FASEB J. Uncover Your Biological Pathway
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.06-7377com.
(The FASEB Journal. 2007;21:1527-1538.)
© 2007 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-7377comv1
21/7/1527    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Herzig, S.
Right arrow Articles by Hullin, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Herzig, S.
Right arrow Articles by Hullin, R.

Mechanism of Cav1.2 channel modulation by the amino terminus of cardiac ß2-subunits

Stefan Herzig*,{dagger},1,2, Ismail F. Y. Khan*,{dagger},1, Dirk Gründemann*,{dagger}, Jan Matthes*, Andreas Ludwig{ddagger}, Guido Michels, Uta C. Hoppe,{dagger}, Dipayan Chaudhuri§, Arnold Schwartz||, David T. Yue§ and Roger Hullin**

* Department of Pharmacology, University of Cologne, Cologne, Germany,

{dagger} Center of Molecular Medicine, University of Cologne, Cologne, Germany;

{ddagger} Institute of Experimental and Clinical Pharmacology and Toxicology, University Erlangen-Nuernberg, Erlangen, Germany;

Internal Medicine III, University of Cologne, Cologne, Germany;

§ Johns Hopkins University School of Medicine, Baltimore, Maryland, USA;

|| Institute of Molecular Pharmacology and Biophysics, University of Cincinnati, Cincinnati, Ohio, USA; and

** Department of Cardiology, Swiss Heart Center Bern, University Hospital, Bern, Switzerland

2Correspondence: Department of Pharmacology, University of Cologne, Gleueler Strasse 24, 50931 Köln, Germany. E-mail: stefan.herzig{at}uni-koeln.de


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
L-type calcium channels are composed of a pore, {alpha}1c (CaV1.2), and accessory ß- and {alpha}2{delta}-subunits. The ß-subunit core structure was recently resolved at high resolution, providing important information on many functional aspects of channel modulation. In this study we reveal differential novel effects of five ß2-subunits isoforms expressed in human heart 2a-e) on the single L-type calcium channel current. These splice variants differ only by amino-terminal length and amino acid composition. Single-channel modulation by ß2-subunit isoforms was investigated in HEK293 cells expressing the recombinant L-type ion conducting pore. All ß2-subunits increased open probability, availability, and peak current with a highly consistent rank order (ß2a{approx}ß2b2e{approx}ß2c2d). We show graded modulation of some transition rates within and between deep-closed and inactivated states. The extent of modulation correlates strongly with the length of amino-terminal domains. Two mutant ß2-subunits that imitate the natural span related to length confirm this conclusion. The data show that the length of amino termini is a relevant physiological mechanism for channel closure and inactivation, and that natural alternative splicing exploits this principle for modulation of the gating properties of calcium channels.—Herzig, S., Khan, I. F. Y., Gründemann, D., Matthes, J., Ludwig, A., Michels, G., Hoppe, U. C., Chaudhuri, D., Schwartz, A., Yue, D. T., Hullin, R. Mechanism of Cav1.2 channel modulation by the amino terminus of cardiac ß2-subunits.


Key Words: cardiac electrophysiology • calcium channel subunit • dihydropyridine


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
THE HIGH VOLTAGE-ACTIVATED L-type calcium channels are multimeric proteins composed of pore-forming subunits Cav1.1–Cav1.4 (1) , auxiliary ß-subunits ß1–4 (2 3 4 5 6) , {alpha}2{delta}-(7 8 9) , and, in some tissues, additional {gamma}-subunits (10) . Coexpression of ß-subunits modulates the Cav1.2-mediated calcium inward currents at macroscopic (11 , 12) and microscopic levels (12 , 13) , and encompasses the high-affinity receptor sites for dihydropyridines (DHP) (14 , 15) . Furthermore, channel gating and membrane expression of the Cav1.2 (16 , 17) may depend on gene expression level (18) and cellular distribution of ß-subunits (19) .

Five distinct full-length ß2-splice variants have been cloned from human myocardium: ß2a to ß2e (for nomenclature, see ref. 20 ); evidence for even more splice variations isoforms has been obtained (21 , 22) . The splice variants ß2a to ß2e differ only in the composition and length of their amino-terminal domain (D1). This raises the question of their physiological significance because the large carboxyl-terminal portion of the subunit (D2–D5), which is known to be highly conserved among ß-subunit genes and species (23) , and mediates interaction with the {alpha}-subunit (24 25 26 27) . More recently it was reported that the D2-D5 portion of the ß-subunit resembles the anchor protein family of membrane-associated guanylate kinases (MAGUK comprising an amino-terminal PDZ domain, an src homology SH3, and a guanylate kinase GK element; see ref. 28 ). In addition to binding, SH3 and GK domain structures are able to determine trafficking and gating effects imposed on the pore by the ß-subunit (29) . Structure, assembly, and binding of various ß-subunits to AID were validated by X-ray crystallography (ß2a2a+AID: refs. 30 , 31 ; ß33+AID and ß4: refs. 32 ). It is interesting that all three crystallography studies used amino-terminally truncated ß-subunits, leaving open the question of the role of the amino terminus, which has functional importance (20 , 22 , 33 34 35) .

Single-channel recording provides detailed, specific information on the actual activity of the channel molecule irrespective of membrane targeting and other possible long-term effects. We chose this method with transient coexpression of native and mutant ß2 constructs on a stable Cav1.2 expression background in human embryonic kidney (HEK) 293 cells (13) for a detailed structure-function analysis of the ß2 amino-terminal regions. The aim of the study was to answer the following questions. 1) Is the differential modulation of Cav1.2 channels by amino-terminal ß2-subunit splice variants confirmed at the single-channel level? 2) What biophysical mechanism determines the intensity of differential modulation? 3) What structural property of ß2-subunit amino termini governs biophysical function?

Our findings strongly suggest that the single-channel gating is differentially activated by the ß2-subunit isoforms, depending on the length of the isoform-specific amino terminus.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Immunoblot
Microsomal membranes from human adult male heart ventricle were prepared in a buffer containing 20 mmol/L MOPS, pH 7.4, 300 mmol/L sucrose, 2 mmol/L EDTA, and a protease inhibitor cocktail. Membrane proteins (100 µg) were separated on a 7.5% SDS-polyacrylamide gel and blotted onto nitrocellulose. The blot was decorated with a ß2-specific antibody (36) and developed using enhanced chemoluminescence.

Quantitative gene expression
Quantification was performed with the iCycler iQ real-time polymerase chain reaction (PCR) detection system using primer/fluorescent probe concentrations of 200 nmol/L in either 1 x iQ Supermix 2a-e) or iQ SyBr Green (cardiac calsequestrin) (all Bio-Rad, Hercules, CA, USA). SyBr Green-based quantification was always followed by melt curve analysis (70°C to 94°C at 0.5°C steps). Quantitation of ß2a-e expression was set up with common antisense primer and common fluorescent probe (antisense primer 5'-CCGGTCCTCCTCCAGAGAT, fluorescent probe 5'-6FAM ATGGACGGCTAGTGTAGGAGTCTGCCGA XT p, nn 110–89, nn 79–52, respectively, based on AF423189) and isoform-specific sense primers (ß2a: 5'-GCATCGCCGGCGAGTA, nn 21–36, GeneBank AF423189; ß2b: 5'-GACAGACGCCTTATAGCTCCTCAA, nn 7–30, GeneBank AF285239; ß2c: 5'-AGTGGACTGGACCTGCTGAA, nn 13–32, GeneBank AF423190; ß2d: 5'-GCCGCCGCACAGTCATAT, nn 109–126, GeneBank AF423191; ß2e: 5'-CCAAGGGAGGAAGGCTGAA, nn 35–53, GeneBank AF423192). Isoform-specific standard curves had 103–107 copies of pCR2.1 plasmids containing subcloned segments of the respective coding sequences cloned by reverse transcription (RT) -PCR using isoform-specific sense and common antisense primers with reverse transcribed mRNA isolated from male adult human nonfailing LV. Myocardial probes were always measured as duplicates. Gel electrophoresis of real-time PCR reactions always visualized a single amplification product. Correlations and efficiencies were 0.991–0.998 and 90.3–98.2%, respectively. In each myocardial specimen, ß2-subunit isoform expression was normalized to cardiac calsequestrin expression (18) . For cardiac calsequestrin, sense primer 5'-CTGAGCATCCTGTGGATCGAC and antisense primer 5'-TGTGGCCTGAATAGGTCAATCTT were from GeneBank positions D55655: 1010–1030 and 1098–1076, respectively. Amplification protocol was 94°C, 3 min; 57.8°C and 94°C, 30 and 20 s, 40 times; hold 25°C. Correlations and efficiencies were 0.997–0.999 and 90.1–97.5%, respectively.

Cloning of ß2 splice variants
Cloning and sequencing ß2-subunits
Full-length ß2-subunit isoform sequences were cloned from mRNA isolated from human adult male left ventricular myocardium using two pairs of sequence-specific primers derived from GenBank sequences (ß2a: U95019; ß2b: AF285239; ß2c: AF423190; ß2d: AF423191; ß2e: AF423192). Amino-terminal coding sequences for ß2-subunit splice variants were generated using isoform-specific primer pairs. ß2a: sense primer 5'-CTCTTCATGCAGTGCTGCGGGCTGGT-3'and antisense primer 5'-ACTTCCGCTAAGCTTGACCTTGTG-3' (nn: 496–521 and 1397–1374, respectively, based on U95019), length 902 bp; ß2b: sense primer 5'-ATGCTTGACAGACGCCTTATAGCT-3' and antisense primer 5'-ACTTCCGCTAAGCTTGACCTTGTG-3' (nn: 1–24 and 899–876 based on AF285239), length 899 bp; ß2c: sense primer 5'-ATGAATCAGGGGAGTGGACTGGAC-3' and antisense primer 5'-ACTTCCGCTAAGCTTGACCTTGTG-3' (nn: 1–24 and 977–894 based on AF423190), length 977 bp; ß2d: sense primer 5-ATGGTCCAAAGGGACATGTCCAAG-3' and antisense primer 5'-ACTTCCGCTAAGCTTGACCTTGTG-3' (nn: 1–24 and 1061–1038 based on AF423191), length 1061 bp; ß2e: sense 5'-ATGAAGGCCACCTGGATCAGGCTT-3' and antisense 5'-ACTTCCGCTAAGCTTGACCTTGTG-3' (nn: 1–24 and 917–894, respectively, based on AF423192), length 917 bp. The carboxyl-terminal 954 bp fragment was amplified by sense primer 5'-CACAAGGTCAAGCTTAGCGGAAGT-3' and antisense primer 5'-GGCAAAACTCATTGGGGGAT-3' (nn: 1374–1397 and 2327–2308, respectively, based on U95019), length 1146 bp. Amplification was performed in cDNA reverse transcribed (Revert Aid Kit, MBI Fermentas, Burlington, ON, Canada) from mRNA isolated from nonfailing human left ventricular myocardium using Trizol (Invitrogen, Carlsbad, CA, USA) and the poly(A)tract kit (Promega, Madison, WI, USA). PCR conditions always were 40 cycles of 94°C, 58°C, 72°C, each 1 min; and 5 min 72°C. Amplification products were verified by UV protected 0.8% agarose gel electrophoresis, extracted (Perfect Gel Clean-up, Eppendorf-Vaudaux, Basel, Switzerland), and subcloned into pCR2.1-TOPO (Invitrogen). Sequences of cloned fragments were determined on both strands (MWG Biotech, Ebersberg, Germany). For eukaryotic expression, full-length ß2-subunit isoforms were reassembled in the pcDNA3 polylinker region (Invitrogen) opened by BamHI/NotI. Full-length coding sequences were inserted by T4 DNA ligation of amino-terminal ß2-subunit isoform fragments cut by BamHI (pCR2.1 restriction site) and HindIII (internal restriction site contained in all ß2-subunit isoforms) and of the carboxyl-terminal fragment cut by HindIII and NotI (pCR2.1 restriction site). {alpha}2{delta}-1 (7) cDNA was also contained in pcDNA3 (13) .

Construction of mutant ß2-subunits
Construction of pcDNA3-ß2d–del
To delete internally 55 amino acids from the D1 sequence of ß2d as indicated in Table 1 , two fragments were generated by PCR with pcDNA3-ß2d as template. Insert A (222 b) was amplified with primers FpcDNA3 (5'-GTA CGG TGG GAG GTC TAT AT) and RAB2D (5'-GAG CGTCTC TAACC CGC CGC CGC CGC TGT GGG A; Esp 3I site underlined). Insert B (288 b) was amplified with primers FBB2D (5'-GAG CGTCTC T GGT TCG GCA GAC TCC TAC; Esp 3I site underlined) and RBB2D (5'-ACC AAT CGC CCT ATC CAC CAG). Both amplicons were separately cloned into pUC19 with Escherichia coli DH10B as host (37) and sequenced on both strands. For the assembly of pcDNA3-ß2d–del, insert A was released by restriction with BamHI and Esp 3I, and insert B was released with Esp 3I and Bst BI. The vector frame consisted of two unaltered fragments of pcDNA3-ß2d. Frame A (5.6 kb) was prepared by restriction of pcDNA3-ß2d with BamHI, incubation with alkaline phosphatase, and restriction with Esp 3I. Frame B (1.34 kb) was prepared by restriction of pcDNA3-ß2d with Bst BI, incubation with alkaline phosphatase, and restriction with Esp 3I. Inserts A and B and frames A and B were isolated by UV-protected agarose gel electrophoresis (38) , joined all at once with T4 DNA ligase, and electroporated into DH10B (37) . The resulting plasmid, pcDNA3-ß2d–del, was verified by sequencing and prepared for transfection (13 , 37) .


View this table:
[in this window]
[in a new window]

 
Table 1. L-type calcium channel ß-subunits used for heterologous coexpressiona

Construction of pcDNA3-ß2abab
To create a tandem repeat of the D1 sequences of ß2a and ß2b as indicated in Table 1 , two fragments were generated by PCR with pcDNA3-ß2a as template. Insert C (275 b) was amplified with primers FpcDNA3 and RCB2A (5'-GAG CGTCTC T CCC AGG AAT AAT GTA TTT AGT TTG AGG automatic gain control (AGC) TAT AAG GCG TCTG TCA AGC ATA TAG GAC ACC CGT AC; Esp 3I site underlined). Insert D (127 b) was amplified with primers FDB2A (5'-GAG CGTCTC T TGG GAT GCA GTG CTG CGG GCT; Esp 3I site underlined) and RDB2A (5'-GAG CGTCTC TAACC CCC AGG AAT AAT GTA TTT AGT TTG AGG AGC TAT AAG GCG TCT GTC AAG CAT ATA GGA CAC CCG TAC; Esp 3I site underlined). Primers RCB2A and RDB2A were purified by PAGE at the manufacturer (biomers.net, Ulm, Germany). For the assembly of pcDNA3-ß2abab, insert C was released by restriction with BamHI and Esp 3I, and insert D was released with Esp 3I. Inserts C and D were isolated as above and ligated in a single reaction with insert B and frames A and B. All other steps were as described above for the construction of pcDNA3-ß2d–del.

Cell culture and cotransfection
Cell culture and transient cotransfection were performed as described (13 , 39) . In brief, HEK 293 cells were stably transfected with the full-length Cav1.2-subunit (GeneBank #NM_000719) cloned from human heart (40) . Cells were seeded in polystyrene Petri dishes (9.6cm2; Falcon, Heidelberg, Germany) at a density of 1–2 · 104 cells cm–2 and transiently cotransfected with cDNA plasmids encoding the different human cardiac ß2-splice variants together with the {alpha}2{delta}-1-subunit from rabbit skeletal muscle (7) and green fluorescence protein (pGFP, BD Biosciences Clontech, Palo Alto, CA, USA; GeneBank #U19280). Lipofection was carried out 24–36 h after plating by incubating (3–6 h) with SuperFect (Qiagen, Valencia, CA, USA) and the respective plasmids at a DNA mass ratio of 3:3:1 (13) . Transfected cells were grown (37°C and 6% CO2) on Petri dishes in Dulbecco’s modified Eagle medium (DMEM, Biochrom KG, Berlin, Germany) supplemented with 10% FBS (Sigma, Deisenhofen, Germany), penicillin (10 U ml–1), and streptomycin (10 µg x ml–1, both from Biochrom). Electrophysiological recordings in GFP-positive cells were obtained 48–72 h after transfection.

Single-channel recordings
Single-channel currents through L-type calcium channels were measured at room temperature (19–23°C). Single-channel measurements and analysis were as reported (13 , 16 , 41) . Cells were superfused with depolarizing bath solution containing (in mmol/L) K-glutamate 120, KCl 25, MgCl2 2, HEPES 10, EGTA 2, CaCl2 1, Na2-ATP 1, dextrose 10 (pH 7.4 with NaOH, 21–23°C). Pipettes (7–10M{Omega}) were filled with (in mmol/L) BaCl2 110, HEPES 10 (pH 7.4 with TEA-OH). Single calcium channels were recorded in the cell-attached configuration (depolarizing test pulses of 150 ms duration at 1.67 Hz, holding potential –100 mV). An Axopatch 1D amplifier with pClamp 5.5 or 6.0 software (both from Axon Instruments, Foster City, CA, USA) was used for pulse generation, data acquisition (10 kHz), and filtering (2 kHz, –3 dB, 4-pole Bessel). Experiments were analyzed whenever the channel activity persisted for at least 72 s (≥120 sweeps).

Single-channel gating analysis
Linear leak and capacity currents were digitally subtracted. Openings and closures were identified by the half-height criterion. The availability (fraction of sweeps containing at least one channel opening), the open probability (Popen, defined as the relative occupancy of the open state during active sweeps), and the ensemble average peak current (Ipeak, obtained visually) were analyzed for one-channel (k=1) and multichannel patches (k≤3). In the latter case, they were recalculated based on k, the number of channels in the patch (see below); k was defined as the maximum current amplitude observed divided by the unitary current. Peak current was corrected by division through k. Closed-time, first-latency, and open-time histogram analyses were carried out in patches where k = 1. Time constants of open-time and closed-time histograms were obtained by maximum-likelihood estimation using pSTAT software (Axon Instruments) on log-transformed data (42) . Time-dependent inactivation was determined by taking the maximum peak of the ensemble average current Ipeak near the beginning of the pulse and the remaining average current I150 at the end of the 150 ms test pulse. Calculations were based on the following equations:

Formula 1(1)

Formula 2(2)

Formula 3(3)

Formula 4(4)

Formula 5(5)

Formula 6(6)

Formula 7(7)
i[{Delta}t j)

k = number of detected channels in the patch

j = open event time index (j=0... 1500)

m = sweep index

{Delta}t = interval of time resolution is 100µs (=10 kHz)

i[{Delta}t j) = time-dependent amplitude of the jth first open levels

t0 = pulse duration [ms]

M0 = total number of sweeps

Ma = number of active sweeps

topen = open times [ms]

tclosed = closed times [ms]

tlatency = first latencies [ms]

Ipeak = peak of the ensemble average current [fA]

I150 = ensemble average current after 150 ms of depolarization [fA]

Availability was recalculated for only one channel according to


Formula 8

(8)
Based on recalculated availability for one channel, single-channel mean open probability is then given by:

Formula 9(9)

Descriptive statistics
Effects of the ß2-subunits on single-channel parameters were statistically examined by T tests of each ß2 group vs. sham controls (i.e., cells cotransfected with {alpha}2{delta}-1, GFP and an "empty" pcDNA3) to verify successful transfection within the sample. In addition, one-way ANOVA was performed over the whole series (i.e., cells cotransfected with cDNAs encoding for ß2 and {alpha}2{delta}-1) to identify differencs among ß2-subunit isoforms. Student or alternate Welch T tests (used in case of different SDs between samples) were considered significant at the level of P < 0.05. Significant ANOVAs (P<0.05) were followed by post hoc tests among ß2-subunits, applying Bonferroni correction for multiple comparisons (P<0.05 was considered significant). All values are given as mean ± SE based on n, the number of independent experiments.

Stochastical modeling of channel number
PMAX (maximum of simultaneously open channels) is an estimator for n, the exact number of channels in a patch (43) with k simultaneous detected openings (stacked current levels). PMAX is only reliable for patches where k < 4, as included here for analysis. The PMAX probability Prob[channel n=k) is then given by:

Formula 10(10)
with k = number of simultaneous openings ("seen" channels), n = real number of channels, Po,all = single-channel open probability calculated over the entire recording time, and M = total number of sweeps.

Modeling of single-channel gating
The gating scheme and modeling procedure were adopted exactly from Colecraft et al. (12) . In brief, idealized data from single-channel records (k=1) with optimal signal-to-noise ratio were used to compute the time course of open probability within the sweep and to construct cumulative distribution functions of first latency, open times, and closed times. These data were simultaneously fitted by a Simplex algorithm (Matlab, MathWorks, Natick, MA, USA), with starting values set by eye (12) and adjusted according to the visual quality of the initial simulation (12) . Robustness of fits was assessed by 10-fold variations of the individual rate constants. As in the previous study, variations of k12 and k21 did not affect the quality of fits, so these parameters were held constant.

Drugs
The active enantiomer of the calcium agonist, (S)-BAY K8644 (Sigma-Aldrich, St. Louis, MO, USA) was dissolved (light-protected) in absolute ethanol as a 1 mmol/L stock solution. This stock solution was diluted to 0.1 mmol/L for daily use and a 20 µl bolus was added to the bath to obtain a final agonist concentration of 1 µmol/L. The final ethanol concentration was 0.1%.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Cardiac expression of ß2-subunit isoforms
A polyclonal antibody directed against a ß2-subunit carboxyl-terminal sequence motif in the D5 domain (36) detected a single band of 70 kDa in human left ventricular tissue (Fig. 1 A). We therefore isolated the full-length coding sequences of five different ß2 isoforms in nonfailing left ventricular human heart mRNA. Sequences of all five ß2-subunit splice variants (ß2a-e) corresponded to published sequences in the GeneBank (for respective GeneBank coding numbers, see Materials and Methods). All five ß2-subunit isoforms were identical in the D2 to D5 regions (589 residues). Differential splicing was restricted to the D1 region encoding amino termini from 16 (ß2a) to 71 (ß2d) amino acids (Table 1) . Real-time RT-PCR using isoform-specific amino-terminal primers demonstrated disparate gene expression of each isoform 2a:194±18 copies; ß2b: 149300±62582 copies; ß2c:4910±2210 copies; ß2d: 2378±687 copies; ß2e: 508±86 copies) in normal adult human left ventricular myocardium.


Figure 1
View larger version (31K):
[in this window]
[in a new window]

 
Figure 1. Expression of the ß2-subunit in human heart. A) Immunoblot. Membrane proteins from human left ventricular heart ventricle (100 µg) were separated on 7.5% SDS-polyacrylamide gel and blotted onto nitrocellulose. The blot was decorated with a ß2-specific antibody and developed with enhanced chemoluminescence. B) Quantitative gene expression of five ß2-subunit isoforms in mRNA isolated from human left ventricular myocardium (n=3): bar plots (mean±SE) demonstrate gene expression levels of each ß2-subunit isoform; 2% agarose gel electrophoresis of real-time, ß2 isoform-specific RT-PCR demonstrates specific amplification.

Cav1.2 modulation by natural ß2-subunit splice variants
HEK 293 cells stably expressing a human cardiac splice variant Cav1.2 of the L-type calcium channel pore were cotransfected with {alpha}2{delta}-1-subunits and either ß2a, ß2b, ß2c, ß2d, or ß2e. Typical traces from single-channel experiments are depicted in Fig. 2 . The modulatory effect of ß2-isoforms differs markedly between isoforms. This is easily appreciated by visually comparing open probability and the frequency of active sweeps (availability). Statistical analysis of fast gating (Table 2 ) confirms successful transfection and modulation of pore subunits by all ß2-subunits. Open probability and ensemble peak current are significantly affected by all-natural ß2-subunits compared with controls (using empty pcDNA3 vectors). Mean first latency is shortened by all isoforms except for ß2d. Availability and the rate of inactivation of ensemble average currents are significantly affected by ß2a and ß2b only. In summary, all five natural human cardiac ß2 splice variants increase channel activity but at different magnitudes. Indeed, significant differences among the ß2-subunits were identified for peak current, availability, inactivation, open probability, mean first latency, and the slow closed-time component {tau}closed slow (ANOVA: ß2a-e, P<0.05). Here, the single-channel gating indicates a consistent rank order of activity: the strongest modulators are ß2a, ß2b (shortest D1=16, 17 aa), followed by ß2e (D1=23 aa) and ß2c (D1=43 aa). The weakest modulator is ß2d (longest D1=71 aa). This array of activity gives a first hint that the length of the amino-terminal D1 domain may be relevant for the functional differences noted. However, conserved structural motifs (cp. ß2d and ß2c), or structural dissimilarities (cp. ß2a and ß2b) had no apparent influence on function in various analyses (Tables 1 and 2) . To further scrutinize the concepts of length- and motif-based modulation, we created mutant ß2-subunits.


View this table:
[in this window]
[in a new window]

 
Table 2. ß2-Subunit effects on single-channel properties of recombinant L-type channelsa

Effects of mutant ß2d_del- and ß2abab-subunits
To examine a truncated version of the weak modulator ß2d, ß2d_del was shortened by 55 aa between residues 17 and 71, thus exactly matching ß2a in length. Conversely, a long chimeric construct containing tandem repeats of the ß2a and ß2b amino termini was made to mimic ß2d in length (D1: 66 and 71 aa, respectively). After transfection of ß2d_del, highly active channels were observed, with gating behavior comparable to ß2a or ß2b. Opposite biophysical characteristics were observed with the elongated ß2abab construct (Fig. 2 , Fig. 3 ). In the biophysical fingerprint of the entire data sets, both ß2 mutants are in accordance with the modulation of the single calcium channels as a function of the length of the D1 domain. Analysis of first latency, closed-time, and open-time histograms for ß2d_del and ß2abab (Fig. 3 , Table 2 ) confirms that the mutant constructs are functionally active (significant effects vs. pcDNA3 control) and imitate their length-matched natural counterparts regarding extent and mechanism of channel modulation. Inspection of all those gating parameters that are differentially affected by ß2-subunits reveals the same rank order:


Figure 2
View larger version (30K):
[in this window]
[in a new window]

 
Figure 2. ß2-subunit effects on single-channel behavior of recombinant L-type channels. HEK 293 cells stably expressing human cardiac Cav1.2 were transiently transfected with separate vectors encoding {alpha}2{delta}-1, GFP, and the ß2-subunits [ß2a-e, two mutant constructs and empty plasmid construct DNA (pcDNA) vectors as control] as indicated. The top row illustrates the pulse protocol (150 ms pulse length, holding potential of –100 mV, test pulse to +10 mV, applied every 600 ms). Twenty representative consecutive traces (of at least 180 recorded per experiment) are depicted for each channel complex.


Figure 3
View larger version (19K):
[in this window]
[in a new window]

 
Figure 3. Single-channel properties of Cav1.2 · ß2 · {alpha}2{delta}-1 complexes, as derived from pooled data. For number of experiments included, see n in Table 2B (A–C) or Table 2A (D), respectively. A) Cumulative first latency function. B) Closed-time histograms. C) Open-time histograms. D) Ensemble average current.

Peak ensemble average current: ß2a {approx} ß2b {approx} ß2d_del > ß2e {approx} ß2c > ß2d {approx} ß2abab

Availability: ß2a {approx} ß2b {approx} ß2d_del > ß2e {approx} ß2c {approx} ß2d {approx} ß2abab

Open probability: ß2a > ß2b {approx} ß2d_del {approx} ß2e {approx} ß2c > ß2d {approx} ß2abab

Time-dependent inactivation: ß2a < ß2b {approx} ß2d_del {approx} ß2e < ß2c {approx} ß2d {approx} ß2abab

First latency: ß2a {approx} ß2b {approx} ß2d_del < ß2e {approx} ß2c < ß2d {approx} ß2abab

Closed-time constant {tau}slow: ß2a {approx} ß2b {approx} ß2d_del {approx} ß2e {approx} ß2c < ß2d {approx} ß2abab

Again, this rank order reflects exactly their rank order of amino-terminal length. To confirm this quantitatively, gating parameters were plotted against the respective length of amino termini and subjected to linear regression. Correlations were statistically significant (Fig. 4 A–E: P<0.05) or showed a consistent trend (Fig. 4F : P=0.08). This picture of various aspects of channel function confirms the idea that ß2-subunit action depends on the length of domain D1.


Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
Figure 4. Structure-function relationship of natural and mutant subunits. Single-channel parameters are plotted against the respective length of the amino terminus (D1 domain). Natural (ß2a-e) and mutant (ß2d_del and ß2abab) ß-subunit isoforms are depicted as solid and open symbols, respectively. Linear regression analysis reveals significant correlations (r=Pearson correlation coefficient, P<0.05 indicates significance) between activity parameters and amino-terminal length. A) Peak current. B) Availability. C) Open probability. D) Inactivation. E) Mean first latency. F) Closed-time constant {tau}closed,slow.

Validation of channel number
Before being carried to the next step, our analysis has to withstand one important methodological caveat. Calculation of single-channel parameters, especially in recombinant cell systems, usually requires a bona fide approach that the true number of channels in the patch matches k, the number of observed open levels. Unfortunately, one of the main reported effects of ß-subunits is elevation of Cav1.2 membrane expression (22) , which increases the bias to underestimate channel number (13) . A way to improve certainty is to enhance single-channel open probability. This can be achieved by use of a channel agonist like (S)-Bay K 8644 (Bay K). Bay K was routinely avoided here, but we used it in some experiments ex posteriori to assure the number of channels (see Materials and Methods). In none of the five supposed one-channel patches tested and in only three of eight experiments with multichannel patches, the number of "seen channels" was elevated by Bay K, whereas the drug significantly and substantially elevated peak ensemble current and open probability (ß2a: 644±95fA and 40.0±5.1%, n=4; ß2b: 471±186fA and 19.4±7.2%, n=6; ß2d: 445±170fA and 15.9±5.2%, n=8).

In addition, we estimated channel numbers by stochastic simulation (13 , 43) . The probability that the true number of channels equals the number of opening levels observed should increase with higher open probability, longer recording time, and lower channel number. This relationship was empirically verified for our datasets (Table 3 ). In absolute terms, the probability of an accurate estimation of channel number is well above 90% in putative one-channel patches with ß2-subunit transfection. Thus, analysis of experiments with only one observed open level (see, e.g., Table 2B , Fig. 3A-C , Fig. 4E, F ) creates negligible bias in terms of underestimating the channel number in the patch. Therefore, the next step of detailed biophysical analysis was restricted to one-channel experiments.


View this table:
[in this window]
[in a new window]

 
Table 3. Estimation of channel number na

Detailed biophysical mechanisms of ß2-subunit modulation of gating
Prima facie mechanisms of channel activity (which affect open probability and peak current) are closed-closed transitions (deduced from closed-state duration, {tau}closed and first latency), closed-open transitions (deduced from open state duration and {tau}open), and inactivation (time-dependent reduction of ensemble average currents, availability). Inspection of the qualitative descriptors of single-channel activity (Table 2) hints that transitions linked to closed and inactivated states account for the functional divergence between ß2-subunits regarding single-channel kinetics. This would resemble differences already described between ß-subunit genes (12 , 13) or within ß2-subunit isoforms (20) , respectively. Because these parameters are still intricately linked, we scrutinized the elementary biophysical mechanisms at the level of individual rate constants within a well-defined gating mechanism (Fig. 5 A). This mechanism has been successfully used to model the entire repertoire of single-channel behavior of L-type channels in cardiomyocytes overexpressing various ß-subunits (12) . Here, the time course of open probability vs. sweep length, the first latency function, and the open- and closed-time distributions were modeled simultaneously. Data were pooled from one-channel experiments with high signal-to-noise ratios. Under these constraints, enough sweeps could be recruited for ß2b, ß2d, and ß2c, which represent the extremes and an intermediate position of our structure-activity array, respectively. Fits mirror satisfactorily the original data (Fig. 5) and converge reliably (Table 4 ). Only 4 of the 12 rate constants were substantially different between ß2-subunits, each fulfilling the overall structure-activity rank order of ß2b > ß2c > ß2d. These four rate constants were either exit rates from deep closed states (k23 and k34) or the rates defining inactivated states ({gamma} for exit and {lambda} for entry, respectively). Consistent with these findings, the steady-state probability of C1, which reflects the proportion of channels not being inactivated at the beginning of the sweep, reiterates the ß2b > ß2c > ß2d sequence. Of note, the fast near-open or open-closed transitions (e.g., k45, k54, {kappa}, {delta}) are hardly affected, explaining why large differences in popen coincide with rather similar open times and closed times for the different isoforms (Table 2) . In summary, a channel containing a weakly activating ß2-subunit (e.g., ß2d) more likely resides in deep closed states and in the "inactivated" state, and thus rarely occupies the open or near-open closed states.


Figure 5
View larger version (23K):
[in this window]
[in a new window]

 
Figure 5. Quantitative modeling of single-channel gating behavior with ß2b, ß2c, and ß2d. Idealized data from high-quality, one-channel (k=1) experiments (cf. Table 4 ) were used to compute the time course of open probability within the sweep and to construct cumulative distribution functions of first latency, open times, and closed times (black and gray). Fits are displayed as smooth red curves. Parameters obtained by the fits are summarized in Table 4 . A) Gating mechanism underlying the fits is displayed below. B) Data and best fit for ß2b (780 sweeps from n=4 experiments). C) Data and best fit for ß2c (2460 sweeps from n=10 experiments). D) Data and best fit for ß2d (1200 sweeps from n=7 experiments).


View this table:
[in this window]
[in a new window]

 
Table 4. Rate constants from model fits of data obtained with ß2b-, ß2c-, and ß2d-subunitsa


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Gene expression of ß2-subunit isoforms
ß2-subunit gene expression has been demonstrated in the human heart at the mRNA level (44) and at the protein level (45) . Because of the lack of a suitable antibody specific for the amino terminus of the ß2-subunit, we confirmed expression of the five cloned splice variants by RT-PCR using isoform-specific primers.

Modulation of single-channel gating parameters by amino-terminal length
Single-channel analysis demonstrated that all five natural human cardiac ß2 splice variants increase channel activity, but at clearly different magnitudes. Our findings show that the extent of ß2-subunit isoform-specific modulation of single-channel gating is determined by the length of the amino-terminal amino acid sequence. We think that neither structural motifs in the D1 domain nor palmitoylation (33) or clusters of arginine and lysine are important for activity. At the single-channel level, ß2a and ß2b induce similar electrophysiological fingerprints, although the amino terminus of the ß2b-subunit does not contain a palmitoylation signal. All ß2-subunits contain clusters of basic arginines and lysines in the D1 domains, but despite an identical RRK-R motif in ß2c and ß2d, the biophysical properties of these isoforms differ. In addition, ß2a and ß2b have different arginine patterns 2a: RRR-R; ß2b: RR) but their biophysical activities are similar. Without excluding all possible factors relevant for whole-cell currents (like membrane targeting, 20 , 33 ), single-channel gating of the five distinct ß2-subunit isoforms suggests no other candidate for a specific modulatory domain besides amino-terminal length.

This idea can be examined in numerous ways—for example, replacing the natural amino terminus by the amino terminus of another ß-subunit, by random sequences of amino acids, or by polyalanine peptides. As a first step, we tested the structure/function relation in the D1 domain by constructing two different chimeras: ß2d_del, a shortened version of the weak modulator ß2d created by internal deletion of 55 aa, and ßabab, which contained tandem repeats of the ß2a and ß2b amino termini to mimic ß2d in length. Both ß2 mutants maintained the concept of length-dependent modulation since transfection of ß2d_del induced highly active single channels with gating behavior comparable to ß2a or ß2b, whereas the elongated ß2abab construct demonstrated opposite effects with replication of the ß2d phenotype. Thus, the mutant constructs imitate the magnitude and mechanism of channel modulation of their length-matched natural counterparts, which reinforces our new mechanism of ß2-subunit action on calcium current.

Detailed biophysical mechanisms of ß2-subunit modulation
Mechanisms of single-channel activity (which affect open probability and peak current) are closed-closed transitions, closed-open transitions, and inactivation. Four rate constants were identified that were substantially different between the ß2-subunits examined when modeling the time course of open probability vs. sweep length, the first latency function, and the open- and closed-time distributions. These rate constants were two exit rates from deep closed states and the rates defining inactivated states. The rank order of activity (ß2b > ß2c > ß2d) reiterates the pattern identified by the descriptive single-channel analysis, affirming the concept of length-dependent modulation. Mechanistically, this implies that weakly activating ß2-subunits with a long amino terminus (e.g., ß2d) are more likely to adapt and reside in the "inactivated" state. This explains the phenomenon of inactivation time course and, in part, the slow first latency function, low availability and open probability. In addition, weakly activating ß2-subunits remain in deeper closed states, which affects closed-time distributions, first latency, and open probability. A long amino terminus favors inactivation and maintains deep channel closure.

Comparison with previous electrophysiological data
Differences between ß2-subunit isoforms have been examined at the whole-cell level (20 , 21 , 22) , and single-channel biophysics were examined for different ß-subunit genes (12 , 13) . Confirming and extending the latter, we find that the ß2-subunit affects transitions between deep closed states. Regarding the inactivation rate, the biophysical pattern of amino-terminal isoforms corresponds in large part to whole-cell data by Takahashi et al. (20) ; however, they reported slow inactivation with ß2a and ß2e, but not with ß2b. Future single-channel work exploiting a wider range of test potentials should resolve this issue.

Implications for physiological or pathological channel function
Our data provide evidence that the D1 domain of the ß2-subunit confers significant effects on channel function. In contrast to the large core portion of the ß2-subunit, the 3-dimensional structure of the flexible ß2-subunit D1 domain has not been resolved due to its flexibility (30 , 31) . Similar problems were encountered when crystallizing the ß3- and ß4-subunit (32) . Our biophysical findings indicate that the length of the amino-terminal D1 domain plays a crucial role in fine-tuning regulation of the calcium channel activity independent of its amino acid composition. This is supported by data from an earlier study (11) , where a GFP tag that was fused to the amino terminus of rat ß2-subunits resulted in analogous changes of whole-cell peak current and time-dependent inactivation.

Our results provide a mechanistic understanding of elusive calcium channel modulation described for ß1–4-subunit genes (12 , 13 , 20) and ß2-subunit isoforms (20 , 22) . The differential modulation by amino termini provides a physiological rationale for differential splicing of the ß2-subunit gene in heart (13 , 21 , 22) and broadens the view of complexity of auxiliary subunitfunction (e.g., in the context of gating kinetics associated with calcium "channelopathies") (46) . This biophysical design could also explain how, by exploiting the diversity and regulation of their subunit splice isoforms, cells can optimize the physiological gating properties of ion channels.


   ACKNOWLEDGMENTS
 
The authors gratefully acknowledge Patrizia Castiglioni, Ramona Weingarten, and Katja Rolshofen for excellent technical help, and Drs. F. Hofmann and N. Klugbauer (Technical University of Munich) for generously providing the {alpha}2{delta}-1 plasmid. Supported by Deutsche Forschungsgemeinschaft, DFG (He 1578/6–4, Hu 586/2–2), by the Center of Molecular Medicine Cologne, CMMC (TV 81/A5 to S.H. and U.C.H.), by the National Institutes of Health (R01 HL079599–01 and T32 HL07382–30 to A.S.), and by Katharina Huber Steiner Stiftung, Bern (R.H.).


   FOOTNOTES
 
1 These authors contributed equally to this work.

Received for publication September 23, 2006. Accepted for publication December 25, 2006.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Ertel, E. A., Campbell, K. P., Harpold, M. M., Hofmann, F., Mori, F., Perez-Reyes, E., Schwartz, A., Snutch, T. P., Tanabe, T., Birnbaumer, L., Tsien, R. W., Catterall, W. A. (2000) Nomenclature of voltage-gated calcium channels. Neuron 25,533-535[CrossRef][Medline]
  2. Ruth, P., Rohrkasten, A., Biel, M., Bosse, E., Regulla, S., Meyer, H. E., Flockerzi, V., Hofmann, F. (1989) Primary structure of the ß subunit of the DHP-sensitive calcium channel from skeletal muscle. Science 245,1115-1118[Abstract/Free Full Text]
  3. Hullin, R., Singer-Lahat, D., Freichel, M., Biel, M., Dascal, N., Hofmann, F., Flockerzi, V. (1992) Calcium channel ß subunit heterogeneity: functional expression of cloned cDNA from heart, aorta and brain. EMBO J. 11,885-890[Medline]
  4. Perez-Reyes, E., Castellano, A., Kim, H. S., Bertrand, P., Baggstrom, E., Lacerda, A. E., Wei, X. Y., Birnbaumer, L. (1992) Cloning and expression of a cardiac/brain ß subunit of the L-type calcium channel. J. Biol. Chem. 267,1792-1797[Abstract/Free Full Text]
  5. Castellano, A., Wei, X., Birnbaumer, L., Perez-Reyes, E. (1993) Cloning and expression of a third calcium channel ß subunit. J. Biol. Chem. 268,3450-3455[Abstract/Free Full Text]
  6. Castellano, A., Perez-Reyes, E. (1994) Molecular diversity of Ca2+ channel ß subunits. Biochem. Soc. Trans. 22,483-488[Medline]
  7. Ellis, S. B., Williams, M. E., Ways, N. R., Brenner, R., Sharp, A. H., Leung, A. T., Campbell, K. P., McKenna, E., Koch, W. J., Hui, A., et al (1988) Sequence and expression of mRNAs encoding the {alpha}1 and {alpha}2 subunits of a DHP-sensitive calcium channel. Science 241,1661-1664[Abstract/Free Full Text]
  8. Felix, R. (1999) Voltage-dependent Ca2+ channel {alpha}2{delta} auxiliary subunit: structure, function and regulation. Receptors Channels 6,351-362[Medline]
  9. Qin, N., Yagel, S., Momplaisir, M. L., Codd, E. E., D’Andrea, M. R. (2002) Molecular cloning and characterization of the human voltage-gated calcium channel {alpha}2{delta}-4 subunit. Mol. Pharmacol. 62,485-496[Abstract/Free Full Text]
  10. Klugbauer, N., Dai, S., Specht, V., Lacinova, L., Marais, E., Bohn, G., Hofmannm, F. (2000) A family of {gamma}-like calcium channel subunits. FEBS Lett. 470,189-197[CrossRef][Medline]
  11. Wei, S. K., Colecraft, H. M., DeMaria, C. D., Peterson, B. Z., Zhang, R., Kohout, T. A., Rogers, T. B., Yue, D. T. (2000) Ca2+ channel modulation by recombinant auxiliary ß subunits expressed in young adult heart cells. Circ. Res. 86,175-184[Abstract/Free Full Text]
  12. Colecraft, H. M., lseikhan, B. A., Takahashi, S. X., Chaudhuri, D., Mittman, S., Yegnasubramanian, V., Alvania, R. S., Johns, D. C., Marban, E., Yue, D. T. (2002) Novel functional properties of Ca2+ channel ß subunits revealed by their expression in adult rat heart cells. J. Physiol. 541,435-452[Abstract/Free Full Text]
  13. Hullin, R., Khan, I. F., Wirtz, S., Mohacsi, P., Varadi, G., Schwartz, A., Herzig, S. (2003) Cardiac L-type calcium channel ß-subunits expressed in human heart have differential effects on single channel characteristics. J. Biol. Chem. 278,21623-21630[Abstract/Free Full Text]
  14. Mitterdorfer, J., Froschmayr, M., Grabner, M., Striessnig, J., Glossmann, H. (1994) Calcium channels: the ß-subunit increases the affinity of dihydropyridine and Ca2+ binding sites of the {alpha}1-subunit. FEBS Lett. 352,141-145[CrossRef][Medline]
  15. Suh-Kim, H., Wie, X., Birnbaumer, L. (1996) subunit composition is a major determinant in high affinity binding of a Ca2+ channel blocker. Mol. Pharmacol. 50,1330-1337[Abstract]
  16. Schröder, F., Handrock, R., Beuckelmann, D. J., Hirt, S., Hullin, R., Priebe, L., Schwinger, R. H., Weil, J., Herzig, S. (1998) Increased availability and open probability of single L-type calcium channels from failing compared with nonfailing human ventricle. Circulation 98,969-976[Abstract/Free Full Text]
  17. Groner, F., Rubio, M., Schulte-Euler, P., Matthes, J., Khan, I. F., Bodi, I., Koch, S. E., Schwartz, A., Herzig, S. (2004) Single-channel gating and regulation of human L-type calcium channels in cardiomyocytes of transgenic mice. Biochem. Biophys. Res. Commun. 314,878-884[CrossRef][Medline]
  18. Hullin, R., Asmus, F., Ludwig, A., Hersel, J., Boekstegers, P. (1999) subunit expression of the cardiac L-type calcium channel is differentially regulated in diastolic heart failure of the cardiac allograft. Circulation 100,155-163[Abstract/Free Full Text]
  19. Nishimura, S., Takeshima, H., Hofmann, F., Flockerzi, V., Imoto, K. (1993) Requirement of the calcium channel ß subunit for functional conformation. FEBS Lett. 324,283-286[CrossRef][Medline]
  20. Takahashi, S. X., Mittman, S., Colecraft, H. M. (2003) Distinctive modulatory effects of five human auxiliary ß2 subunit splice variants on L-type calcium channel gating. Biophys. J. 84,3007-3021[Medline]
  21. Foell, J. D., Balijepalli, R. C., Delisle, B. P., Yunker, A. M., Robia, S. L., Walker, J. W., McEnery, M. W., January, C. T., Kamp, T. J. (2004) Molecular heterogeneity of calcium channel ß-subunits in canine and human heart: evidence for differential subcellular localization. Physiol. Genomics 17,183-200[Abstract/Free Full Text]
  22. Harry, J. B., Kobrinsky, E., Abernethy, D. R., Soldatov, N. M. (2004) New short splice variants of the human cardiac Cavbeta2 subunit: redefining the major functional motifs implemented in modulation of the Cav1.2 channel. J. Biol. Chem. 279,46367-46372[Abstract/Free Full Text]
  23. Birnbaumer, L., Qin, N., Olcese, R., Tareilus, E., Platano, D., Costantin, J., Stefani, E. (1998) Structures and functions of calcium channel ß subunits. J. Bioenerg. Biomembr. 30,357-375[CrossRef][Medline]
  24. Walker, D., Bichet, D., Campbell, K. P., De Waard, D. (1998) A ß4 isoform-specific interaction site in the carboxyl-terminal region of the voltage-dependent Ca2+ channel {alpha}1A subunit. J. Biol. Chem. 273,2361-2367[Abstract/Free Full Text]
  25. De Waard, M., Pragnell, M., Campbell, K. P. (1994) Ca2+ channel regulation by a conserved ß subunit domain. Neuron 13,495-503[CrossRef][Medline]
  26. Pragnell, M., DeWaard, M., Mori, Y., Tanabe, T., Snutch, T. P., Campbell, K. P. (1994) Calcium channel ß-subunit binds to a conserved motif in the I-II cytoplasmic linker of the {alpha}1-subunit. Nature 368,67-70[CrossRef][Medline]
  27. De Waard, M., Scott, V. E., Pragnell, M., Campbell, K. P. (1996) Identification of critical amino acids involved in {alpha}1-ß interaction in voltage-dependent Ca2+ channels. FEBS Lett. 380,272-276[CrossRef][Medline]
  28. Takahashi, S. X., Miriyala, J., Tay, L. H., Yue, D. T., Colecraft, H. M. (2005) CaVbeta SH3/guanylate kinase domain interaction regulates multiple properties of voltage-gated Ca2+ channels. J. Gen. Physiol. 126,365-377[Abstract/Free Full Text]
  29. Yue, D. T. (2004) The dawn of high-resolution structure for the queen of ion channels. Neuron 42,357-359[CrossRef][Medline]
  30. Van Petegem, F., Clark, K. A., Chatelain, F. C., Minor, D. L. (2004) Structure of a complex between a voltage-gated calcium channel ß-subunit and an alpha-subunit domain. Nature 429,671-675[CrossRef][Medline]
  31. Opatowsky, Y., Chen, C. C., Campbell, K. P., Hirsch, J. A. (2004) Structural analysis of the voltage-dependent calcium channel ß subunit functional core and its complex with the {alpha}1 interaction domain. Neuron 42,387-399[CrossRef][Medline]
  32. Chen, Y. H., Li, M. H., Zhang, Y., He, L. L., Yamada, Y., Fitzmaurice, A., Shen, Y., Zhang, H., Tong, L., Yang, J. (2004) Structural basis of the {alpha}1-ß subunit interaction of voltage-gated Ca2+ channels. Nature 429,675-680[CrossRef][Medline]
  33. Chien, A. J., Gao, T., Perez-Reyes, E., Hosey, M. M. (1998) Membrane targeting of L-type calcium channels. Role of palmitoylation in the subcellular localization of the ß2a subunit. J. Biol. Chem. 273,23590-23597[Abstract/Free Full Text]
  34. Olcese, R., Qin, N., Schneider, T., Neely, A., Wei, X., Stefani, E., Birnbaumer, L. (1994) The amino terminus of a calcium channel ß subunit sets rates of channel inactivation independently of the subunit’s effect on activation. Neuron 13,1433-1438[CrossRef][Medline]
  35. Vendel, A. C., Terry, M. D., Striegel, A. R., Iverson, N. M., Leuranguer, V., Rithner, C. D., Lyons, B. A., Pickard, G. E., Tobet, S. A., Horne, W. A. (2006) Alternative splicing of the voltage-gated Ca2+ channel ß4 subunit creates a uniquely folded N-terminal protein binding domain with cell-specific expression in the cerebellar cortex. J. Neurosci. 26,2635-2644[Abstract/Free Full Text]
  36. Ludwig, A., Flockerzi, V., Hofmann, F. (1997) Regional expression and cellular localization of the {alpha}1 and ß subunit of high voltage activated calcium channels in rat brain. J. Neurosci. 17,1339-1349[Abstract/Free Full Text]
  37. Gründemann, D., Babin-Ebell, J., Martel, F., Ording, N., Schmidt, A., Schömig, E. (1997) Primary structure and functional expression of the apical organic cation transporter from kidney epithelial LLC-PK1 cells. J. Biol. Chem. 272,10408-10413[Abstract/Free Full Text]
  38. Gründemann, D., Schömig, E (1996) Protection of DNA during preparative agarose gel electrophoresis against damage induced by ultraviolet light. BioTechniques 21,898-903[Medline]
  39. Erhardt, J., Hynicka, A., DiBenedetto, W., Shen, A., Stone, N., Paulson, N., Pittman, R. N. (1998) A novel F box protein, NFB42, is highly enriched in neurons and induces growth arrest. J. Biol. Chem. 273,35222-35227[Abstract/Free Full Text]
  40. Schultz, D., Mikala, G., Yatani, A., Engle, D. B., Iles, D. E., Segers, B., Sinke, R. J., Weghuis, D. O., Klockner, U., Wakamori, M., et al (1993) Cloning, chromosomal localization, and functional expression of the {alpha}1 subunit of the L-type voltage-dependent calcium channel from normal human heart. Proc. Natl. Acad. Sci. U. S. A. 90,6228-6232[Abstract/Free Full Text]
  41. Michels, G., Matthes, J., Handrock, R., Kuchinke, U., Groner, F., Cribbs, L. L., Pereverzev, A., Schneider, T., Perez-Reyes, E., Herzig, S. (2002) Single-channel pharmacology of mibefradil in human native T-type and recombinant Cav3.2 calcium channels. Mol. Pharmacol. 61,682-694[Abstract/Free Full Text]
  42. Sigworth, F. J., Sine, S. M. (1987) Data transformations for improved display and fitting of single-channel dwell time histograms. Biophys. J. 52,1047-1054[Medline]
  43. Horn, R. (1991) Estimating the number of channels in patch recordings. Biophys. J. 60,433-439
  44. Freise, D., Himmerkus, N., Schroth, G., Trost, C., Weissgerber, P., Freichel, M., Flockerzi, V. (1999) Mutations of calcium channel ß subunit genes in mice. Biol. Chem. 380,897-902[CrossRef][Medline]
  45. Haase, H., Kresse, A., Hohaus, A., Schulte, H. D., Maier, M., Osterziel, H. J., Lange, P. E., Morano, I. (1996) Expression of calcium channel subunits in the normal and diseased human myocardium. J. Mol. Med. 74,99-104[Medline]
  46. Splawski, I., Timothy, K. W., Sharpe, L. M., Decher, N., Kumar, P., Bloise, R., Napolitano, C., Schwartz, P. J., Joseph, R. M., Condouris, K., et al (2004) CaV1.2 calcium channel dysfunction causes a multisystem disorder including arrhythmia and autism. Cell 119,19-31[CrossRef][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-7377comv1
21/7/1527    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Herzig, S.
Right arrow Articles by Hullin, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Herzig, S.
Right arrow Articles by Hullin, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS