|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||


* Cell Biology and Physiology, Wright State University School of Medicine, Dayton, Ohio, USA; and
Department of Biochemistry, Wake Forest University School of Medicine, Winston-Salem, North Carolina, USA
1Correspondence: Department Neuroscience, Cell Biology and Physiology, Wright State University, School of Medicine, 3640 Colonel Glenn Hwy., Dayton, Ohio 45435, USA. E-mail: julian.cambronero{at}wright.edu
| ABSTRACT |
|---|
|
|
|---|
Key Words: signal transduction network phospholipases and kinases small interfering RNA protein/lipid binding immunofluorescence colocalization
| INTRODUCTION |
|---|
|
|
|---|
Phospholipase D (PLD) catalyzes the hydrolysis of the terminal diester bond of glycerophospholipids, resulting in the formation of phosphatidic acid (PA) plus a related base in cell membranes. Two distinct isoforms of mammalian phospholipase D exist, named PLD1 and PLD2. PLD-generated PA is linked to several key cellular pathways, including mitogenesis, via activation of protein kinase C (PKC) and/or Raf, and endocytosis/vesicular trafficking, through association with small G proteins such as Arf and Rho (13
14
15)
or by activation of a mitogen-activated protein kinase (MAPK) (16)
. It is also well documented that PLD-derived PA is an activator of the NADPH oxidase system (17
18
19
20
21
22
23
24)
. PA can also function as an intracellular regulator of tyrosine kinase activity, particularly that of Fgr (25)
. Protein tyrosine phosphatase SHP-1 (26)
, protein phosphatase-1 (27
, 28)
, sphingosine kinase-1 (29
, 30)
, cAMP-specific phosphodiesterase PDE4D3 (31)
, and PI4P 5 kinase (32
, 33)
are also PA targets.
An established connection has been found between mTOR and PLD, as both activities become elevated with growth factors and mitogens, both increase survival signaling pathways, and both are implicated in cell cycle progression (34
, 35)
. PLD-generated PA activates mTOR, since the mTOR/p70S6K/eukaryotic initiation factor (elF) 4E-binding protein (4E-BP) pathway is inhibited by butanol, a primary alcohol that reduces the production of PA from PLD via a transphosphatidylation reaction (36
, 37)
. It has been speculated that PA binds to mTOR at the site targeted by rapamycin (36
, 37)
. Elevated PLD activity results in rapamycin resistance to p70S6K phosphorylation in MCF-7 breast cancer cells (38)
. Reduction of PA production from PLD by butanol decreases phenylephrinebut not platelet-derived growth factor (PDGF)-induced phosphorylation of mTOR, and that of its two substrates, p70S6K and 4E-BP1 (39)
.
Even though several mitogens activate S6K by phosphorylation via mTOR and PI3K/AKT (40
, 41)
, these cell signaling links are not completely essential (42
43
44
45)
. As PA can also act as a mitogen (46)
, this raises the possibility that PLD-generated PA may regulate S6K independently of mTOR or PI3K/AKT pathways. PA directly activates enzymes (e.g., Raf-1, PDE4D3, SHP-1) by binding to acidic/hydrophobic motifs in the target protein (47)
, and S6K contains potential hydrophobic clusters closely related to its activation (48)
. However, it is not known whether PA binds to and/or directly activates S6K. In this study, we demonstrate the existence of a direct PA/p70S6K interaction, at the level of PA binding to the enzyme p70S6K and a subsequent activation of its kinase activity. We present evidence indicating that PLD can regulate p70S6K without the intervention of mTOR.
| MATERIALS AND METHODS |
|---|
|
|
|---|
C-end/T412E), anti-rabbit IgG (agarose beads), the cAMP-dependent kinase inhibitor TTYADFIASGRTGRRNAIHD, and 4',6'-diamidino-2-phenylidole (DAPI) were from Sigma (St. Louis, MO, USA); [
-32P]ATP (30 Ci/mmol) was from Amersham Pharmacia Biotech (Arlington Heights, IL, USA); 1,2-dioleoyl-sn-glycero-3-phosphate (dioleoyl PA, or DO-PA) and all other lipids were from Avanti Polar Lipids (Alabaster, AL, USA); n-[1-3H]butanol (5 Ci/mmol) was from American Radiolabeled Chemicals (St. Louis, MO, USA); antip70S6K antibodies were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA); antimTOR, antimyc, antiphospho(T389)-p70S6K, antiphospho(T421/S424)-p70S6K, and antiphospho(S235/S236)-S6 protein antibodies (polyclonal), were from Cell Signaling (Beverly, MA, USA); p70S6K peptide substrate KKRNRTLTK was from Upstate Biotechnology Inc. (Lake Placid, NY, USA); GelMount was from BioMeda-Fisher (Pittsburgh, PA, USA); platinum Pfx polymerase, RNaseOUT SuperScriptII reverse transcriptase, and random hexamers were from Invitrogen; dNTPs were from Promega (Madison, WI, USA); the RNeasy Protect minikit was from Qiagen Inc. (Valencia, CA, USA); mTOR siRNA was from Ambion Inc. (Austin, TX, USA).
Plasmids, site-directed mutangenesis, and reverse transcriptase-polymerase chain reaction (RT-PCR)
MycPLD2a, cloned in pcDNA3.1, was a gift from Drs. J. David Lambeth (Emory University) and Isabel Lopez (University of Illinois at Chicago) and was originally described in (49)
. The ORF of PLD2a was subcloned into Ndel/BamHI of pcDNA-HisTag-Xa [Integrated DNA Technologies (IDT) Coralville, IA, USA] to generate HisPLD2, an expression plasmid that was used in the immunofluorescence studies. The mutant pcDNA-mycPLD2a K758R ("K758R"), originally described in (50)
, was produced by site-directed mutagenesis with the PCR-based QuickChange II mutagenesis kit (Stratagene, La Jolla, CA, USA). Briefly, pcDNA-mycPLD2a was denatured 2 min at 95°C in the presence of mutagenic primers: sense 5'-TC TACATCCACAGCAGGGTGCTCATCGCA G-3'. Identity of mutant was confirmed by direct DNA sequencing (Cleveland Genomics, Cleveland, OH, USA). A phCMV2-HAmTOR expression plasmid was constructed in our laboratory by direct subcloning of the full-length human mTOR cDNA (pCMV6-mTOR, OriGene Technologies, Inc. Rockville, MD, USA) into the vector phCMV2-hemagglutinin (HA) (Genlantis, San Diego, CA, USA). Briefly, a HindIII restriction site was generated in frame, and upstream the first ATG codon of mTOR by site-directed mutagenesis. pCMV6-(HindIII)mTOR was double-digested with HindIII/NotI, and the full-length mTOR cDNA was inserted in the tagging-vector following standard strategies. A pRK5-p70S6K (wild-type) expression plasmid was a generous gift from the Friedrich Miescher Institute for Biomedical Research, Switzerland. For RT-PCR, total RNA was isolated from COS-7 cells with the RNeasy Protect Mini kit. The first-strand cDNA was synthesized with 0.5 µg of total RNA, 250 ng of random hexamers, 500 µM dNTPs, 10 mM DTT, 40 U RNaseOUT, and 200 U of SuperScriptII Reverse Transcriptase at 42°C, 50 min. For PLD2 detection in overexpressed cells, "mycPLD2a-445" primer was used in standard PCR with back-transcribed RNA from cell lysates; sense: ATGGAGCAGAAGCTGATCAGCGAGGAGGAC.
Cell culture and plasmid transfection
COS-7 were initially seeded at 1 x 105 cells/well in 6-well tissue culture plates, in 2 ml D-MEM containing 10% FBS and nonessential amino acids. Cells were grown at 37°C in a CO2 incubator until they were 7080% confluent (
36 h). For transfection, a lipid-DNA complex was prepared by mixing 2 µg DNA plasmid (WT or mutant), 5 µl Lipofectamine, and 5 µl Plus reagent, in 1.2 ml OptiMEM vol as detailed in (51)
. After a 2-h incubation, cells were washed and incubated with D-MEM + 10% FBS for 2 d to allow the expression of intended RNA and protein. Cells were harvested and resuspended at a density of 23 x 106 cells/ml in fresh PBS at the time of the experiment.
Immunoprecipitation and immunoblotting
Transiently or mock-transfected COS-7 cells were lysed in lysis buffer/protease/phosphatase inhibitors [50 mM Tris HCl, pH 7.5; 1 mM EDTA; 1 mM EGTA; 0.5 mM sodium orthovanadate; 0.1% ß-mercaptoethanol; 1% Triton X-100; 1% deoxycholic acid; 50 mM sodium fluoride; 5 mM sodium pyrophosphate; 10 mM sodium ß-glycerolphosphate plus freshly added protease/phosphatase inhibitors (0.1 mM PMSF, 1 µg/ml aprotinin, 1 µg/ml pepstatin, 1 µg/ml leupeptin, 1 µM microcystin)]. When needed, 600900 µg of protein were incubated overnight with 50 µg anti-myc/Agarose in a final vol of 500 µl lysis buffer/inhibitors with gentle rotation. Agarose beads were spun-down at 12,000 g and washed 5 times with ice-cold lysis buffer/inhibitors, resuspended in loading buffer, boiled 5, subjected to 420% SDS-PAGE, and transferred to PDVF membranes. Western blots were developed by the ECL method (Amersham, UK).
Lipid binding to p70S6K enzyme
Assessment of binding used three complementary protocols. First, it was measured in an ELISA-based method modified from Ghosh et al. (52)
. Phospholipid (from natural sources) amounts ranged from 0 to 30 nmol/well. Samples were blocked with 300 µl 3% BSA in PBS for 90 min. Recombinant p70S6K protein was added in binding buffer (1% BSA; 50 mM Na2PO4, pH 7.2; 1 mM EGTA; 150 mM NaCl) and incubated for 1 h, followed by anti p70S6K antibody and HRP-conjugated secondary antibody. Bound protein was analyzed by addition of 100 µl TMB. Optical density (OD) was measured at 450 nm, and apparent affinity (as EC50) and maximal binding were calculated from each binding curve by nonlinear regression analysis. A second assay measured binding using lipids in large unilamellar vesicles (LUVs). LUVs (100 nm vesicles, verified by light scattering) were made by lipid extrusion in binding buffer (25 mM Tris-HCl, pH 7.2; 100 mM NaCl; 1 mM EGTA; 0.1 mM DTT) at a total lipid concentration of 0.1 mM, with PC and PE at a 1:4 M ratio and 0.7 mol% biotinylated PE at the expense of the egg PE (53)
. Recombinant p70S6K was included at 0.2 µM. Mixtures were incubated with streptavidin, analyzed by 12% SDS-PAGE stained with GelCode Blue. The percentage of protein bound is equal to (densitometry value of pellet)/(value of pellet plus supernatant) x 100. The third method used LUVs to compete for binding of p70S6K to immobilized PA in the ELISA assay. The ELISA plate was coated with 1 nmol Egg PA per well, and blocked as described above. Recombinant p70S6K protein (200 ng/ml) was incubated with 0.05 mM LUVs in LUV binding buffer for 20 min, followed by placing 100 µl of the mixture in each PA-coated well. After incubation on the plate for 20 min, the plates were washed and developed using antibodies as described above.
Phospholipase D and p70S6K activity assays
PLD activity was directly measured by utilizing the transphosphatidylation reaction with short-chain PC (PC8) and [3H]butanol substrates as in (51)
. Cell sonicates (
80 µg protein) were added to 1.5 ml Eppendorf tubes containing the following final assay conditions: 4.5 mM PC8 phospholipid; 75 mM HEPES, pH 7.9; and 1.7 µCi [3H]Butanol in a liposome form and incubated for 20 min at 30°C. Lipids were extracted and TLC sections that migrated as authentic PBut were scraped and [3H]phosphatidylbutanol ([3H]PBut) was quantified. Ribosomal p70S6K enzymatic activity was quantified by an in vitro kinase assay (54)
using either cell-derived anti-p70S6K immunoprecipitates or recombinant p70S6K. For the former, cell lysates were immunoprecipitated with anti-p70S6K antibody conjugated to agarose beads (54)
. Immunocomplexes were mixed with the phosphoacceptor peptide substrate KKRNRTLTK (75 µM) that bears the consensus site for S6K recognition. The phosphotransferase reaction was performed in the presence of 0.420 µCi [
-32P]ATP (7 nM) for 20 min at 37°C. The reaction was terminated by blotting the reaction mixture onto P81 IEC cellulose phosphate papers and counted for radioactivity. For measuring S6K in the presence of lipids, dioleoyl (18:1)-PA, di18:1-PS, di18:1-PC, or phosphatidylinositol (PI) were mixed with 0.16 µM of recombinant p70S6K enzyme in PBS, pH = 7.2, 0.5% BSA. After incubation for 20 min at 37°C, samples were assayed for in vitro kinase activity with KKRNRTLTK as above.
mTOR gene expression silencing
mTOR (FRAP1) siRNA from Ambion targeting exon #3 (locus ID 2475; sense, GGAGUCUACUCGCUUCUAUtt. siRNA powder was reconstituted in nuclease-free H2O at 100 µM. Aliquots of 0.5 µl of siRNA (100 nM final concentration to cells) were mixed with 300 µl OptiMEM and 2 µg myc-PLD2 plasmid and incubated at RT for 15 min, after which this was supplemented with 5 µl lipofectamine-2000 in 300 µl OptiMEM. This solution was added to adherent COS-7 in 6-well plates (
7080% confluent) that had been pre-equilibrated with 300 µl OptiMEM for 10 min. Cells were then placed in the incubator for 3 h to allow the cotransfection of siRNA and PLD2. After this, cells were washed once and complete media was added (2 ml D-MEM+10% FBS). Cells were further incubated at 5% CO2, 37°C for 2 d.
Immunofluorescence microscopy
COS-7 cells were seeded on glass coverslips placed on 6-well tissue culture plates and transfected as indicated above for 2 d. Cells were then processed for immunofluorescence as in (55)
, with 2 µg/ml of either anti-His or anti-myc antibodies and with 0.5 µg/ml FITC-conjugated secondary antibody. For triple labeling, the dyes were TRITC-primary antibody, FITC-secondary Ab, and DAPI. Coverslips were examined on a Nikon (Tokyo, Japan) microscope with a 100x objective (numerical aperture 1.3). Images were acquired in MetaView v.6.0 software (Universal Imaging Co, Molecular Devices, Downington, PA, USA) and no gamma adjustments were made on the acquired micrographs.
Statistical analysis
The analysis of multiple intergroup differences in each experiment was conducted by one-way ANOVA followed by Student t test. A P < 0.05 was used as the criterion of statistical significance.
| RESULTS |
|---|
|
|
|---|
1 nM PA. Binding of p70S6K was negligible to the neutral phospholipids PC and PE. Binding to another acidic phospholipid (PI) was much less than binding to PA (<20%). Binding to PA was also dependent on the amount of p70S6K added in the wells (Fig. 1B
40 ng protein/well, and is not altered by the presence or absence of Ca2+ ions (not shown). All these data indicate that PA binds to p70S6K in a specific and saturable manner.
|
To further verify that PA binds to p70S6K, we used a second assay in which LUVs containing various mol% of PA were incubated with recombinant p70S6K, followed by sedimentation of the LUVs and assessment of bound protein by Coomassie staining. As shown in Fig. 2
A, p70S6K bound very poorly to LUVs containing only PC and PE (1:4 M ratio, 0 mol% PA in the graph). However, binding increased dramatically as the mol% of PA in the LUVs was increased. Binding reached almost 100% at 60 mol% PA. If other acidic phospholipids (PS or PI) were substituted for PA at 60 mol%, much less binding was observed (Fig. 2B
). Thus, this liposome binding assay confirms that p70S6K binds preferentially to PA and does not bind to either PC or PE. Using these results, we can also calculate the apparent stoichiometry of binding of PA to p70S6K. Assuming that 50% of the lipid is accessible to the protein and that 90% of the protein is bound at 60 mol% PA, we determined that the ratio of PA to S6K was 167:1.
|
To investigate the possible activation of p70S6K by other charged phospholipids and to calculate relative binding affinities of various phospholipids, we have developed a new competition ELISA assay. LUVs of varying acidic phospholipid composition were used to compete for the binding of S6K to PA attached to the wells of 96-well plates. Results are presented in Fig. 3
and were subjected to nonlinear regression analysis using SigmaPlot to calculate half-maximal inhibition (IC50, an estimate of relative binding affinity) and the Hill slope for each phospholipid. Binding of p70S6K to acidic phospholipids phosphatididylinositol 4-phosphate (PI 4-P) and phosphatididylinositol 4,5-bisphosphate (PI 4,5-P2), compared to PA, is shown in Fig. 3A
. Both phosphoinositides had binding activity, with PI 4,5-P2 more effective than PI 4-P. PI 4-P showed a similar binding curve to PA but was less effective (IC50: PA=28.6 mol%, PI 4-P=46.0 mol%), while PI 4,5-P2 had a higher apparent affinity (IC50=9.9 mol%) than PA. The binding curve for PI 4,5-P2 showed a different pattern, in that it was hyperbolic rather than sigmoidal. The calculated Hill coefficients for the three lipids confirmed that binding of PA and PI 4-P showed cooperativity (Hill slopes: PA=4.4, PI 4-P=2.4), while binding of PI 4,5-P2 was not (Hill slope=0.8).
|
We also compared the binding properties of PA to other phospholipids, including cardiolipin (CL), which shares the simple phosphate headgroup with PA but is a larger molecule with two acylated glycerol backbone chains and two free phosphates. Results are shown in Fig. 3B
. Interestingly, the competition curve with cardiolipin-containing LUVs was very similar to the curve with PA-containing LUVs. Both had similar apparent affinities and both showed cooperativity (IC50: PA=28.6 mol%; CL=27 mol%; Hill slope: PA=4.4, CL=3.0). In agreement with Figs. 1
and 2
, PI and PS showed much less binding [IC50 for PI = 50.8 mol%; the value for PS could not be calculated since it inhibited less than 50% at the highest concentration possible (99.3 mol%)]. PI had a calculated Hill slope of 4.3, suggesting cooperative binding similar to PA, CL, and PI 4-P.
Lastly, we examined the effect of acyl chain composition on the binding of PA to p70S6K. Results are shown in Fig. 3C
and indicate that PA containing only saturated acyl chains [dipalmitoyl-PA (PA 16:0), didecanoyl-PA (PA 10:0)] binds very poorly. Introducing unsaturation into at least one acyl chain is necessary and sufficient for binding to take place. Curves for dioleoyl-PA (PA 18:1) and 1-stearoyl-2-arachidonyl-PA (PA 18:0/20:4) were very similar to natural PA from egg lecithin (PA) and give similar apparent affinities and Hill slopes (IC50: PA=28.6 mol%, PA 18:1=31.5 mol%, PA 18:0/20:4=30.4 mol%; Hill slopes: PA=4.4, PA 18:1=3.7, PA 18:0/20:4=3.4). In addition, 1 mM glycerol-3-phosphate (which lacks any acyl chains) did not inhibit binding (data not shown). These results suggest that binding is mediated by interactions of the protein with both the headgroup and the acyl chains of PA.
PA activates the p70S6K enzyme in vitro
We next examined whether the binding of PA to p70S6K had a functional effect on the enzymatic activity of this kinase. We tested the ability of PA to activate p70S6K in vitro, utilizing the enzyme obtained from two different sources: protein immunoprecipitated from cell lysates or a purified, recombinant protein. For the first approach, the source of the enzyme was COS-7 cell lysates. These were immunoprecipitated with specific anti-p70S6K antibodies, and the immunocomplex beads were assayed for p70S6K activity in the presence of lipids. Figure 4
A shows a dramatic activating effect by PA. In contrast, activation with other related phospholipids (PS, PC, or PI) is modest, pointing to a direct effect of PA on p70S6K. We also evaluated the role, if any, of other charged phospholipids. As presented in Fig. 4B
, cardiolipin activated S6K but with a somewhat lesser effect than that observed with binding (Fig. 3B
). The polyphosphoinositides PI 4-P and PI45P2 could also stimulate S6K activity (Fig. 4B
), paralleling the binding data on the previous figure. Lastly, and as also found in the binding data, using saturated acyl chains (di10:0) in PA failed to activate the kinase (Fig. 4B
).
|
As the experiments presented in Figs. 4A and B
had an immunoprecipitated p70S6K as the source of enzyme for the lipid/protein in vitro assays, two sets of control experiments were conducted to make sure that the assay did contain specifically p70S6K. The first set of controls was aimed at estimating the amounts of endogenous p70S6K immunoprecipitated as used in Figs. 4A
,B. For this, we used Western blotting after anti-p70S6K immunoprecipitation (Fig. 4C
). Since a positive control with recombinant enzyme was loaded in parallel to the immunoprecipitated beads, an estimate of the endogenous p70S6K could be made, which was 50100 ng in the amount routinely used in lysates for immunprecipitation (200 µl). The second experimental control, presented in Fig. 4D
, was aimed at investigating if mTOR coimmunoprecipitated with p70S6K. The figure shows that mTOR could not be detected in p70S6K immunoprecipitates, as compared with a positive control of COS-7 transfected with a hemaglutinin-tagged mTOR expression plasmid. This finding indicates that p70S6K, and not mTOR, is likely responsible for the enhancing effect of PA shown in Figs. 4A, B
.
Since mTOR and p70S6K interact functionally, it is also possible that mTOR is present in the p70S6K immunoprecipitates and mediates the effect of PA on p70S6K activity observed in Figs. 4A, B
. To eliminate this possibility, we followed a complementary, albeit more stringent, approach with purified p70S6K. Figure 5
A shows that dioeloyl-PA, added at micromolar concentrations to recombinant, purified p70S6K, enhanced the basal activity level of p70S6K. The observed effect reached a peak of maximum activity at
3040 µM PA, and from this value the stoichiometry for the interaction between PA and S6K could be calculated: The amount of PA that yields maximum binding is
30 µM. However, as we use sonicated liposomes, the actual lipid concentration available to interact with the protein is half (since half would be on the inside and half would be on the outside leaflet of the bilayer), i.e., 15 µM. As the assay uses 0.16 µM of recombinant S6K, the ratio of PA to p70S6K is 94, i.e., 94 molecules of PA bind a single molecule of S6K. Contrary to the strong activation of PA, the effect was negligible for PC and nonexistent for PI or dioeloyl-PS (Fig. 5A
). These results provide direct confirmation that p70S6K is specifically activated by PA in vitro.
|
We also examined the effect of the acyl chain composition of PA, as well as the potency of other charged phospholipids. Results presented in Fig. 5B
parallel those obtained in cell-derived immunoprecipitated p70S6K, in that cardiolipin, PI 4-P, and PI4,5P2 are also activators of S6K activity, while saturated PA (10:0) is not. It is worth noting that the amount of recombinant S6K enzyme for the in vitro assays of Figs. 5A, B
(200400 ng) is slightly higher than that calculated for endogenous (immunoprecipitated 70S6K) of Fig. 4A, B
, but still in the same order of magnitude, and yet activation levels in the cell-derived set are quantitatively higher, possibly due to the positive effect of other cell factors not present in the immuoprecipitated beads.
PLD2 overexpression in cells leads to p70S6K activation
Having demonstrated that PA binds and activates p70S6K in vitro, we next examined whether the results could be reproduced in vivo. To this end, we designed a way to generate PA within the living cell and tested its ability to activate p70S6K in the same cell. The source of PA was an overexpression of a pcDNA-mycPLD2 construct encoding myc-tagged PLD2, which was transfected into cultured COS-7 cells. Optimization experiments demonstrated that 36 h of transfection was enough to produce RNA as detected by RT-PCR with specific primers (56)
. COS-7 cells were transfected with either the wild-type construct or a lipase inactive mutant (PLD2-K758R). The presence of PLD2 at the RNA level (Fig. 6
A, upper panel) as well as at the protein level (Fig. 6A
, lower panel), was demonstrated for both the wild-type and the lipase inactive mutant. The expression of both RNA and protein is seen at comparable quantities and did not affect the level of endogenous p70S6K.
|
We also investigated the phosphorylation status of endogenous S6K using two different antiphospho antibodies targeting known regulatory amino acids involved in the activation of the enzyme: T389 and T421/S424 (Fig. 6B
). The figure shows that phosphorylation of p70S6K is evident in PLD2-transfected cells (quantitative scans of phospho-bands are presented in Fig. 6C
). Conversely, COS-7 cells that were overexpressing the lipase-inactive mutant of mycPLD2 (K758R) failed to increase phosphorylation of p70S6K and S6 protein. These results suggest that PLD2 activity is required for phosphorylation/activation of p70S6K. Figure 6B
also includes a phospho-S235/S236 blot (bottom panel), which shows the phosphorylation status of p70S6Ks natural substrate, ribosomal protein S6 that it is also augmented with PLD2 transfection. As reported extensively by other authors (57
58
59
60)
, phosphorylation of protein S6 on S235/S236 is one of the most reliable readouts of phosphorylation/activity for p70S6K and since it parallels results of phosphorylation in residues T389 and T421/S424, it was used in subsequent experiments.
Next, we measured the activity levels of both enzymes (PLD and p70S6K) in cells overexpressing the wild-type or the lipase inactive mutant. Figure 6D
shows that both PLD and p70S6K activities were increased in cells transfected with the wild-type mycPLD2 construct, which paralleled the phosphorylation data of Fig. 6B, C
. Conversely, transfection with the lipase inactive PLD2-K758R mutant did not result in PLD and p70S6K activity augmentation. This occurred even though the levels of expressed RNA and protein for PLD2-K758R were comparable with those of wild-type (Fig. 6A
). Thus, the effect of PLD2 on p70S6K is not mediated simply through a direct interaction of the PLD molecule but its enzymatic activity (i.e., the synthesis of PA) must be present.
Neither mTOR kinase activity inhibition nor mTOR gene expression silencing prevents p70S6K activation by PA
As shown previously (36
37
38)
, PLD-derived PA binds to mTOR. Since mTOR is one of the upstream activators of p70S6K, it is possible that the observed results of PA activation in vivo were mediated, at least in part, by PA interaction with mTOR. This could result in an activation of p70S6K, without a direct PA-p70S6K interaction. To shed light on this, we designed two complementary experiments aimed at eliminating the contribution of mTOR. The first approach was a pharmacological one, using rapamycin to inhibit mTOR activity in nontransfected cells. Results from these experiments indicate that, while rapamycin does not affect the level of PLD2 activity (Fig. 7
A), it inhibits p70S6K phosphorylation (Fig. 7B
), as expected [also demonstrated in our lab before (10)
], while it is still evident in PLD2+rapamycin. Rapamycin also inhibits S6K activity (Fig. 7C
). Importantly, this inhibition was rescued with increasing concentrations of exogenous dioleoyl-PA (Fig. 7C
).
|
As speculated in (36
, 37)
, however, PA can compete for the same binding site as rapamycin on mTOR, and the rescue of inhibition with PA in Fig. 7C
might play a role at the level of mTOR in addition to p70S6K. To rule out this possibility, we performed an experiment designed to silence mTOR gene expression with siRNA. COS-7 cells were cotransfected with wild-type PLD2 in the presence or absence of siRNA, and the levels of involved proteins and p70S6K activity were measured afterward. Figure 8
A indicates that the level of mTOR protein expression after siRNA transfection is considerably reduced. Densitometric values of bands in Fig. 8A
, for Control, PLD2, simTOR, simTOR+PLD2 are 277.8, 238.0, 94.5, 95.6; therefore, the inhibition caused by simTOR+PLD2 is 76% with respect to Control and 60% with respect to PLD2 alone (mean value=68%). While Fig. 8A
, upper panel, shows that mTOR protein expression is diminished, Fig. 8A
, middle panel, indicates that endogenous p70S6K remains unaffected. Additionally, Fig. 8A
, lower panel, shows that overexpression of PLD2 was not affected by mTOR gene silencing. Further, silencing mTOR expression did not alter the augmentative effect of PLD2 on p70S6K phosphorylation (Fig. 8B
and companion densitometry analysis, Fig. 8C
) or activity (Fig. 8D
). This means that PLD-derived PA can still bind and activate p70S6K even in the absence of mTOR. Note that the basal level of p70S6K activity in siRNA-transfected cells (Fig. 8D
) is lower than in control cells, indicating that mTOR could activate p70S6K in the absence of PLD2. However, mTOR is no longer needed for p70S6K activation in PLD2 siRNA-transfected cells.
|
The last series of experiments was aimed at investigating whether the transfection with PLD2 as presented in earlier figures would modify p70S6K at COS-7 membranes or whether p70S6K would exhibit any pattern(s) of colocalization with PLD2. As presented in Fig. 9
A, PLD2 (WT or lipase inactive mutant, PLD2-K758R) immunofluorescence stain is diffusely present around the cytoplasm and localized in the perinuclear region, in agreement with previous reports (61)
. Figure 8A
also indicates that S6K is localized around the cell cytoplasm, also in agreement with other authors for S6K1 (62)
.
|
Interestingly, the localization of S6K seems to change when PLD2 is transfected, with a pattern of the more dense accumulation of immunofluorescence stain shifting away form perinuclear regions and, importantly, PLD2 and S6K colocalize in the cell (Fig. 9B
). The same effect was observed using the inactive mutant of PLD2 (Fig. 9C
), suggesting that colocalization is independent of enzyme activity.
| DISCUSSION |
|---|
|
|
|---|
A role of PLD1 in the regulation of mTOR and PI3K and an interaction of PA with the PI3K/AKt survival signaling pathway has also been indicated earlier (63
64
65
66
67)
. However, the aforementioned studies did not address whether an overexpression of PLD leads to changes in p70S6K enzymatic activity in vivo, in addition to phosphorylation changes, or whether there was a direct effect of PA on p70S6K activation. PA-directed activation of mTOR does not preclude the existence of PA also activating p70S6K. The present report fills that gap and serves to indicate a participation of the isoform PLD2 on the regulation of the p70S6K pathway.
How an interaction of PA with p70S6K occurs in vivo is not yet known. We have observed a selective binding of p70S6K to PA compared to PI and PS. As relatively high amounts of PA (>10 mol%) are necessary to detect a significant p70S6K binding, questions arise as to whether the binding of PA to p70S6K has a physiological function. However, our findings using liposomes are similar to those obtained by others for Type I PIP 5-kinase (33)
and Raf-1 (52)
. The ultimate experiment will be to determine the binding site for PA on p70S6K and to assess the effect of eliminating binding using site-directed mutagenesis on the in vivo function of the enzyme.
At present, we can only speculate as to how PA is accessible for interaction with p70S6K in the cell. It is possible that PA, generated at sites of PLD localization, could attract p70S6K to the membrane, as PA does with Raf-1 (16
, 52)
. As such, PA could also serve as a docking site for p70S6K. Results presented here indicate that PLD2 transfection changed the pattern of subcellular expression, and a colocalization of S6K and PLD2 was observed by immunofluorescence microscopy. Some evidence for a geographical proximity of p70S6K to the cell membrane can be found in the literature. P70S6K binds to F-actin and is localized to submembranous actin in Swiss 3T3 fibroblasts (68)
. In addition, p70S6K interacts directly with the small GTPase Rac (69)
, which regulates the actin cytoskeleton (70)
. Finally, p70S6K interacts with the scaffolding protein spinophilin, which forms a plasma membrane-associated complex with Tiam1 that activates p70S6K (71)
. Since PLD also binds to F-actin and regulates cytoskeletal function (72)
, it is reasonable to propose that p70S6K may come into close proximity to this enzyme and to membrane-associated PLD-generated PA.
After establishing a PA/p70S6K interaction in vitro, the next logical question to answer was whether that lipid/protein interaction leads to an increase in the activity of the kinase. Indeed, PA selectively enhanced p70S6K activity both in vitro and in vivo, indicating that PA had a functional effect on the enzyme. The mechanism by which PA activates p70S6K is unknown, but it clearly must involve a direct effect on the enzyme, since enzyme activity was enhanced in vitro when only PA and recombinant p70S6K were present. The stoichiometry of both binding of PA to p70S6K and activation of the enzyme was between 100200:1 (PA:p70S6K), indicating that binding is not likely mediated by insertion of the headgroup of PA into a binding pocket on the protein. Our data demonstrate that the acyl chains of PA also contribute to the interaction and that certain other acidic phospholipids with free phosphate groups (cardiolipin, PI 4-P) have similar effects as PA. The pattern of binding of PI 4,5-P2 was clearly different, in that no cooperativity was observed, and it was not as effective as PA for increasing p70S6K activity. The basis for these differences requires further investigation, but it is interesting that another phosphoinositide-bisphosphate (PI 3,4-P2) bound poorly to p70S6K (data not shown), suggesting that a phosphate on the 5 position of the inositol ring was important for the effect. It is reasonable then to conclude that p70S6K acts within a hydrophobic environment provided by a micellar PA, near a membrane bilayer, that leads to an increase in its enzymatic activity.
In this study, the binding experiments were performed with recombinant, constitutively active enzyme. The activity experiments were carried over with the recombinant enzyme, but also with the immunoprecipitated, cell-derived, enzyme. Based on the phospho-antibody immunoblots, we have to assume that the cell-derived enzyme was obtained, at least in some degree, in a phosphorylated form. Thus, would speculate that the phosphorylation state of p70S6K impacts on lipid binding/activation, so much so that PA might act only on the phosphorylated enzyme state. For the purpose of binding and concomitant activation, a phosphorylated enzyme, derived from the cell, could be mimicked by the recombinant, constitutively active enzyme, and either one would provide the results indicated.
As for the point at which PA bind to the kinase, the evidence indicates that PA binds to the N terminus of p70S6K, since the protein used for the lipid binding experiments was truncated at the C-terminus (
C-end/T412E). But it seems clear that it binds to the full-length protein in vivo, since PA also activates the enzyme in cell-derived immunoprecipitates. A consensus binding site for PA in proteins has not been identified. PA binds electrostatically to similar regions of basic amino acids in Raf-1, SHP-1, and cAMP phosphodiesterase PDE4 (29
, 73
, 74)
.
Homology searches based on amino acid sequences are not particularly helpful in finding putative PA binding sites, and particular 3D conformations might be involved. A putative shallow binding pocket for PA and other acidic phospholipids has been identified in the phox homology domain of the NADPH oxidase component p47phox (75)
. In addition, Jones et al. (76)
recently identified a novel PA binding region on phosphatase PP1c
that is mostly hydrophobic and contains a unique loop-strand structural fold. Additional homology modeling and mutagenesis experiments will be needed to define the binding site for PA on p70S6K.
In conclusion, the data presented in this manuscript suggest an alternative mechanism of p70S6K activation that is dependent on PLD but independent of mTOR and thus expands the list of signaling proteins that are directly regulated by PA. As the present study defines the ability of phospholipids to directly impact an enzyme activity in isolated systems, as well as transfected cell systems, it addresses the fundamental question of network interaction between cell lipases and kinases in vivo. The intricacies of the functional regulation of a key signaling protein kinase and a key phospholipase (both involved in cell growth and signal transduction), certainly warrant continued investigation.
| ACKNOWLEDGMENTS |
|---|
Received for publication June 2, 2006. Accepted for publication October 31, 2006.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
M. Makam, D. Diaz, J. Laval, Y. Gernez, C. K. Conrad, C. E. Dunn, Z. A. Davies, R. B. Moss, L. A. Herzenberg, L. A. Herzenberg, et al. Activation of critical, host-induced, metabolic and stress pathways marks neutrophil entry into cystic fibrosis lungs PNAS, April 7, 2009; 106(14): 5779 - 5783. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Tannerstedt, W. Apro, and E. Blomstrand Maximal lengthening contractions induce different signaling responses in the type I and type II fibers of human skeletal muscle J Appl Physiol, April 1, 2009; 106(4): 1412 - 1418. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Kraft, J. L. Garrido, E. Fluharty, L. Leiva-Vega, and G. Romero Role of Phosphatidic Acid in the Coupling of the ERK Cascade J. Biol. Chem., December 26, 2008; 283(52): 36636 - 36645. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Feng, R. E. Brown, C. D. Trung, W. Li, L. Wang, T. Khoury, S. Alrawi, J. Yao, K. Xia, and D. Tan Morphoproteomic Profile of mTOR, Ras/Raf Kinase/ERK, and NF-{kappa}B Pathways in Human Gastric Adenocarcinoma Ann. Clin. Lab. Sci., January 1, 2008; 38(3): 195 - 209. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Gomez-Cambronero, M. Di Fulvio, and K. Knapek Understanding phospholipase D (PLD) using leukocytes: PLD involvement in cell adhesion and chemotaxis J. Leukoc. Biol., August 1, 2007; 82(2): 272 - 281. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |