|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,1
* Section of Pulmonary and Critical Care Medicine, Yale University School of Medicine, New Haven, Connecticut, USA; and
Division of Pulmonary and Critical Care, New Jersey Medical School, University of Medicine and Dentistry of New Jersey, Newark, New Jersey, USA
2Correspondence: Section of Pulmonary and Critical Care Medicine, Yale University School of Medicine, P.O. Box 208057, New Haven, CT 06520-8057 USA. E-mail: patty.lee{at}yale.edu
| ABSTRACT |
|---|
|
|
|---|
Key Words: oxidant injury angiogenesis endothelial acute lung injury
| INTRODUCTION |
|---|
|
|
|---|
Observations in animal models of HALI indicate that this form of lung injury may result in decreased VEGF expression during the acute phase and increased VEGF synthesis during recovery (7
, 8)
. Although widely distributed in many organs, VEGF is present at high levels in the lung, but its function is not well understood (9)
. VEGF is a family of dimorphic glycoproteins within the platelet-derived growth factor (PDGF) superfamily of growth factors. Although only one of many growth factors, VEGF is required for successful vasculogenesis as well as vascular permeability, mitogen, and survival properties of endothelial cells involved in angiogenesis in the adult vasculature (10)
. VEGF synthesis is stimulated by cytokines, as well as hypoxia, and in cultured endothelial cells prevents apoptosis most likely via induction of antiapoptotic proteins such as the Bcl-2 family members, which stabilize mitochondrial membranes (11)
. It has been shown in an in vivo model that IL-13 is protective in the setting of hyperoxia and that this protection is in large part the result of its ability to induce the expression of VEGF in lung parenchyma, blood vessels, airways, and alveolar macrophages (3)
. Transgenic mice that overexpress VEGF are protected from HALI in part by induction of the antiapoptotic protein Bcl family member A1 (12
, 13)
. However, the absence of A1 does not entirely abrogate the protective effect of VEGF, suggesting there are additional mediators of VEGF-induced cytoprotection (12)
.
Heme oxygenase-1 (HO-1) is one of the most potently induced molecules in response to hyperoxia and has been shown to be protective during HALI (14
15
16)
. HO-1 is the inducible form of heme oxygenase (HO) and is a stress response protein that is synthesized in response to a variety of chemical and physical factors such as lipopolysaccharide (LPS), heavy metals, hemoglobin, and hyperoxia. HO-1 catalyzes the rate-limiting step in the oxidative degradation of heme molecules to biliverdin, producing carbon monoxide and releasing iron. Indirect evidence that HO-1 mediates VEGF-stimulated angiogenesis has been shown in vitro and suggests that induction of HO-1 may play an important role in many VEGF functions (17
, 18)
. Therefore, we hypothesized that VEGF induction of HO-1 might play a significant role in the observed cytoprotection in VEGF transgenic mice exposed to hyperoxia. To test this hypothesis, we characterized the effect of VEGF-induced cytoprotection in the presence of either a chemical inhibitor of HO activity or a HO-1-specific silencing RNA (siRNA) (19)
. Our results demonstrate for the first time that HO-1 mediates the protective effects of VEGF during HALI in vivo.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Administration of short interfering RNA
Synthesis and efficacy of the HO-1 short interfering RNA (HO-1 siRNA) have been described previously (19)
. Mice were anesthetized with methoxyflurane, then given either HO-1 siRNA (2 mg/kg) or nonspecific siRNA 2 mg/kg (NS siRNA) intranasally in a total volume of 50 µl of PBS. Administration was performed 24 h before commencing the dox, then daily until animals were either sacrificed or placed in the hyperoxia chamber for survival experiments.
Chemical inhibition of HO and hyperoxia exposures
For hyperoxia experiments adult 6-wk-old mice were used. Chemical inhibition of HO was performed with intraperitoneally (i.p.) injections of tin protoporphryin (SnPP) or sham injection with saline. A total of 18 VEGF TG (+) mice were used; 9 received daily SnPP (37.5 mg/kg) in 0.2 ml of saline, and 9 received only saline (0.2 ml). Animals were placed in a hyperoxia chamber consisting of a Plexiglas chamber with 5 L per minute of 100% oxygen continuous flow. For survival experiments, the mice were monitored closely and their survival in hours was recorded. Administration of SnPP was continued daily during hyperoxia exposure. Animals were allowed food and dox water ad libitum. For injury experiments, mice were removed from the hyperoxia chamber and euthanized after 72 h. All animal protocols were reviewed and approved by the Institutional Animal Care and Use Committee at Yale University (IACUC).
Construction of lentiviral shRNA vectors
To silence mouse HO-1 expression in vivo for periods of >24 h, target site 429447 (GenBank accession #BC010757) was used to design Lenti-HO-1-shRNA. This target sequence 5'-GCCACACAGCACTATGTAA-3' has been previously described (19)
. Two oligos, 5'GATCCCGTTAATAGTGCTGTGTGGCTTGATATCCGGCCACACAGCACTATGTAATTTTTTCCAAC-3' and 5'-TCGAGTTGGAAAAAATTACATAGTGCTGTGTGGCCGGATATCAAGCCACACAGCACTATGTAACGG-3', were annealed and ligated into BamHI and XhoI fragments of pRNAT-U6.1/Lenti (GenScript, Piscataway, NJ, USA) to generate Lenti-HO-1 shRNA according to the manufacturers instructions. The construct was confirmed by sequencing. The luciferase ShRNA gene was inserted into the same lentiviral plasmid to generate a control vector (Lenti-Luc shRNA).
Lentivirus production
ViraPower lentiviral expression system (Invitrogen, Carlsbad, CA, USA) was used to produce Lenti-HO1-shRNA and Lenti-Luc-shRNA according to the manufacturers instructions. Briefly, the vector plasmids (either Lenti-HO-1-shRNA or Lenti-Luc-shRNA) and ViraPower Package mixture were cotransfected into 293T cells. Forty-eight h after transfection, viruses were harvested and concentrated in PBS by ultracentrifugation to
1.25 x 109 transducing units per milliliter (T.U./ml).
Intranasal administration of lentivirus
Intranasal administration of either the Lenti-HO1 shRNA or the Lenti-Luc shRNA was performed on VEGF TG (+) mice (6.25x107 TU/mouse); 24 h later they were started on dox water for 5 days. Mice received only a single intranasal treatment for each experiment. The mice were then either euthanized to check the HO-1 protein expression level in room air or placed in the hyperoxia chamber for survival experiments as described above.
BAL and protein quantification
Mice were euthanized and the tracheas were isolated and cannulated. Whole-lung lavage was performed twice with a total volume of 1.8 ml ice-cold PBS. Bronchoalveolar lavage (BAL) was centrifuged at 3000 g and the protein concentration of the supernatant was determined using the BCA Protein Assay Reagent (Pierce Labs, Rockford, IL, USA).
Lipid peroxidation assay
Lipid peroxidation is a mechanism of cellular injury that can be caused by reactive oxygen species (ROS). Malondialdehyde (MDA) is an end product of this process, which can be measured in a colorimetric assay (Calbiochem, San Diego, CA, USA). Assays were performed according to the manufacturers instructions. Whole-lung lysate was prepared by homogenizing lung tissue in 62.5 mM Tris-HCL (pH=6.8) supplemented with Complete-Mini Protease Inhibitor (Roche Diagnostics, Indianapolis, IN, USA). Protein concentration was determined using the BCA Protein Assay Reagent and equal milligram amounts from each specimen were used for the MDA assay.
HO activity assay
Total HO activity in the harvested lung samples of SnPP-treated or SnPP-untreated mice was determined in the microsomal fraction by measuring the formation of bilirubin as described (22)
. In brief, lung tissue was homogenized in 5 volumes of 0.05 M Tris HCl/0.25 M sucrose (pH 7.4). The homogenate was centrifuged at 27,000 g for 10 min. The supernatant was removed and centrifuged at 105,000 g for 90 min. The pellet (microsomal fraction) was resuspended in 100 mM potassium phosphate buffer with 2 mM MgCl2 (pH 7.4). The HO activity assay was carried out by mixing microsomal protein (0.5 mg) and cytosolic fraction of rat liver as a source of biliverdin reductase (2 mg) with 100 mM potassium phosphate buffer/2 mM MgCl2 (pH 7.4), 10 µM hemin, 2 mM glucose-6-phosphate, 0.2 U of glucose-6-phosphate dehydrogenase, and 0.8 mM NADPH. All chemical reagents were commercially obtained (Sigma). The reaction was conducted in the dark for 1 h at 37°C. The concentration of the end product of the HO/biliverdin reductase pathway (bilirubin) was then determined spectrophotometrically as the difference in absorbance between 464 and 600 nm using an excitation coefficient of 40 mM1cm1, HO activity was expressed as nanomoles of bilirubin formed per milligram of tissue protein. Protein content level was determined via BCA assay.
Laser capture microdissection and RNA extraction
Laser capture microdissection (LCM) was used to selectively dissect sections of large airway, alveolar tissue, and blood vessels from lung histological sections for quantitation of mRNA by real-time reverse transcription-polymerase chain reaction (RT-PCR). To prepare mouse lungs for microdissection, the trachea was cannulated and the lungs were dissected from the chest cavity. The lungs were inflated with 50% Tissue-Tek OTC in PBS, the trachea was clamped, and the inflated lungs were embedded in OTC (Sakura Finetek, Torrance CA, USA). Sections (10 µ) were cut with a refrigerated microtome, fixed in cold 70% ethanol, and stained with hematoxylin and eosin. For LCM, we used Leica AS LMD apparatus (Leica, Exton, PA, USA) and microdissected sections from large airway, blood vessels, and alveolar tissue. The RNeasy Micro Kit (Qiagen, Valencia, CA, USA) was used for RNA isolation from the OTC-embedded microdissected specimens.
Real-time RT-PCR
First-strand cDNA was synthesized using Superscript II Reverse Transcriptase (Invitrogen, Burlington, ON, Canada) with random hexamers; conditions were 10 min at 25°C, 30 min at 48°C, and 5 min at 95°C. Real-time RT-PCR reactions were carried out in Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and an ABI Prism 7000 Sequence Detection System (Applied Biosystems). GAPDH was amplified as a control. Real-time PCR conditions were 95°C for 10 min, 40 cycles of: 95°C for 15 s, followed by 60°C for 1 min. For real-time PCR, the HO-1 primers were sense 5'-CGCCTTCCTGCTCAACATT-3' and antisense 5'-TGTGTTCCTCTGTCAGCATCAC-3'. GAPDH primers were sense 5'TGTGTCCGTCGTGGATCTGA-3' and antisense was 5'-CCTGCTTCACCACCTTCTTGAT-3'.
Terminal deoxynucleotidyltransferase dUTP nick-end labeling (TUNEL) assay
We used the in situ cell death detection kit according to the manufacturers protocol (Roche Molecular Biochemicals). Sections of formalin-fixed, paraffin-embedded lung tissue were deparaffinized and rehydrated, rinsed with PBS, and digested with proteinase K (Roche Molecular Biochemicals) at a concentration of 20 µg/ml for 20 min. After PBS washes, sections were incubated with TUNEL reaction mixture at 37°C for 1 h, then incubated with antifluorescein conjugated with alkaline phosphatase at 37°C for 30 min. Sections were washed twice with PBS and stained with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate substrate solution before counterstaining with nuclear fast-red. Apoptotic and normal cells were observed under a light microscope. Normal cells exhibited red nuclear staining whereas TUNEL-positive cells, indicating cell death/apoptosis, exhibited purple nuclear staining. Five hundred cells were counted for each sample and the number of apoptotic cells is expressed as a percentage of the total counted.
Protein extraction and immunoblot analysis
One-half of the left lung was homogenized in 62.5 mM Tris-HCL (pH=6.8) supplemented with Complete-Mini Protease Inhibitor (Roche Diagnostics). Protein concentration of the lysates was determined using the BCA Protein Assay Reagent. Equal amounts of protein were combined with 2x SDS sample buffer (125 mM Tris HCl, pH 6.8; 4% SDS; 20% glycerol; 100 mM DTT, and 0.2% bromphenol blue) and boiled for 5 min. Samples were electrophoresed on 12% precast Tris HCl gels (Bio-Rad, Hercules, CA, USA). The gel was transferred onto a nitrocellulose membrane (Bio-Rad) and incubated for 1 h in 5% nonfat powdered milk containing Tris-buffered saline and 0.1% Tween 20 (M-TTBS). The membranes were then incubated for 2 h with mouse anti-HO-1 monoclonal antibody (1:1000 dilution; Stressgen, San Diego, CA, USA) in M-TTBS. After three washes in TTBS, the membranes were incubated with horseradish peroxidase (HRP) -conjugated goat anti-mouse IgG antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 90 min in 5% milk TTBS. The membranes were then washed three times in TTBS, followed by detection of signal via chemiluminescence with Western Luminol Reagent (Santa Cruz Biotechnology). To assess for equal protein loading, membranes were stripped in Restore Western Stripping Buffer (Pierce Labs), then incubated with rabbit anti-ß-tubulin antibody (Santa Cruz Biotechnology). Secondary antibody was HRP-conjugated goat anti-rabbit antibody (Santa Cruz Biotechnology). Washes and exposure performed were as described above.
Reverse transcription PCR
Total RNA was extracted from one-half of one lung using Trizol reagent according to the manufacturers protocol (Gibco BRL, Carlsbad, CA, USA). RT-PCR was performed using 0.4 µg total lung RNA and the RT-PCR Master Mix (USB, Cleveland, OH, USA). Primers were as follows: mouse ß-actin sense 5'-GTGGGCCGCTCTAGGCACCAA-3'; antisense 5'-CTCTTTGATGTCACGCACGATTTC-3'. Primers for hVEGF were sense 5'-CCTCCGCGGCCATGAACTTT-3' and antisense 5'-TCTTTCCGGATCCGAGATCTGGRT-3'. Reverse transcription was performed at 42°C for 30 min; PCR conditions were 1 cycle at 95°C for 3 min, 30 cycles at 95°C for 30 s, 60°C for 1 min, 68°C for 1 min, followed by 68°C for 3 min. Reaction products were separated and imaged on a 1% agarose gel with ethidium bromide (0.5 µg/ml) and an Alpha Imager (Alpha Innotech, San Leandro, CA, USA).
| RESULTS |
|---|
|
|
|---|
|
VEGF-induced HO-1 cytoprotection promotes survival and reduces injury in hyperoxia
Hyperoxic acute lung injury is associated with increased alveolar-capillary permeability as measured by BAL protein content. To determine whether expression of VEGF reduces this effect of hyperoxia, TG (+) mice were fed dox water for 5 days, then exposed to 100% hyperoxia for 72 h and sacrificed. As shown in Fig. 2
A, the TG (+) mice had significantly less protein in their BAL fluid compared with TG () mice, which is indicative of decreased hyperoxic injury (n=12; *P<0.01). To investigate whether there was evidence of cell death and apoptosis, TUNEL staining was performed on sections from these same mice and the percent of TUNEL-positive cells was quantitated (Fig. 2B
). Sections from the TG (+) mice clearly showed decreased TUNEL-positive cells compared with TG () mice, consistent with decreased apoptosis and cell death (n=6; *P<0.05). After observing that VEGF decreased hyperoxia-induced lung injury, we assessed the effect of these changes on survival. Tin protoporphryin (SnPP) is a known potent chemical inhibitor of HO enzymatic activity in vivo (23)
. VEGF TG (+) mice were given dox water for 7 days with concurrent i.p. injections (initiated 24 h before dox) of either saline or SnPP, then exposed to hyperoxia. As shown in Fig. 2C
, the TG (+) mice that received SnPP to inhibit HO-1 had significantly worse survival rates than TG (+) mice, which received sham injections of saline, demonstrating that VEGF-induction of HO activity is a major contributor to the decreased mortality observed in TG (+) mice exposed to hyperoxia (n=18; *P<0.002). To confirm that the SnPP was inhibiting HO enzymatic activity in this in vivo model, we performed an HO activity assay by measuring bilirubin production (the main product of the HO and biliverdin reductase system). Figure 2D
shows that SnPP is a potent inhibitor of HO activity (n=9; *P<0.05). Of note, the TG (+) mice treated with SnPP appeared to have decreased HO activity compared with the untreated TG () mice, and this is consistent with the fact that SnPP effectively inhibits basal HO activity.
|
Although SnPP is widely used as an HO-1 inhibitor, it also inhibits the noninducible isoforms of HO, HO-2, and HO-3, and therefore lacks specificity. To determine the specific role of HO-1 induction, we employed RNA interference using short siRNA, a powerful and highly specific method of gene silencing. We had previously shown in mice that unmodified, intranasal administration of HO-1 siRNA decreases the levels of HO-1 mRNA and protein in a lung-specific fashion (19)
. To assess the efficacy of HO-1 siRNA, in VEGF TG (+) mice, we administered either nonspecific siRNA (NS siRNA) or HO-1 siRNA, followed by dox for an additional 5 days to VEGF TG (+) mice. Mice were then sacrificed before or exposed to 72 h of hyperoxia. As shown in Fig. 3
A, HO-1 siRNA dramatically decreases total lung VEGF-induced HO-1 expression compared with TG (+) mice treated with nonspecific silencing RNA (NS siRNA). HO-1 siRNA is also effective at decreasing VEGF-induced HO-1 expression in the setting of hyperoxia (Fig. 3B
), but neither hyperoxia nor HO-1 siRNA has any effect on the level of expression of the human VEGF transgene (hVEGF) in TG (+) mice. Real-time RT-PCR was then performed on LCM microdissected tissue from large airways, blood vessels, and alveolar tissue (parenchyma). Figure 3D-F
shows that intranasal HO-1 siRNA administration is capable of inhibiting VEGF induction of HO-1 mRNA in multiple lung compartments. Since there are data showing that VEGF induction of A1 is important for VEGF cytoprotection from HALI, RT-PCR was performed on the same specimens, but there was no change in the levels of the antiapoptotic protein A1 with HO-1 siRNA treatment (data not shown).
|
Next, we demonstrated that HO-1 inhibition in VEGF transgenic mice results in increased oxidant injury and apoptosis in the setting of hyperoxia. Lipid peroxidation occurs in the setting of increased ROS generation. Therefore, we used an assay for MDA, a product of lipid peroxidation, to detect oxidant injury in our model. Mice were given NS siRNA or HO-1 siRNA, followed by 5 days of dox, then exposed to 72 h of hyperoxia. Mice were sacrificed and whole-lung lysates were used for the MDA assay. As seen in Fig. 4
A, inhibition of VEGF-induced HO-1 with HO-1 siRNA results in a significant increase in lipid peroxidation during hyperoxia (n=18; *P<0.05). ALI results in increased permeability of the epithelial-endothelial barrier leading to protein and fluid extravasation into the alveolar space. In Fig. 4B
, inhibition of VEGF-induced HO-1 results in an increased wet-to-dry ratio in hyperoxia compared with NS siRNA-treated TG (+) mice (n=9; *P<0.05). Figure 5
D demonstrates that VEGF TG (+) mice treated with HO-1 siRNA and TG () control mice have significantly elevated levels of BAL protein content, whereas the TG (+) mice treated with NS siRNA remain protected. TUNEL staining of sections from these same mice was performed to evaluate the effect of VEGF-induced HO-1 and HO-1 siRNA on cell death and apoptosis (Fig. 5A-C
). The representative sections from TG () mice shown in Fig. 5A
have prominent lung TUNEL staining, indicative of cell damage and death associated with HALI. Sections from TG (+) mice treated with NS siRNA, which retain VEGF-induced HO-1 expression (Fig. 5B
), do not show the same extent of cell damage as demonstrated by TUNEL staining. However, treatment of TG (+) mice with HO-1 siRNA (Fig. 5C
) abrogates the cytoprotective effect of VEGF-induced HO-1. Quantitation of TUNEL positivity (Fig. 5E
) shows that TG (+) mice given NS siRNA are protected from HALI and demonstrate significantly less TUNEL-positive cells than either TG () mice or TG (+) mice treated with HO-1 siRNA. Consistent with our current findings of TUNEL positivity in a variety of cell types, we have previously shown that hyperoxia leads to both lung epithelial and endothelial cell apoptosis (24
, 25)
.
|
|
Lentiviral inhibition of HO-1 and the effect on survival
Unmodified HO-1 siRNA is quite effective at silencing HO-1, but its limited half-life necessitates daily administration, and this is impractical once the mice are placed in the chamber for continuous hyperoxia exposure. To circumvent this issue, we designed a lentiviral expression system that demonstrates prolonged suppression of HO-1 activity. Figure 6
A shows that this vector remains effective at suppressing HO-1 expression 5 days after a single administration, but that the luciferase shRNA control insert has no effect on HO-1 expression. As shown in Fig. 6B
, inhibition of HO-1 in the TG (+) mice with Lenti-HO-1 shRNA worsens survival during hyperoxia compared with mice that received a control lentiviral siRNA (Lenti-Luc shRNA) (n=20; *P<0.05); this finding is similar to the survival results achieved with the chemical HO inhibitor SnPP. Lenti-HO-1 shRNA also worsened survival in TG () mice, which is consistent with our recent report using unmodified HO-1 siRNA in wild-type mice during hyperoxia (24)
. Of note, as seen in Fig. 6C
Lenti-HO-1 shRNA was comparable to unmodified HO-1 siRNA in its ability to worsen lung injury in TG (+) mice as measured by BAL protein concentration (n=9; *P<0.05).
|
| DISCUSSION |
|---|
|
|
|---|
The importance of hyperoxic acute lung injury is its utility as a model of human ARDS and thus there has been extensive investigation into the processes that potentiate or mitigate hyperoxic lung injury. Investigations of HO-1 have demonstrated that, in addition to its function as an antioxidant, it also has the capacity to decrease apoptosis (14)
. HO-1 is an important defense mechanism against oxidant injury, and there are several loss-of-function mutations in humans that exhibit a diverse phenotype including evidence of diffuse endothelial injury (27
, 28)
. Thus, there are data showing that functional HO is important for resistance against what is presumed to be oxidant injury to the endothelium (30)
. Our experiments have shown that inhibition of HO-1 protein synthesis or activity abrogates VEGF-induced cytoprotection, as evidenced by decreased survival in hyperoxia as well as increased lung injury by multiple measures. In addition, these findings apply to both the epithelial and endothelial layers, emphasizing the role of different cell types in modulating lung injury and repair responses. Our studies using HO-1 siRNA in vivo specifically identify HO-1 as an important mediator of the antioxidant and antiapoptotic properties of transgenic VEGF expression. Furthermore, we show for the first time the efficacy of intranasal siRNA in multiple lung compartments as well as the utility of intranasal lentiviral shRNA delivery.
Diverse models investigating HO-1 have suggested that HO-1 is not simply functioning as an antioxidant but have implicated it as a mediator of angiogenesis, thus supporting the idea that VEGF-induced HO-1 expression contributes to VEGF-induced angiogenesis (18
, 30
31
32)
. Recent studies in human endothelial cells have suggested a potential connection between angiogenesis and cytoprotection in which VEGF, in conjunction with HO-1, was shown to play a role in the prevention of LPS-induced inflammation and to simultaneously promote angiogenesis (33)
. We now demonstrate the in vivo importance of VEGF-induced HO-1 expression as a protective mechanism during lethal hyperoxia, thus enhancing our understanding of how VEGF modulates injury.
The exact role of VEGF in the normal adult lung has yet to be fully defined. Recent data suggest that the presence of VEGF is required to maintain the stability of the alveolar unit, both epithelial and endothelial components, and that this is dependent in part on VEGF inhibition of apoptosis (34
, 35)
. Our data corroborate this understanding of the alveolar unit by showing that epithelial-derived VEGF has effects on both epithelium and endothelium, presumably due to the soluble nature of VEGF. Although lack of VEGF signaling does not inhibit alveolar cell proliferation, it does increase the amount of septal apoptosis and leads to vascular pruning visible on angiography (35)
. VEGF was initially described as a vascular permeability factor and only later was discovered to be essential for angiogenesis. Since early ARDS is characterized by noncardiogenic pulmonary edema, the initial investigation of the role of VEGF in ARDS in both animals and humans focused on the contribution VEGF makes to noncardiogenic pulmonary edema by enhancing vascular permeability (36)
. There are significant animal data showing loss of VEGF synthesis in the setting of HALI and other models of acute lung injury (ALI) such as LPS treatment and direct bacterial inoculation (37)
. Research on VEGF in ARDS in humans has had conflicting results, with the suggestion that plasma levels of VEGF are elevated but BAL VEGF levels are decreased (38
, 39)
. Some studies have emphasized the deleterious aspects of VEGF function due to increased permeability while others have focused on loss of VEGF synthesis as harmful (40)
. Although in humans it has been hypothesized that increased permeability and resultant severe hypoxemia in the acute phase of ARDS is due to altered VEGF function, the early mortality directly attributable to lung injury is actually quite low (41). This suggests that the pulmonary response to injury, rather than the injury itself, is likely to be a significant determinant of outcome.
In combination with the accumulating evidence that VEGF has potent antiapoptotic effects in both normal and pathological states, the current data indicate that alterations in vascular permeability are not likely to be the only role of VEGF in ARDS. The dissection of VEGF signaling as it relates to the induction of HO-1 as well as other target molecules may allow us to discern the potentially deleterious effects of VEGF from those such as HO-1 induction, which is clearly protective. Our findings that VEGF induction of HO-1 is an important component of cytoprotection during hyperoxia highlight the importance of VEGF signaling in the lung in vivo and serve as a basis to expand future investigations into novel VEGF-mediated pathways.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Received for publication August 18, 2006. Accepted for publication December 6, 2006.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
A. Le, R. Zielinski, C. He, M. T. Crow, S. Biswal, R. M. Tuder, and P. M. Becker Pulmonary Epithelial Neuropilin-1 Deletion Enhances Development of Cigarette Smoke-induced Emphysema Am. J. Respir. Crit. Care Med., September 1, 2009; 180(5): 396 - 406. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Bein, S. C. Wesselkamper, X. Liu, M. Dietsch, N. Majumder, V. J. Concel, M. Medvedovic, M. A. Sartor, L. N. Henning, C. Venditto, et al. Surfactant-Associated Protein B Is Critical to Survival in Nickel-Induced Injury in Mice Am. J. Respir. Cell Mol. Biol., August 1, 2009; 41(2): 226 - 236. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-Y. Kim, H.-J. Cho, J.-J. Sir, B.-K. Kim, J. Hur, S.-W. Youn, H.-M. Yang, S.-I. Jun, K.-W. Park, S.-J. Hwang, et al. Sulfasalazine induces haem oxygenase-1 via ROS-dependent Nrf2 signalling, leading to control of neointimal hyperplasia Cardiovasc Res, June 1, 2009; 82(3): 550 - 560. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Weis, A. Weigert, A. von Knethen, and B. Brune Heme Oxygenase-1 Contributes to an Alternative Macrophage Activation Profile Induced by Apoptotic Cell Supernatants Mol. Biol. Cell, March 1, 2009; 20(5): 1280 - 1288. [Abstract] [Full Text] [PDF] |
||||
![]() |
M R Looney, C T Esmon, and M A Matthay Role of coagulation pathways and treatment with activated protein C in hyperoxic lung injury Thorax, February 1, 2009; 64(2): 114 - 120. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Quinton, M. R. Jones, B. E. Robson, B. T. Simms, J. A. Whitsett, and J. P. Mizgerd Alveolar Epithelial STAT3, IL-6 Family Cytokines, and Host Defense during Escherichia coli Pneumonia Am. J. Respir. Cell Mol. Biol., June 1, 2008; 38(6): 699 - 706. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Dulak, J. Deshane, A. Jozkowicz, and A. Agarwal Heme Oxygenase-1 and Carbon Monoxide in Vascular Pathobiology: Focus on Angiogenesis Circulation, January 15, 2008; 117(2): 231 - 241. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Datta, O. Dormond, A. Basu, D. M. Briscoe, and S. Pal Heme oxygenase-1 modulates the expression of the anti-angiogenic chemokine CXCL-10 in renal tubular epithelial cells Am J Physiol Renal Physiol, October 1, 2007; 293(4): F1222 - F1230. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |