bands migrated at the appropriate size, as determined by comparison to molecular mass standards (Santa Cruz Biotechnology). Protein concentration was assayed using a dye-binding protein assay from Bio-Rad.

Electron microscopy
ACM were exposed to isoflurane or oxygen (control) using the protocol above. After isoflurane exposure (30 min, 2.1% isoflurane, 0.350±0.004 mM), cells were fixed with 2.5% glutaraldehyde in 0.1 M cacodylate buffer for 2 h at room temperature, postfixed in 1% OsO4 in 0.1 M cacodylate buffer (1 h) at room temperature, and embedded as monolayers in LX-112 (Ladd Research, Williston, VT, USA). Sections were stained in uranyl acetate and lead citrate and observed with an electron microscope (JEOL 1200 EX-II, JOEL USA, Peabody, MA,or Philips CM-10, Philips Electronic Instruments, Mahwah, NJ, USA). Random sections were taken by an EM technician blinded to the treatments.

Sucrose density fractionation
Whole hearts were homogenized with a tissue grinder with three 10 s bursts in 150 mM Na2CO3, pH 11.0, to extract membrane proteins. Lysates were then subjected to three cycles of 20 s bursts of sonication and 1 min incubation on ice. Approximately 1 ml of lysate was mixed with 1 ml of 80% sucrose in 25 mM MES and 150 mM NaCl (MES buffered saline, MBS, pH 6.5) to form 40% sucrose and loaded at the bottom of an ultracentrifuge tube. A discontinuous sucrose gradient was generated by layering 6 ml of 35% sucrose prepared in MBS followed by 4 ml of 5% sucrose in MBS. The gradient was centrifuged at 175, 000 g using a SW41Ti rotor (Beckman Instruments, Fullerton, CA, USA) for 3 h at 4°C. Samples were removed in 1 ml aliquots to yield 12 fractions; fractions 4–12 were used in immunoblot analyses.

In vivo experimental preparation
Mice were anesthetized with sodium pentobarbital (80 mg/kg ip). A twenty-gauge catheter was then inserted into the tracheae, and the mice were mechanically ventilated using a pressure-controlled ventilator (TOPO Ventilator, Kent Scientific Co., Torrington, CT, USA, peak inspiratory pressure: 15 cmH2O, respiratory rate: 100 breaths/min, inspired oxygen: 100%). A thoracotomy was performed to expose the heart. Core temperature was maintained at 36°C with a heating pad, and ECG leads were placed to record heart rate. For assessment of Src and caveolin protein changes, mice received 100% oxygen in the control group or 1.4% isoflurane (1 minimum alveolar concentration for mice; ref 27 ) or underwent three cycles of 5 min ischemia/5 min reperfusion for ischemic preconditioning before heart excision.

Ischemia reperfusion protocol and experimental groups
After thoracotomy, baseline was established and mice were randomly assigned to experimental protocols. Mice received 100% O2 (45 min) in the control group or 1.4% isoflurane (30 min with 15 min washout). Other mice received 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo[3,4-d]pyrimidine (PP2, Calbiochem, San Diego, CA, USA), a Src kinase inhibitor (10 µg/kg, IV, 20 min before isoflurane), or naloxone (Nal, Tocris, Ellisville, MO, USA), a nonselective opioid receptor antagonist (3 mg/kg, 10 min prior to isoflurane). Ischemic preconditioning was induced by three cycles of 5 min left coronary artery occlusion followed by 5 min reperfusion just before lethal ischemia. Lethal ischemia was produced by occluding the left coronary artery with a 7–0 silk suture on a taper BV-1 needle (Ethicon, Inc., Somerville, NJ, USA) for 30 min. A small piece of polyethylene tubing was used to secure the silk ligature without damaging the artery. After 30 min of occlusion, the ligature was released and the heart was reperfused for 2 h. Reperfusion was confirmed by observing return of blood flow in the epicardial coronary arteries.

Determination of infarct size
After 2 h of reperfusion, the coronary artery was again occluded. The area at risk (AAR) was determined by staining with 1% Evans blue (1.0 ml, Sigma). The heart was immediately excised and placed into 1% agarose and allowed to harden. Once hardened, the heart was cut into 1 mm slices (McIlwain tissue chopper; Brinkmann Instruments, Inc., Westbury, NY, USA). Each slice of left ventricle (LV) was counterstained with 3.0 ml of 1% 2,3,5,-triphenyltetrazolium chloride (Sigma) for 5 min at 37°C. After overnight storage in 10% formaldehyde, slices were weighed and visualized under a microscope (Leica Microsystems Inc., Bannockburn, IL, USA) equipped with a charge-coupled device camera (Cool SNAP-Pro, Media Cybernetics, Inc., Silver Spring, MD, USA). The images were analyzed (Image-Pro Plus Version 4.5, Media Cybernetics, Inc.) and infarct size was determined by planimetry. The AAR was expressed as a percentage of the LV (AAR/LV). Infarct size (IS) was expressed as a percentage of the AAR (IS/AAR).

Hemodynamics
The hemodynamic effects of isoflurane during the ischemia-reperfusion protocol were studied in a separate group of mice. Mice were anesthetized with sodium pentobarbital (as above). The right carotid artery was instrumented with 1.4F Mikro-tip pressure transducer (Model SPR-671, Millar Instruments, Inc., Houston, TX, USA), which was connected to an amplifier (Model TCB-500, Millar) for determination of heart rate, arterial blood pressure, and rate pressure product. Pressure signals were digitally converted (IOX version 1.8.5.11, Emka Technologies, Falls Church, VA, USA) and stored on a computer.

Immunoprecipitation
Immunoprecipitations were performed using protein G-agarose (Roche Applied Science, Indianapolis, IN, USA). Whole hearts were lysed in IPEGAL lysis buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 5 mM MgCl2, 1 mM EGTA, 2 mM dithiothreitol, and 0.5% Igepal CA-630 plus mammalian protease inhibitor (Sigma) and phosphatase inhibitor cocktails (Upstate, Charlottesville, VA, USA). The lysate was precleared with agarose, incubated with primary antibody for 3 h at 4°C, immunoprecipitated overnight with protein-agarose at 4°C, and then centrifuged at 13,000 g for 5 min. Protein-agarose pellets were washed once with lysis buffer, followed by subsequent washes with wash buffer A (50 mM Tris-HCl, pH 7.5, 500 mM NaCl, and 0.2% Igepal CA-630) and wash buffer B (10 mM Tris-HCl, pH 7.5, and 0.2% Igepal CA-630).

Statistical analysis
Data analysis was performed by observers blinded to experimental groups. Group size to determine the primary outcome variable of infarct size was determined by power analysis. The SD of infarct size was determined from historic control mice of similar strain undergoing a similar ischemia-reperfusion protocol. Statistical analyses were performed by one-way ANOVA followed by post hoc unpaired Student’s t test with Bonferroni correction for multiple comparisons. All data are mean ± SE. Statistical significance was defined as P < 0.05.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Caveolin mRNA and protein expression in mouse ACM
We initially investigated the expression of mRNA and protein for Cav-1, Cav-2, and Cav-3 in ACM isolated from mice. Real-time PCR showed expression of all three Cav isoforms (Fig. 1 A). The relative expression of mRNA for the different Cavs was Cav-3>Cav-1>Cav-2. Caveolin proteins also showed similar levels of expression among the 3 Cavs (Fig. 1B ).


Figure 1
View larger version (37K):
[in this window]
[in a new window]

 
Figure 1. Caveolin mRNA and protein expression in mouse ACM. A) mRNA was isolated from mouse ACM. Expression of caveolin-1, -2, and -3 was assessed with specific primers. All 3 caveolin mRNAs were expressed in ACM. Lower GAPDH normalized values correspond to higher mRNA expression. B) ACM lysates were immunoblotted for caveolin isoforms. All 3 caveolin proteins are expressed in ACM.

Isoflurane protects isolated ACM and alters caveolae number and protein content
Isolated mouse ACM were subjected to simulated ischemia/reperfusion (SI/R) injury by exposure to hypoxia and glucose deprivation. Exposure of myocytes to isoflurane (30 min) before SI/R significantly reduced cell death (51.5±0.8% vs. 66.0±2.1%, n=5 separate ACM isolations, P<0.01, Fig. 2 A) and increased the number of caveolae (Fig. 2B, n =3 separate ACM isolations and EM analysis). Fractionation of ACM on a sucrose density gradient to separate buoyant membranes showed enrichment of proteins following isoflurane exposure in buoyant fractions (Fig. 2C, n =3 separate ACM isolations and fractionations).


Figure 2
View larger version (46K):
[in this window]
[in a new window]

 
Figure 2. Isoflurane-induced cardiac protection and isoflurane effects on membrane morphology and caveolae protein content. A) Isolated mouse ACM were subjected to SI/R (hypoxia+glucose deprivation). Cells treated with isoflurane before SI/R showed significantly reduced cell death; n = 4–6 experiments from individual animals. B) ACM were exposed to isoflurane, fixed, and underwent routine EM analysis. Representative EM images show that isoflurane increases membrane invaginations that are typical features of caveolae; n = 3 experiments from individual animals. C) ACM were fractionated on a discontinuous sucrose gradient and fractions were analyzed for protein content. Isoflurane increased the protein content of fractions 4–6, which are associated with buoyant membranes that comprise caveolae; n = 3 experiments from individual animals. *P < 0.05 vs. control.

Cardiac protection in vivo enhances phosphorylation and enrichment of Src and Cav-1 in caveolae containing buoyant fractions
Mice were exposed to isoflurane or ischemic preconditioning, and the hearts were excised and probed for Src and Cav-1 phosphorylation. Isoflurane exposure rapidly (within 5 min) increased the phosphorylated state of Src and Cav-1 (Fig. 3 A–B, n=6). We assessed signaling components in buoyant fractions because they contain caveolae. Exposure of mice to isoflurane increased the enrichment of phosphorylated and total Src and Cav-1 in caveolae containing buoyant fractions, as assessed by sucrose density fractionation (Fig. 3C , n=3), a result consistent with findings obtained with isolated ACM exposed to isoflurane (Fig. 2C ). Ischemic preconditioning decreased infarct size (Fig. 3D ) and produced significant elevation of phosphorylated Src (Fig. 3E ) and Cav-1 (Fig. 3F ) in the heart.


Figure 3
View larger version (67K):
[in this window]
[in a new window]

 
Figure 3. Cardiac protection induces Src and Cav-1 phosphorylation and migration to buoyant caveolar fractions in vivo. Mice were exposed to isoflurane, and hearts were excised at various time points (5, 10, 30 min). Lysed hearts were immunoblotted for various proteins; n = 6 animals per group. A, top panel) Representative immunoblots of phosphoSrc (Y416) and total Src. A, bottom panel) densitometry shows that there was a rapid elevation of Src phosphorylation after isoflurane exposure that remained elevated for at least 30 min. B, top panel) Representative immunoblots of phosphoCav-1 and total Cav-1. B, bottom panel) Densitometry shows that there was a rapid elevation of Cav-1 phosphorylation that remained elevated for at least 30 min. C) Isoflurane treated hearts (30 min) were lysed and fractionated on a discontinuous sucrose density gradient. One milliter fractions were collected and probed for phospho (Y416) and total Src and Cav-1. Isoflurane exposure of whole animals resulted in increased total and phospho Src and Cav-1 in buoyant fractions (BF), whereas control animals not exposed to isoflurane localized Src and Cav-1 primarily in heavy membrane fractions (HF). n = 3 animals per group. D) Mice were subjected to an IPC protocol (3 cycles of 5 min ischemia followed by 5 min reperfusion) followed by left anterior descending coronary artery occlusion for 30 min and 2 h reperfusion. AAR as a percentage of total LV was similar in each group. Infarct size expressed as a percentage of AAR was reduced by IPC; n = 8 mice per group. E, F) Mice underwent IPC and hearts were excised 30 min later. Lysed hearts were immunoblotted for various proteins. E, top panel) Representative immunoblots of phosphoSrc (Y416) and total Src. E, bottom panel) Densitometry shows elevation of Src phosphorylation after IPC. F, top panel) Representative immunoblots of phosphoCav-1 and total Cav-1. F, bottom panel) densitometry shows elevation of Cav-1 phosphorylation after IPC; n = 6 animals per group. *P < 0.05 treated group vs. control.

Inhibition of Src attenuates Cav-1 phosphorylation and isoflurane-induced cardiac protection
Treatment of mice with the Src inhibitor PP2 decreased Src and Cav-1 phosphorylation in the heart in response to isoflurane exposure (Fig. 4 A and 4 B, n=6). No differences were observed in area at risk (AAR) as a percentage of LV between the groups (Fig. 4C ). Mice treated with isoflurane had a significant reduction in infarct size as a percent of AAR compared to controls (25.9±2.0 vs. 42.1±1.4, n=8/group, P < 0.01), whereas PP2-treated mice could not be protected by isoflurane treatment (41.8±3.4, n=8, Fig. 4D ). Treatment of mice with the opioid receptor antagonist naloxone decreased Src and Cav-1 phosphorylation in the heart in response to isoflurane exposure (Fig. 4E and F , n=4).


Figure 4
View larger version (40K):
[in this window]
[in a new window]

 
Figure 4. PP2, a Src kinase inhibitor, inhibits Src and Cav-1 phosphorylation and abolishes isoflurane-induced cardiac protection. Mice were treated with PP2 (1 µg/kg) 20 min before isoflurane exposure (30 min); n = 6 animals per group. A, top panel) Representative immunoblot of Src phosphorylation (Y416) and total Src. A, bottom panel) Densitometry shows a reduction in Src phosphorylation (Y416) with PP2 treatment. B, top panel) Representative immunoblot of Cav-1 phosphorylation with PP2 treatment. B, bottom panel) Densitometry shows a reduction in Cav-1 phosphorylation with PP2 treatment. C, D) Mice were treated with PP2 (1 µg/kg) 20 min prior to isoflurane exposure (30 min with 15 min washout) and then subjected to left anterior descending coronary artery occlusion for 30 min followed by 2 h reperfusion. C) AAR as a percentage of total LV was similar in each group. D) Infarct size expressed as a percentage of AAR was reduced by isoflurane treatment. Protection was abolished if animals were treated with PP2 before isoflurane exposure; n = 8 mice per group. E and F. Mice were treated with naloxone (Nal, 3mg/kg) 10 min before isoflurane exposure (30 min); n = 4 animals per group. E, top panel) Representative immunoblot of Src phosphorylation (Y416) and total Src. E, bottom panel) Densitometry shows a reduction in Src phosphorylation (Y416) with naloxone. F, top panel) representative immunoblot of Cav-1 phosphorylation with naloxone. F, bottom panel) Densitometry shows a reduction in Cav-1 phosphorylation with naloxone. +P < 0.05 vs. control and * P < 0.05 vs. isoflurane.

Cav-1–/– mice are resistant to isoflurane-induced cardiac protection
Wild-type (WT) and Cav-1–/– mice showed no differences in AAR as a percentage of the LV (Fig. 5 A). WT mice exposed to isoflurane had reduced infarct size as a percentage of AAR (30.5±4.0 vs. 44.2±1.5, n=7, P<0.01) but Cav-1–/– mice did not show such reduction (46.6±4.5 vs. 41.7±2.9, n=7, P>0.05, Fig. 5B ). WT and Cav-1–/– mice were exposed to isoflurane (30 min), hearts were immediately excised, and Src phosphorylation (Y416 and Y527) was assessed; we observed no difference between WT and Cav-1–/– mice in Src Y416 and Y527 phosphorylation (Fig. 5C ). However, we observed differences in hearts excised from WT and Cav-1–/– mice exposed to isoflurane (30 min) followed by a 2 h recovery period; activated Src (Y416) was increased, while inactive Src (Y527) was decreased in Cav-1–/– mice after 2 h but we observed the opposite result in WT mice (Fig. 5D ). Cav-1–/– mice also showed decreased recruitment of Csk (C-terminal Src kinase), a negative regulator of Src, to Src (Y527) after 30 min isoflurane exposure and 2 h recovery (Fig. 5E ). Hearts from Cav-1–/– mice have similar expression of Cav-3 compared to WT (data not shown).


Figure 5
View larger version (37K):
[in this window]
[in a new window]

 
Figure 5. Cav-1–/– mice are resistant to isoflurane-induced cardiac protection and show altered Src deactivation. Cav-1–/– and wild-type (WT) mice were exposed to isoflurane (30 min with 15 min washout) and then subjected to left anterior descending coronary artery occlusion for 30 min followed by 2 h reperfusion. A) AAR as a percentage of total LV was similar in each group. B) Infarct size expressed as a percentage of AAR was reduced by isoflurane treatment in WT mice but not in Cav-1–/– mice. n = 7 mice per group. C) Mice were exposed to isoflurane (30 min) after which hearts were excised and analyzed for Src phosphorylation. C, top panel) Representative immunoblots for Src (Y416 and Y527) phosphorylation and total Src. C, bottom panels) Densitometry shows no difference in Src Y416 and Y527 in WT and Cav-1–/– mice 30 min after isoflurane; n = 6 animals per group. D) Mice were exposed to isoflurane (30 min) and allowed to recover for 2 h after which hearts were excised and analyzed for Src phosphorylation. D, top panel) Representative immunoblots for Src (Y416 and Y527) phosphorylation and total Src. D, bottom panels) Densitometry shows that activated Src (Y416) remains elevated and inactive Src (Y527) is reduced in Cav-1–/– mice 2 h after isoflurane. WT mice showed deactivation of Src at this time point. n = 4–6 animals per group. E) Hearts from mice exposed to isoflurane (30 min) that recovered for 2 h were lysed and immunoprecipitated [inositol phase (IP)] using Src (Y527) and phosphorylated Cav-1. IPs were separated by SDS-PAGE and probed for Csk or phosphoCav-1. Cav-1–/– mice showed a reduced recruitment of Csk to Src and the absence of phosphoCav-1. Sup = supernatant. *P < 0.05 vs. WT.

Hemodynamics
We found no significant differences between WT and Cav-1–/– mice in heart rate, blood pressure, or rate pressure product with isoflurane exposure (Table 1 ).


View this table:
[in this window]
[in a new window]

 
Table 1. Hemodynamics


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Ischemic preconditioning (IPC) is considered "the gold standard" for protecting the heart from ischemia-reperfusion injury. We show that IPC protected mice from in vivo ischemia-reperfusion injury and produced increased phosphorylation of Src and Cav-1. In addition, we used isoflurane, an agent that produces cardiac protection in animal models of ischemia-reperfusion injury (28 , 29) and patients undergoing coronary artery bypass graft surgery (30) , as a tool to dissect the temporal and spatial role of Src, Cav-1, and caveolae in cardiac protection. Isoflurane protected isolated cardiac myocytes from hypoxia-induced cell death and had profound effects on membrane morphology of ACM. Isoflurane increased the expression of caveolae in the sarcolemmal membrane and localization of proteins, including caveolin, in buoyant membrane fractions. These buoyant microenvironments are highly enriched in cholesterol, glycosphingolipids, caveolins, and multiple signaling molecules in cardiac myocytes and other cell types (14 , 21 , 31 , 32) . Recently, we reported that opioid receptors, which are involved in cardiac protection, are localized in caveolae and physical disruption of caveolae resulted in an inability to protect ACM from hypoxic/ischemic damage (10) , thus underscoring the importance of caveolar-localized signaling networks in cardiac protection. Based on those findings and the current results, we propose that components of signal transduction involved in cardiac protection coexist and function in a caveolar/caveolin microenvironment.

How do cardiac protective stimuli manipulate the caveolar microenvironment? As noted in the introduction, the three isoforms of caveolins, the structural proteins essential for caveolae formation (33 , 34) , contain a scaffolding domain [caveolin scaffolding domain (CSD)] that anchors and regulates protein function (35 , 36) . Cav-3 is found primarily in striated (skeletal and cardiac) muscle (37) ; however, recent evidence suggests that Cav-1 may also be an integral component in cardiac myocytes (20) . No previous studies have described a role for Cav-1 in cardiac protection. In the current study, we show that mice exposed to IPC or isoflurane show increased activation of Src and phosphorylation of Cav-1. Isoflurane resulted in enrichment of total and phosphorylated Src and Cav-1 in buoyant membrane fractions. Such data suggest that isoflurane increases the protein content of buoyant caveolar microdomains, specifically enriching cardiac protective signaling components in those microdomains. Caveolins function as scaffolds for signaling molecules, providing temporal and spatial regulation of signal transduction, in particular by interaction of the CSD to inhibit activity of signaling proteins (e.g., ERK1/2, eNOS) through their caveolin-binding motifs (12 , 38 39 40 41) . Alternatively, caveolins can promote signaling via enhanced receptor-effector coupling or enhanced receptor affinity when caveolin expression is increased (35 , 42) . This has led to the concept of a "caveolar paradox" in which caveolins may allosterically inhibit molecules such as eNOS under basal conditions but facilitate increased signaling on agonist stimulation (35 , 43) , a mechanism that may be important in cardiac protection.

Recent studies suggest that Cav-1 can be phosphorylated by stress-induced pathways and that this phosphorylation is dependent on activation of Src (44 45 46) ; however, the physiological and pharmacologic implications of Cav-1 phosphorylation are not clear. We show that both IPC and isoflurane induce the phosphorylation of Src (Y416) in the heart. Moreover, we find that isoflurane-induced phosphorylation of Cav-1 depends on Src activation because PP2, a Src kinase inhibitor that blocks the autophosphorylation of Src at Y416, attenuates Cav-1 phosphorylation and isoflurane-induced cardiac protection. Interestingly, Cav-1–/– mice showed normal activation of Src (phosphorylation at Y416) 30 min after isoflurane in both WT and Cav-1–/– mice; however, Src (Y416) remained phosphorylated in Cav-1–/– mice 2 h after of isoflurane exposure, suggesting impaired deactivation of Src. WT mice showed activation (Y416 phosphorylation) at 30 min and deactivation of Src (Y527 phosphorylation) 2 h after isoflurane. Others have shown that phosphorylated Cav-1 is necessary to recruit Csk to Src to phosphorylate Y527 and inactivate Src (24) . Our data confirm that this mechanism is inhibited in hearts of Cav-1–/– mice, implying its possible involvement in cardiac protection. The findings suggest that transient activity of Src is regulated by Cav-1 and that Cav-1 plays a critical role in isoflurane-induced cardiac protection. Recent work shows similar negative regulation of Src by phosphorylated Cav-1 by the protease-activated receptor 1, a G-protein coupled receptor (25) . Collectively, these data suggest a novel signaling paradigm whereby deactivation of Src by a Cav-1 dependent mechanism is important for cardiac protection.

Our findings should be interpreted within the constraints of potential limitations. Cav-1–/– mice have several phenotypic differences from wild-type mice, including pulmonary hypercellularity and fibrosis, altered microvascular permeability, and cardiomyopathic changes thought to be due to hyperproliferation of cardiac fibroblasts and hyperactivation of eNOS and Erk 1/2 pathways in endothelial cells and cardiac fibroblasts (47) . We used young Cav-1–/– mice (8–10 wk old) that showed no differences in hemodynamic response to anesthesia or isoflurane to limit the role of long-term pathophysiological changes on our results. However, we cannot rule out other effects of the phenotype unrelated to Src activation and Cav-1 phosphorylation on the lack of cardiac protection in Cav-1–/– mice. In addition, our study only addressed Src and Cav-1 phosphorylation in isoflurane and IPC. We show that naloxone, a nonselective opioid receptor antagonist, which blocks isoflurane-induced cardiac protection (48) , decreased Src and Cav-1 phosphorylation to control levels when given prior to isoflurane exposure. However, studies have shown that opioids and sevoflurane, which produce cardiac protection, do not necessarily cause activation of Src (49 , 50) . Further studies that look at other cardiac protective stimuli are warranted in Cav-1–/– mice.

In conclusion, the results show that cardiac protection involves modulation of the tyrosine kinase, Src and Cav-1, proteins that localize in caveolae. Because the absence of Cav-1 negates the protective effects of isoflurane, Cav-1 appears to have a critical role in cardiac protective signaling. The findings thus raise the intriguing possibility that therapies targeted to post-translational modification of Src and Cav-1 may provide a novel approach to produce cardiac protection.


   ACKNOWLEDGMENTS
 
Supported by American Heart Association Scientist Development Grant 0630039N (H. H. Patel), American Heart Association Postdoctoral Fellowship 0525190Y (Y. M. Tsutsumi), American Heart Association Predoctoral Fellowship 0615027Y (Y. Horikawa), Merit Award from the Department of Veterans Affairs (D. M. Roth), and NIH RO1 NS 047570 (P. M. Patel), and 1PO1 HL66941–01 (D. M. Roth and P. A. Insel, co-investigator).


   FOOTNOTES
 
1 These authors contributed equally to this work.

Received for publication November 30, 2006. Accepted for publication December 25, 2006.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Murry, C. E., Jennings, R. B., Reimer, K. A. (1986) Preconditioning with ischemia: a delay of lethal cell injury in ischemic myocardium. Circulation 74,1124-1136[Abstract/Free Full Text]
  2. Hausenloy, D. J., Yellon, D. M. (2006) Survival kinases in ischemic preconditioning and postconditioning. Cardiovasc. Res. 70,240-253[Abstract/Free Full Text]
  3. Juhaszova, M., Zorov, D. B., Kim, S. H., Pepe, S., Fu, Q., Fishbein, K. W., Ziman, B. D., Wang, S., Ytrehus, K., Antos, C. L., et al (2004) Glycogen synthase kinase-3beta mediates convergence of protection signaling to inhibit the mitochondrial permeability transition pore. J. Clin. Invest. 113,1535-1549[CrossRef][Medline]
  4. Palade, G. (1953) Fine structure of blood capilaries. J. App. Physiol. 24,1424-1436
  5. Yamada, E. (1955) The fine structure of the gall bladder epithelium of the mouse. J. Biophys. Biochem. Cytol. 1,445-458[Medline]
  6. Neubig, R. R. (1994) Membrane organization in G-protein mechanisms. FASEB J. 8,939-946[Abstract]
  7. Okamoto, T., Schlegel, A., Scherer, P. E., Lisanti, M. P. (1998) Caveolins, a family of scaffolding proteins for organizing "preassembled signaling complexes" at the plasma membrane. J. Biol. Chem. 273,5419-5422[Free Full Text]
  8. Ostrom, R. S., Insel, P. A. (1999) Caveolar microdomains of the sarcolemma: compartmentation of signaling molecules comes of age (editorial). Circ. Res. 84,1110-1112[Free Full Text]
  9. Rybin, V. O., Xu, X., Lisanti, M. P., Steinberg, S. F. (2000) Differential targeting of beta -adrenergic receptor subtypes and adenylyl cyclase to cardiomyocyte caveolae. A mechanism to functionally regulate the cAMP signaling pathway. J. Biol. Chem. 275,41447-41457[Abstract/Free Full Text]
  10. Patel, H. H., Head, B. P., Petersen, H. N., Niesman, I. R., Huang, D., Gross, G. J., Insel, P. A., Roth, D. M. (2006) Protection of adult rat cardiac myocytes from ischemic cell death: role of caveolar microdomains and {delta}-opioid receptors. Am. J. Physiol. Heart. Circ. Physiol. 291,H344-H350[Abstract/Free Full Text]
  11. Couet, J., Li, S., Okamoto, T., Ikezu, T., Lisanti, M. P. (1997) Identification of peptide and protein ligands for the caveolin-scaffolding domain. Implications for the interaction of caveolin with caveolae-associated proteins. J. Biol. Chem. 272,6525-6533[Abstract/Free Full Text]
  12. Feron, O., Dessy, C., Opel, D. J., Arstall, M. A., Kelly, R. A., Michel, T. (1998) Modulation of the endothelial nitric-oxide synthase-caveolin interaction in cardiac myocytes. Implications for the autonomic regulation of heart rate. J. Biol. Chem. 273,30249-30254[Abstract/Free Full Text]
  13. Feron, O., Saldana, F., Michel, J. B., Michel, T. (1998) The endothelial nitric-oxide synthase-caveolin regulatory cycle. J. Biol. Chem. 273,3125-3128[Abstract/Free Full Text]
  14. Head, B. P., Patel, H. H., Roth, D. M., Lai, N. C., Niesman, I. R., Farquhar, M. G., Insel, P. A. (2005) G-protein coupled receptor signaling components localize in both sarcolemmal and intracellular caveolin-3-associated microdomains in adult cardiac myocytes. J. Biol. Chem. 280,31036-31044[Abstract/Free Full Text]
  15. Li, S., Song, K. S., Lisanti, M. P. (1996) Expression and characterization of recombinant caveolin. Purification by polyhistidine tagging and cholesterol-dependent incorporation into defined lipid membranes. J. Biol. Chem. 271,568-573[Abstract/Free Full Text]
  16. Yamamoto, M., Toya, Y., Schwencke, C., Lisanti, M. P., Myers, M. G., Jr, Ishikawa, Y. (1998) Caveolin is an activator of insulin receptor signaling. J. Biol. Chem. 273,26962-26968[Abstract/Free Full Text]
  17. Rothberg, K. G., Heuser, J. E., Donzell, W. C., Ying, Y. S., Glenney, J. R., Anderson, R. G. (1992) Caveolin, a protein component of caveolae membrane coats. Cell 68,673-682[CrossRef][Medline]
  18. Scherer, P. E., Okamoto, T., Chun, M., Nishimoto, I., Lodish, H. F., Lisanti, M. P. (1996) Identification, sequence, and expression of caveolin-2 defines a caveolin gene family. Proc. Natl. Acad. Sci. U. S. A. 93,131-135[Abstract/Free Full Text]
  19. Tang, Z., Scherer, P. E., Okamoto, T., Song, K., Chu, C., Kohtz, D. S., Nishimoto, I., Lodish, H. F., Lisanti, M. P. (1996) Molecular cloning of caveolin-3, a novel member of the caveolin gene family expressed predominantly in muscle. J. Biol. Chem. 271,2255-2261[Abstract/Free Full Text]
  20. Head, B. P., Patel, H. H., Roth, D. M., Murray, F., Swaney, J. S., Niesman, I. R., Farquhar, M. G., Insel, P. A. (2006) Microtubules and actin microfilaments regulate lipid raft/caveolae localization of adenylyl cyclase signaling components. J. Biol. Chem. 281,26391-26399[Abstract/Free Full Text]
  21. Krajewska, W. M., Maslowska, I. (2004) Caveolins: structure and function in signal transduction. Cell. Mol. Biol. Lett. 9,195-220[Medline]
  22. Fryer, R. M., Schultz, J. E. J., Hsu, A. K., Gross, G. J. (1999) Importance of PKC and tyrosine kinase in single or multiple cycles of preconditioning in rat hearts. Am. J. Physiol. Heart. Circ. Physiol. 276,H1229-H1235[Abstract/Free Full Text]
  23. Ludwig, L. M., Weihrauch, D., Kersten, J. R., Pagel, P. S., Warltier, D. C. (2004) Protein kinase C translocation and Src protein tyrosine kinase activation mediate isoflurane-induced preconditioning in vivo: potential downstream targets of mitochondrial adenosine triphosphate-sensitive potassium channels and reactive oxygen species. Anesthesiology 100,532-539[CrossRef][Medline]
  24. Cao, H., Sanguinetti, A. R., Mastick, C. C. (2004) Oxidative stress activates both Src-kinases and their negative regulator Csk and induces phosphorylation of two targeting proteins for Csk: caveolin-1 and paxillin. Exp. Cell Res. 294,159-171[CrossRef][Medline]
  25. Lu, T. L., Kuo, F. T., Lu, T. J., Hsu, C. Y., Fu, H. W. (2006) Negative regulation of protease-activated receptor 1-induced Src kinase activity by the association of phosphocaveolin-1 with Csk. Cell. Signal 18,1977-1987[CrossRef][Medline]
  26. Ander, A. N., Duggirala, S. K., Drumm, J. D., Roth, D. M. (2004) Natriuretic peptide gene expression after beta-adrenergic stimulation in adult mouse cardiac myocytes. DNA Cell Biol. 23,586-591[Medline]
  27. Deady, J. E., Koblin, D. D., Eger, E. I., Heavner, J. E., D’Aoust, B. (1981) Anesthetic potencies and the unitary theory of narcosis. Anesth. Analg. 60,380-384[Abstract/Free Full Text]
  28. Kersten, J. R., Schmeling, T. J., Pagel, P. S., Gross, G. J., Warltier, D. C. (1997) Isoflurane mimics ischemic preconditioning via activation of KATP channels. Anesthesiology 87,361-370[CrossRef][Medline]
  29. Tsutsumi, Y. M., Patel, H. H., Lai, N. C., Takahashi, T., Head, B. P., Roth, D. M. (2006) Isoflurane produces sustained cardiac protection after ischemia-reperfusion injury in mice. Anesthesiology 104,495-502[CrossRef][Medline]
  30. Belhomme, D., Peynet, J., Louzy, M., Launay, J. M., Kitakaze, M., Menasche, P. (1999) Evidence for preconditioning by isoflurane in coronary artery bypass graft surgery. Circulation 100,II340-II344[Medline]
  31. Lasley, R., Prakash, N., Uittenbogaard, A., Smart, E. (2000) Activated cardiac adenosine A1 receptors translocate out of caveolae. J. Biol. Chem. 275,4417-4421[Abstract/Free Full Text]
  32. Ballard-Croft, C., Locklar, A. C., Kristo, G., Lasley, R. D. (2006) Regional myocardial ischemia induced activation of MAPKs is associated with subcellular redistribution of caveolin and cholesterol. Am. J. Physiol. Heart. Circ. Physiol. 291,H658-H667[Abstract/Free Full Text]
  33. Parton, R. G., Way, M., Zorzi, N., Stang, E. (1997) Caveolin-3 associates with developing T-tubules during muscle differentiation. J. Cell Biol. 136,137-154[Abstract/Free Full Text]
  34. Chun, M., Liyanage, U. K., Lisanti, M. P., Lodish, H. F. (1994) Signal transduction of a G protein-coupled receptor in caveolae: colocalization of endothelin and its receptor with caveolin. Proc. Natl. Acad. Sci. U. S. A. 91,11728-11732[Abstract/Free Full Text]
  35. Feron, O., Balligand, J. L. (2006) Caveolins and the regulation of endothelial nitric oxide synthase in the heart. Cardiovasc. Res. 69,788-797[Abstract/Free Full Text]
  36. Sargiacomo, M., Scherer, P. E., Tang, Z., Kübler, E., Song, K. S., Sanders, M. C., Lisanti, M. P. (1995) Oligomeric structure of caveolin: implications for caveolae membrane organization. Proc. Natl. Acad. Sci. U. S. A. 92,9407-9411[Abstract/Free Full Text]
  37. Song, K. S., Scherer, P. E., Tang, Z., Okamoto, T., Li, S., Chafel, M., Chu, C., Kohtz, D. S., Lisanti, M. P. (1996) Expression of caveolin-3 in skeletal, cardiac, and smooth muscle cells. Caveolin-3 is a component of the sarcolemma and co-fractionates with dystrophin and dystrophin-associated glycoproteins. J. Biol. Chem. 271,15160-15165[Abstract/Free Full Text]
  38. Shaul, P. W., Anderson, R. G. (1998) Role of plasmalemmal caveolae in signal transduction. Am. J. Physiol. 275,L843-L851[Medline]
  39. Williams, T. M., Lisanti, M. P. (2004) The caveolin proteins. Genome. Biol. 5,214[CrossRef][Medline]
  40. Engelman, J. A., Chu, C., Lin, A., Jo, H., Ikezu, T., Okamoto, T., Kohtz, D. S., Lisanti, M. P. (1998) Caveolin-mediated regulation of signaling along the p42/44 MAP kinase cascade in vivo. A role for the caveolin-scaffolding domain. FEBS Let. 428,205-211[CrossRef][Medline]
  41. Kamoun, W. S., Karaa, A., Kresge, N., Merkel, S. M., Korneszczuk, K., Clemens, M. G. (2006) LPS inhibits endothelin-1-induced endothelial NOS activation in hepatic sinusoidal cells through a negative feedback involving caveolin-1. Hepatology 43,182-190[CrossRef][Medline]
  42. Raikar, L. S., Vallejo, J., Lloyd, P. G., Hardin, C. D. (2006) Overexpression of caveolin-1 results in increased plasma membrane targeting of glycolytic enzymes: The structural basis for a membrane associated metabolic compartment. J. Cell. Biochem. 98,861-871[CrossRef][Medline]
  43. Feron, O., Kelly, R. A. (2001) The Caveolar Paradox: Suppressing, inducing, and terminating eNOS signaling. Circ. Res. 88,129-131[Free Full Text]
  44. Sanguinetti, A. R., Cao, H., Corley Mastick, C. (2003) Fyn is required for oxidative- and hyperosmotic-stress-induced tyrosine phosphorylation of caveolin-1. Biochem. J. 376,159-168[CrossRef][Medline]
  45. Sanguinetti, A. R., Mastick, C. C. (2003) c-Abl is required for oxidative stress-induced phosphorylation of caveolin-1 on tyrosine 14. Cell Signal 15,289-298[CrossRef][Medline]
  46. Swaney, J. S., Patel, H. H., Yokoyama, U., Head, B. P., Roth, D. M., Insel, P. A. (2006) Focal adhesions in (myo)fibroblasts scaffold adenylyl cyclase with phosphorylated caveolin. J. Biol. Chem. 281,17173-17179[Abstract/Free Full Text]
  47. Cohen, A. W., Hnasko, R., Schubert, W., Lisanti, M. P. (2004) Role of caveolae and caveolins in health and disease. Physiol. Rev. 84,1341-1379[Abstract/Free Full Text]
  48. Ludwig, L. M., Patel, H. H., Gross, G. J., Kersten, J. R., Pagel, P., Warltier, D. C. (2003) Morphine enhances pharmacological preconditioning by isoflurane: role of mitochondrial KATP channels and opioid receptors. Anesthesiology 98,705-711[CrossRef][Medline]
  49. Fryer, R. M., Wang, Y., Hsu, A. K., Nagase, H., Gross, G. J. (2001) Dependence of delta1-opioid receptor-induced cardioprotection on a tyrosine kinase-dependent but not a Src-dependent pathway. J. Pharmacol. Exp. Ther. 299,477-482[Abstract/Free Full Text]
  50. Hu, G., Schwartz, D. E., Shajahan, A. N., Visintine, D. J., Salem, M. R., Crystal, G. J., Albrecht, R. F., Vogel, S. M., Minshall, R. D. (2006) Isoflurane, but not sevoflurane, increases transendothelial albumin permeability in the isolated rat lung: role for enhanced phosphorylation of caveolin-1. Anesthesiology 104,777-785[CrossRef][Medline]



This article has been cited by other articles:


Home page
CirculationHome page
Y. M. Tsutsumi, Y. T. Horikawa, M. M. Jennings, M. W. Kidd, I. R. Niesman, U. Yokoyama, B. P. Head, Y. Hagiwara, Y. Ishikawa, A. Miyanohara, et al.
Cardiac-Specific Overexpression of Caveolin-3 Induces Endogenous Cardiac Protection by Mimicking Ischemic Preconditioning
Circulation, November 4, 2008; 118(19): 1979 - 1988.
[Abstract] [Full Text] [PDF]


Home page
Anesth. Analg.Home page
E. Lucchinetti, M. C. Schaub, and M. Zaugg
Emulsified Intravenous Versus Evaporated Inhaled Isoflurane for Heart Protection: Old Wine in a New Bottle or True Innovation?
Anesth. Analg., May 1, 2008; 106(5): 1346 - 1349.
[Full Text] [PDF]


Home page
FASEB J.Home page
B. P. Head, H. H. Patel, Y. M. Tsutsumi, Y. Hu, T. Mejia, R. C. Mora, P. A. Insel, D. M. Roth, J. C. Drummond, and P. M. Patel
Caveolin-1 expression is essential for N-methyl-D-aspartate receptor-mediated Src and extracellular signal-regulated kinase 1/2 activation and protection of primary neurons from ischemic cell death
FASEB J, March 1, 2008; 22(3): 828 - 840.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. Salani, L. Briatore, S. Garibaldi, R. Cordera, and D. Maggi
Caveolin-1 Down-Regulation Inhibits Insulin-Like Growth Factor-I Receptor Signal Transduction in H9C2 Rat Cardiomyoblasts
Endocrinology, February 1, 2008; 149(2): 461 - 465.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
D. Volonte, C. F. McTiernan, M. Drab, M. Kasper, and F. Galbiati
Caveolin-1 and caveolin-3 form heterooligomeric complexes in atrial cardiac myocytes that are required for doxorubicin-induced apoptosis
Am J Physiol Heart Circ Physiol, January 1, 2008; 294(1): H392 - H401.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.06-7719comv1
21/7/1565    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Patel, H. H.
Right arrow Articles by Roth, D. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Patel, H. H.
Right arrow Articles by Roth, D. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS