FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.06-6652com.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-6652comv1
21/4/1075    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lehman, N.
Right arrow Articles by Gomez-Cambronero, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lehman, N.
Right arrow Articles by Gomez-Cambronero, J.
(The FASEB Journal. 2007;21:1075-1087.)
© 2007 FASEB

Phospholipase D2-derived phosphatidic acid binds to and activates ribosomal p70 S6 kinase independently of mTOR

Nicholas Lehman*, Bill Ledford{dagger}, Mauricio Di Fulvio*, Kathleen Frondorf*, Linda C. McPhail{dagger} and Julian Gomez-Cambronero*,1

* Cell Biology and Physiology, Wright State University School of Medicine, Dayton, Ohio, USA; and

{dagger} Department of Biochemistry, Wake Forest University School of Medicine, Winston-Salem, North Carolina, USA

1Correspondence: Department Neuroscience, Cell Biology and Physiology, Wright State University, School of Medicine, 3640 Colonel Glenn Hwy., Dayton, Ohio 45435, USA. E-mail: julian.cambronero{at}wright.edu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The product of phospholipase D (PLD) enzymatic action in cell membranes, phosphatidic acid (PA), regulates kinases implicated in NADPH oxidase activation, as well as the mammalian target of rapamycin (mTOR) kinase. However, other protein targets for this lipid second messenger must exist in order to explain other key PA-mediated cellular functions. In this study, PA was found to specifically and saturably bind to and activate recombinant and immunoprecipitated endogenous ribosomal S6 kinase (S6K) with a stoichiometry of 94:1 lipid/protein. Polyphosphoinositides PI4-P and PI4,5P2 and cardiolipin could also bind to and activate S6K, albeit with different kinetics. Conversely, PA with at least one acyl side chain saturated (10:0) was ineffective in binding or activating the enzyme. Transfection of COS-7 cells with a wild-type myc-(pcDNA)-PLD2 construct resulted in high PLD activity, concomitantly with an increase in ribosomal p70S6K enzyme activity and phosphorylation in T389 and T421/S424 as well as phosphorylation of p70S6K’s natural substrate S6 protein in S235/S236. Overexpression of a lipase inactive mutant (K758R), however, failed to induce an increase in both PLD and S6K activity or phosphorylation, indicating that the enzymatic activity of PLD2 (i.e., synthesis of PA) must be present to affect S6K. Neither inhibiting mTOR kinase activity with rapamycin nor silencing mTOR gene expression altered the augmentative effect of PLD2 exerted on p70S6K activity. This finding indicates that PA binds to and activates p70S6K, even in the absence of mTOR. Lastly, COS-7 transfection with PLD2 changed the pattern of subcellular expression, and a colocalization of S6K and PLD2 was observed by immunofluorescence microscopy. These results show for the first time a direct (mTOR-independent) participation of PLD in the p70S6K pathway and implicate PA as a nexus that brings together cell phospholipases and kinases.—Lehman, N., Ledford, B., Di Fulvio, M., Frondorf, K., McPhail, L. C., Gomez-Cambronero, J. Phospholipase D2-derived phosphatidic acid binds to and activates ribosomal p70 S6 kinase independently of mTOR.


Key Words: signal transduction • network phospholipases and kinases • small interfering RNA • protein/lipid binding • immunofluorescence colocalization


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
RIBOSOMAL S6 KINASE (p70S6K) is a 70 kDa Ser/Thr protein kinase that catalyzes the phosphorylation of the S6 protein (1 , 2) , a component of the eukaryotic ribosomal 40S subunit. As such, it plays a role in protein translation and in new ribosome formation. In the living cell, ribosomal p70S6K is activated through a complex network of signaling molecules (3 , 4) . The generation of 3-phosphoinositide lipid products by PI3K is required for the phosphorylation of two activating sites in p70S6K: T229 and T389 (5 , 6) . T229 is phosphorylated by phosphoinositide-dependent kinase-1 (PDK1) (7 , 8) , and T389 can be phosphorylated by PDK1 (6) but also by several other kinases, the mammalian target of rapamycin (mTOR) among them. p70S6K is regulated in response to nutrients in somatic cell cultures (9) . P70S6K also plays an important role in cell migration of human leukocytes (10 , 11) and choriocarcinoma JAR cells (12) .

Phospholipase D (PLD) catalyzes the hydrolysis of the terminal diester bond of glycerophospholipids, resulting in the formation of phosphatidic acid (PA) plus a related base in cell membranes. Two distinct isoforms of mammalian phospholipase D exist, named PLD1 and PLD2. PLD-generated PA is linked to several key cellular pathways, including mitogenesis, via activation of protein kinase C (PKC) and/or Raf, and endocytosis/vesicular trafficking, through association with small G proteins such as Arf and Rho (13 14 15) or by activation of a mitogen-activated protein kinase (MAPK) (16) . It is also well documented that PLD-derived PA is an activator of the NADPH oxidase system (17 18 19 20 21 22 23 24) . PA can also function as an intracellular regulator of tyrosine kinase activity, particularly that of Fgr (25) . Protein tyrosine phosphatase SHP-1 (26) , protein phosphatase-1 (27 , 28) , sphingosine kinase-1 (29 , 30) , cAMP-specific phosphodiesterase PDE4D3 (31) , and PI4P 5 kinase (32 , 33) are also PA targets.

An established connection has been found between mTOR and PLD, as both activities become elevated with growth factors and mitogens, both increase survival signaling pathways, and both are implicated in cell cycle progression (34 , 35) . PLD-generated PA activates mTOR, since the mTOR/p70S6K/eukaryotic initiation factor (elF) 4E-binding protein (4E-BP) pathway is inhibited by butanol, a primary alcohol that reduces the production of PA from PLD via a transphosphatidylation reaction (36 , 37) . It has been speculated that PA binds to mTOR at the site targeted by rapamycin (36 , 37) . Elevated PLD activity results in rapamycin resistance to p70S6K phosphorylation in MCF-7 breast cancer cells (38) . Reduction of PA production from PLD by butanol decreases phenylephrine—but not platelet-derived growth factor (PDGF)-induced phosphorylation of mTOR, and that of its two substrates, p70S6K and 4E-BP1 (39) .

Even though several mitogens activate S6K by phosphorylation via mTOR and PI3K/AKT (40 , 41) , these cell signaling links are not completely essential (42 43 44 45) . As PA can also act as a mitogen (46) , this raises the possibility that PLD-generated PA may regulate S6K independently of mTOR or PI3K/AKT pathways. PA directly activates enzymes (e.g., Raf-1, PDE4D3, SHP-1) by binding to acidic/hydrophobic motifs in the target protein (47) , and S6K contains potential hydrophobic clusters closely related to its activation (48) . However, it is not known whether PA binds to and/or directly activates S6K. In this study, we demonstrate the existence of a direct PA/p70S6K interaction, at the level of PA binding to the enzyme p70S6K and a subsequent activation of its kinase activity. We present evidence indicating that PLD can regulate p70S6K without the intervention of mTOR.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Materials
COS-7 cells and media were from American Type Culture Collection (ATCC, Manassas, VA, USA); Lipofectamine Plus reagent was from Invitrogen (Carlsbad, CA, USA); PC8, p70S6K active enzyme ({Delta}C-end/T412E), anti-rabbit IgG (agarose beads), the cAMP-dependent kinase inhibitor TTYADFIASGRTGRRNAIHD, and 4',6'-diamidino-2-phenylidole (DAPI) were from Sigma (St. Louis, MO, USA); [{gamma}-32P]ATP (30 Ci/mmol) was from Amersham Pharmacia Biotech (Arlington Heights, IL, USA); 1,2-dioleoyl-sn-glycero-3-phosphate (dioleoyl PA, or DO-PA) and all other lipids were from Avanti Polar Lipids (Alabaster, AL, USA); n-[1-3H]butanol (5 Ci/mmol) was from American Radiolabeled Chemicals (St. Louis, MO, USA); antip70S6K antibodies were from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA); antimTOR, antimyc, antiphospho(T389)-p70S6K, antiphospho(T421/S424)-p70S6K, and antiphospho(S235/S236)-S6 protein antibodies (polyclonal), were from Cell Signaling (Beverly, MA, USA); p70S6K peptide substrate KKRNRTLTK was from Upstate Biotechnology Inc. (Lake Placid, NY, USA); GelMount was from BioMeda-Fisher (Pittsburgh, PA, USA); platinum Pfx polymerase, RNaseOUT SuperScriptII reverse transcriptase, and random hexamers were from Invitrogen; dNTPs were from Promega (Madison, WI, USA); the RNeasy Protect minikit was from Qiagen Inc. (Valencia, CA, USA); mTOR siRNA was from Ambion Inc. (Austin, TX, USA).

Plasmids, site-directed mutangenesis, and reverse transcriptase-polymerase chain reaction (RT-PCR)
MycPLD2a, cloned in pcDNA3.1, was a gift from Drs. J. David Lambeth (Emory University) and Isabel Lopez (University of Illinois at Chicago) and was originally described in (49) . The ORF of PLD2a was subcloned into Ndel/BamHI of pcDNA-HisTag-Xa [Integrated DNA Technologies (IDT) Coralville, IA, USA] to generate HisPLD2, an expression plasmid that was used in the immunofluorescence studies. The mutant pcDNA-mycPLD2a K758R ("K758R"), originally described in (50) , was produced by site-directed mutagenesis with the PCR-based QuickChange II mutagenesis kit (Stratagene, La Jolla, CA, USA). Briefly, pcDNA-mycPLD2a was denatured 2 min at 95°C in the presence of mutagenic primers: sense 5'-TC TACATCCACAGCAGGGTGCTCATCGCA G-3'. Identity of mutant was confirmed by direct DNA sequencing (Cleveland Genomics, Cleveland, OH, USA). A phCMV2-HAmTOR expression plasmid was constructed in our laboratory by direct subcloning of the full-length human mTOR cDNA (pCMV6-mTOR, OriGene Technologies, Inc. Rockville, MD, USA) into the vector phCMV2-hemagglutinin (HA) (Genlantis, San Diego, CA, USA). Briefly, a HindIII restriction site was generated in frame, and upstream the first ATG codon of mTOR by site-directed mutagenesis. pCMV6-(HindIII)mTOR was double-digested with HindIII/NotI, and the full-length mTOR cDNA was inserted in the tagging-vector following standard strategies. A pRK5-p70S6K (wild-type) expression plasmid was a generous gift from the Friedrich Miescher Institute for Biomedical Research, Switzerland. For RT-PCR, total RNA was isolated from COS-7 cells with the RNeasy Protect Mini kit. The first-strand cDNA was synthesized with 0.5 µg of total RNA, 250 ng of random hexamers, 500 µM dNTPs, 10 mM DTT, 40 U RNaseOUT, and 200 U of SuperScriptII Reverse Transcriptase at 42°C, 50 min. For PLD2 detection in overexpressed cells, "mycPLD2a-445" primer was used in standard PCR with back-transcribed RNA from cell lysates; sense: ATGGAGCAGAAGCTGATCAGCGAGGAGGAC.

Cell culture and plasmid transfection
COS-7 were initially seeded at 1 x 105 cells/well in 6-well tissue culture plates, in 2 ml D-MEM containing 10% FBS and nonessential amino acids. Cells were grown at 37°C in a CO2 incubator until they were 70–80% confluent (~36 h). For transfection, a lipid-DNA complex was prepared by mixing 2 µg DNA plasmid (WT or mutant), 5 µl Lipofectamine, and 5 µl Plus reagent, in 1.2 ml OptiMEM vol as detailed in (51) . After a 2-h incubation, cells were washed and incubated with D-MEM + 10% FBS for 2 d to allow the expression of intended RNA and protein. Cells were harvested and resuspended at a density of 2–3 x 106 cells/ml in fresh PBS at the time of the experiment.

Immunoprecipitation and immunoblotting
Transiently or mock-transfected COS-7 cells were lysed in lysis buffer/protease/phosphatase inhibitors [50 mM Tris HCl, pH 7.5; 1 mM EDTA; 1 mM EGTA; 0.5 mM sodium orthovanadate; 0.1% ß-mercaptoethanol; 1% Triton X-100; 1% deoxycholic acid; 50 mM sodium fluoride; 5 mM sodium pyrophosphate; 10 mM sodium ß-glycerolphosphate plus freshly added protease/phosphatase inhibitors (0.1 mM PMSF, 1 µg/ml aprotinin, 1 µg/ml pepstatin, 1 µg/ml leupeptin, 1 µM microcystin)]. When needed, 600–900 µg of protein were incubated overnight with 50 µg anti-myc/Agarose in a final vol of 500 µl lysis buffer/inhibitors with gentle rotation. Agarose beads were spun-down at 12,000 g and washed 5 times with ice-cold lysis buffer/inhibitors, resuspended in loading buffer, boiled 5, subjected to 4–20% SDS-PAGE, and transferred to PDVF membranes. Western blots were developed by the ECL method (Amersham, UK).

Lipid binding to p70S6K enzyme
Assessment of binding used three complementary protocols. First, it was measured in an ELISA-based method modified from Ghosh et al. (52) . Phospholipid (from natural sources) amounts ranged from 0 to 30 nmol/well. Samples were blocked with 300 µl 3% BSA in PBS for 90 min. Recombinant p70S6K protein was added in binding buffer (1% BSA; 50 mM Na2PO4, pH 7.2; 1 mM EGTA; 150 mM NaCl) and incubated for 1 h, followed by anti p70S6K antibody and HRP-conjugated secondary antibody. Bound protein was analyzed by addition of 100 µl TMB. Optical density (OD) was measured at 450 nm, and apparent affinity (as EC50) and maximal binding were calculated from each binding curve by nonlinear regression analysis. A second assay measured binding using lipids in large unilamellar vesicles (LUVs). LUVs (100 nm vesicles, verified by light scattering) were made by lipid extrusion in binding buffer (25 mM Tris-HCl, pH 7.2; 100 mM NaCl; 1 mM EGTA; 0.1 mM DTT) at a total lipid concentration of 0.1 mM, with PC and PE at a 1:4 M ratio and 0.7 mol% biotinylated PE at the expense of the egg PE (53) . Recombinant p70S6K was included at 0.2 µM. Mixtures were incubated with streptavidin, analyzed by 12% SDS-PAGE stained with GelCode Blue. The percentage of protein bound is equal to (densitometry value of pellet)/(value of pellet plus supernatant) x 100. The third method used LUVs to compete for binding of p70S6K to immobilized PA in the ELISA assay. The ELISA plate was coated with 1 nmol Egg PA per well, and blocked as described above. Recombinant p70S6K protein (200 ng/ml) was incubated with 0.05 mM LUVs in LUV binding buffer for 20 min, followed by placing 100 µl of the mixture in each PA-coated well. After incubation on the plate for 20 min, the plates were washed and developed using antibodies as described above.

Phospholipase D and p70S6K activity assays
PLD activity was directly measured by utilizing the transphosphatidylation reaction with short-chain PC (PC8) and [3H]butanol substrates as in (51) . Cell sonicates (~80 µg protein) were added to 1.5 ml Eppendorf tubes containing the following final assay conditions: 4.5 mM PC8 phospholipid; 75 mM HEPES, pH 7.9; and 1.7 µCi [3H]Butanol in a liposome form and incubated for 20 min at 30°C. Lipids were extracted and TLC sections that migrated as authentic PBut were scraped and [3H]phosphatidylbutanol ([3H]PBut) was quantified. Ribosomal p70S6K enzymatic activity was quantified by an in vitro kinase assay (54) using either cell-derived anti-p70S6K immunoprecipitates or recombinant p70S6K. For the former, cell lysates were immunoprecipitated with anti-p70S6K antibody conjugated to agarose beads (54) . Immunocomplexes were mixed with the phosphoacceptor peptide substrate KKRNRTLTK (75 µM) that bears the consensus site for S6K recognition. The phosphotransferase reaction was performed in the presence of 0.420 µCi [{gamma}-32P]ATP (7 nM) for 20 min at 37°C. The reaction was terminated by blotting the reaction mixture onto P81 IEC cellulose phosphate papers and counted for radioactivity. For measuring S6K in the presence of lipids, dioleoyl (18:1)-PA, di18:1-PS, di18:1-PC, or phosphatidylinositol (PI) were mixed with 0.16 µM of recombinant p70S6K enzyme in PBS, pH = 7.2, 0.5% BSA. After incubation for 20 min at 37°C, samples were assayed for in vitro kinase activity with KKRNRTLTK as above.

mTOR gene expression silencing
mTOR (FRAP1) siRNA from Ambion targeting exon #3 (locus ID 2475; sense, GGAGUCUACUCGCUUCUAUtt. siRNA powder was reconstituted in nuclease-free H2O at 100 µM. Aliquots of 0.5 µl of siRNA (100 nM final concentration to cells) were mixed with 300 µl OptiMEM and 2 µg myc-PLD2 plasmid and incubated at RT for 15 min, after which this was supplemented with 5 µl lipofectamine-2000 in 300 µl OptiMEM. This solution was added to adherent COS-7 in 6-well plates (~70–80% confluent) that had been pre-equilibrated with 300 µl OptiMEM for 10 min. Cells were then placed in the incubator for 3 h to allow the cotransfection of siRNA and PLD2. After this, cells were washed once and complete media was added (2 ml D-MEM+10% FBS). Cells were further incubated at 5% CO2, 37°C for 2 d.

Immunofluorescence microscopy
COS-7 cells were seeded on glass coverslips placed on 6-well tissue culture plates and transfected as indicated above for 2 d. Cells were then processed for immunofluorescence as in (55) , with 2 µg/ml of either anti-His or anti-myc antibodies and with 0.5 µg/ml FITC-conjugated secondary antibody. For triple labeling, the dyes were TRITC-primary antibody, FITC-secondary Ab, and DAPI. Coverslips were examined on a Nikon (Tokyo, Japan) microscope with a 100x objective (numerical aperture 1.3). Images were acquired in MetaView v.6.0 software (Universal Imaging Co, Molecular Devices, Downington, PA, USA) and no gamma adjustments were made on the acquired micrographs.

Statistical analysis
The analysis of multiple intergroup differences in each experiment was conducted by one-way ANOVA followed by Student t test. A P < 0.05 was used as the criterion of statistical significance.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
PA specifically binds to p70S6K
To test whether PA binds to p70S6K, we performed two series of experiments: one involved the ability of p70S6K to bind to lipids immobilized in wells of a microtiter plate, and the other involved the testing of p70S6K binding to LUVs. Results from the first approach are shown in Fig. 1 , indicating that p70S6K bound to PA (Fig. 1A ). Binding was saturable, a hallmark of ligand-protein binding interaction, and saturation occurred at ~1 nM PA. Binding of p70S6K was negligible to the neutral phospholipids PC and PE. Binding to another acidic phospholipid (PI) was much less than binding to PA (<20%). Binding to PA was also dependent on the amount of p70S6K added in the wells (Fig. 1B ). Saturation occurred at ~40 ng protein/well, and is not altered by the presence or absence of Ca2+ ions (not shown). All these data indicate that PA binds to p70S6K in a specific and saturable manner.


Figure 1
View larger version (17K):
[in this window]
[in a new window]

 
Figure 1. Binding kinetics of PA to p70S6K (ELISA assay). A) Binding as a function of phospholipid concentration. Varying amounts (0–1 nmol) of either PA, PC, PI, or PE were immobilized in microtiter wells and then incubated with 20 ng p70S6K ({Delta}C-end/T412E). Bound enzyme was detected by developing the plate with specific anti-p70S6K antibodies as described in Materials and Methods. Shown are averages of two experiments performed in duplicate. B) Binding as a function of enzyme concentration. Different concentrations of p70S6K ({Delta}C-end/T412E) were added to duplicate wells containing 1 nmol of either PA, PC, or PI, and binding was detected as described in Materials and Methods. Results are mean ± SEM of at least n = 3.

To further verify that PA binds to p70S6K, we used a second assay in which LUVs containing various mol% of PA were incubated with recombinant p70S6K, followed by sedimentation of the LUVs and assessment of bound protein by Coomassie staining. As shown in Fig. 2 A, p70S6K bound very poorly to LUVs containing only PC and PE (1:4 M ratio, 0 mol% PA in the graph). However, binding increased dramatically as the mol% of PA in the LUVs was increased. Binding reached almost 100% at 60 mol% PA. If other acidic phospholipids (PS or PI) were substituted for PA at 60 mol%, much less binding was observed (Fig. 2B ). Thus, this liposome binding assay confirms that p70S6K binds preferentially to PA and does not bind to either PC or PE. Using these results, we can also calculate the apparent stoichiometry of binding of PA to p70S6K. Assuming that 50% of the lipid is accessible to the protein and that 90% of the protein is bound at 60 mol% PA, we determined that the ratio of PA to S6K was 167:1.


Figure 2
View larger version (12K):
[in this window]
[in a new window]

 
Figure 2. Binding of p70S6K to PA in liposomes. A) Concentration curve with PA. LUVs containing various mol % of PA (0–60) were incubated with p70S6K ({Delta}C-end/T412E) and binding of the enzyme to the LUVs was detected as described in Materials and Methods. Results shown are mean ± SEM with n = 4–6 in duplicate. B) Phospholipid specificity for p70S6K binding. LUVs containing 60 mol% of the indicated acidic phospholipids were incubated as above and p70S6K binding detected as described in Materials and Methods. The negative control LUVs (None) contain a 4:1 ratio of PE to PC. Results are mean ± SEM; n = 3–6 in duplicate.

To investigate the possible activation of p70S6K by other charged phospholipids and to calculate relative binding affinities of various phospholipids, we have developed a new competition ELISA assay. LUVs of varying acidic phospholipid composition were used to compete for the binding of S6K to PA attached to the wells of 96-well plates. Results are presented in Fig. 3 and were subjected to nonlinear regression analysis using SigmaPlot to calculate half-maximal inhibition (IC50, an estimate of relative binding affinity) and the Hill slope for each phospholipid. Binding of p70S6K to acidic phospholipids phosphatididylinositol 4-phosphate (PI 4-P) and phosphatididylinositol 4,5-bisphosphate (PI 4,5-P2), compared to PA, is shown in Fig. 3A . Both phosphoinositides had binding activity, with PI 4,5-P2 more effective than PI 4-P. PI 4-P showed a similar binding curve to PA but was less effective (IC50: PA=28.6 mol%, PI 4-P=46.0 mol%), while PI 4,5-P2 had a higher apparent affinity (IC50=9.9 mol%) than PA. The binding curve for PI 4,5-P2 showed a different pattern, in that it was hyperbolic rather than sigmoidal. The calculated Hill coefficients for the three lipids confirmed that binding of PA and PI 4-P showed cooperativity (Hill slopes: PA=4.4, PI 4-P=2.4), while binding of PI 4,5-P2 was not (Hill slope=0.8).


Figure 3
View larger version (16K):
[in this window]
[in a new window]

 
Figure 3. ELISA competition. A) Comparison of competition between LUVs containing varying mole percent of egg PA, brain PI4P, and brain PI4,5P2 with the binding of 20 ng p70S6K ({Delta}C-end/T412E) to 1 nmol egg PA immobilized in microtiter wells. LUVs (50 µM) were preincubated with the enzyme for 20 min before 100 µl aliquots were transferred to the ELISA plate. After 20 min on the plate, the unbound enzyme and that bound to the LUVs were washed off, and the enzyme bound to the immobilized PA was detected by developing the plate with specific anti-p70S6K antibodies as described in Materials and Methods. Shown are averages of three experiments performed in duplicate (±SEM). B) Competition of LUVs with varying mole percent anionic phospholipids (egg PA, brain PS and CL, liver PI). Shown are averages of three experiments performed in duplicate (±SEM). C) Effect of acyl chain composition of PA on ability to compete with immobilized egg PA. LUVs containing varying mole percent of egg, dioleoyl (18:1), stearoyl-arachidonoyl (18:0/20:4), dicapryl (10:0), and dipalmitoyl (16:0) PA were competed with 1 nmol plated egg PA. Shown are averages of three to four experiments performed in duplicate (±SEM).

We also compared the binding properties of PA to other phospholipids, including cardiolipin (CL), which shares the simple phosphate headgroup with PA but is a larger molecule with two acylated glycerol backbone chains and two free phosphates. Results are shown in Fig. 3B . Interestingly, the competition curve with cardiolipin-containing LUVs was very similar to the curve with PA-containing LUVs. Both had similar apparent affinities and both showed cooperativity (IC50: PA=28.6 mol%; CL=27 mol%; Hill slope: PA=4.4, CL=3.0). In agreement with Figs. 1 and 2 , PI and PS showed much less binding [IC50 for PI = 50.8 mol%; the value for PS could not be calculated since it inhibited less than 50% at the highest concentration possible (99.3 mol%)]. PI had a calculated Hill slope of 4.3, suggesting cooperative binding similar to PA, CL, and PI 4-P.

Lastly, we examined the effect of acyl chain composition on the binding of PA to p70S6K. Results are shown in Fig. 3C and indicate that PA containing only saturated acyl chains [dipalmitoyl-PA (PA 16:0), didecanoyl-PA (PA 10:0)] binds very poorly. Introducing unsaturation into at least one acyl chain is necessary and sufficient for binding to take place. Curves for dioleoyl-PA (PA 18:1) and 1-stearoyl-2-arachidonyl-PA (PA 18:0/20:4) were very similar to natural PA from egg lecithin (PA) and give similar apparent affinities and Hill slopes (IC50: PA=28.6 mol%, PA 18:1=31.5 mol%, PA 18:0/20:4=30.4 mol%; Hill slopes: PA=4.4, PA 18:1=3.7, PA 18:0/20:4=3.4). In addition, 1 mM glycerol-3-phosphate (which lacks any acyl chains) did not inhibit binding (data not shown). These results suggest that binding is mediated by interactions of the protein with both the headgroup and the acyl chains of PA.

PA activates the p70S6K enzyme in vitro
We next examined whether the binding of PA to p70S6K had a functional effect on the enzymatic activity of this kinase. We tested the ability of PA to activate p70S6K in vitro, utilizing the enzyme obtained from two different sources: protein immunoprecipitated from cell lysates or a purified, recombinant protein. For the first approach, the source of the enzyme was COS-7 cell lysates. These were immunoprecipitated with specific anti-p70S6K antibodies, and the immunocomplex beads were assayed for p70S6K activity in the presence of lipids. Figure 4 A shows a dramatic activating effect by PA. In contrast, activation with other related phospholipids (PS, PC, or PI) is modest, pointing to a direct effect of PA on p70S6K. We also evaluated the role, if any, of other charged phospholipids. As presented in Fig. 4B , cardiolipin activated S6K but with a somewhat lesser effect than that observed with binding (Fig. 3B ). The polyphosphoinositides PI 4-P and PI4–5P2 could also stimulate S6K activity (Fig. 4B ), paralleling the binding data on the previous figure. Lastly, and as also found in the binding data, using saturated acyl chains (di10:0) in PA failed to activate the kinase (Fig. 4B ).


Figure 4
View larger version (21K):
[in this window]
[in a new window]

 
Figure 4. Effect of exogenous lipids on p70S6K (cell-derived) enzymatic activity. Anti-p70S6K immunoprecipitates from COS-7 cells were incubated with 0–111 µM of either PA(18:1), PC, PI, PS (A) or PA(di10:0), cardiolipin (CL), PI4-P, PI4,5P2 (B), for 10 min and then enzyme activity was measured. Results are mean ± SEM; n = 3 in duplicate. C) Immunoprecipitation controls. COS-7 lysates were immunoprecipitated with anti-p70S6K, followed by immunoblot with the same antibodies to estimate the amount of S6K in cells. "Negative control" is buffer loaded into the gel. D) Investigation of whether mTOR would immunoprecipitate with p70S6K. COS-7 lysates were used without any further treatment ("COS-7 lysates") or they were immunoprecipitated with anti-p70S6K, followed by immunoblot with anti-mTOR antibodies. "Positive control": COS-7 transfected for 2 d with the phCMV2-HAmTOR expression plasmid.

As the experiments presented in Figs. 4A and B had an immunoprecipitated p70S6K as the source of enzyme for the lipid/protein in vitro assays, two sets of control experiments were conducted to make sure that the assay did contain specifically p70S6K. The first set of controls was aimed at estimating the amounts of endogenous p70S6K immunoprecipitated as used in Figs. 4A ,B. For this, we used Western blotting after anti-p70S6K immunoprecipitation (Fig. 4C ). Since a positive control with recombinant enzyme was loaded in parallel to the immunoprecipitated beads, an estimate of the endogenous p70S6K could be made, which was 50–100 ng in the amount routinely used in lysates for immunprecipitation (200 µl). The second experimental control, presented in Fig. 4D , was aimed at investigating if mTOR coimmunoprecipitated with p70S6K. The figure shows that mTOR could not be detected in p70S6K immunoprecipitates, as compared with a positive control of COS-7 transfected with a hemaglutinin-tagged mTOR expression plasmid. This finding indicates that p70S6K, and not mTOR, is likely responsible for the enhancing effect of PA shown in Figs. 4A, B .

Since mTOR and p70S6K interact functionally, it is also possible that mTOR is present in the p70S6K immunoprecipitates and mediates the effect of PA on p70S6K activity observed in Figs. 4A, B . To eliminate this possibility, we followed a complementary, albeit more stringent, approach with purified p70S6K. Figure 5 A shows that dioeloyl-PA, added at micromolar concentrations to recombinant, purified p70S6K, enhanced the basal activity level of p70S6K. The observed effect reached a peak of maximum activity at ~30–40 µM PA, and from this value the stoichiometry for the interaction between PA and S6K could be calculated: The amount of PA that yields maximum binding is ~30 µM. However, as we use sonicated liposomes, the actual lipid concentration available to interact with the protein is half (since half would be on the inside and half would be on the outside leaflet of the bilayer), i.e., 15 µM. As the assay uses 0.16 µM of recombinant S6K, the ratio of PA to p70S6K is 94, i.e., 94 molecules of PA bind a single molecule of S6K. Contrary to the strong activation of PA, the effect was negligible for PC and nonexistent for PI or dioeloyl-PS (Fig. 5A ). These results provide direct confirmation that p70S6K is specifically activated by PA in vitro.


Figure 5
View larger version (23K):
[in this window]
[in a new window]

 
Figure 5. Effect of lipids on recombinant p70S6K enzymatic activity in vitro. Recombinant, affinity-purified p70S6K was incubated with either PA(18:1), PC, PI, PS (A), or PA (di10:0), cardiolipin (CL), PI 4-P, PI4,5P2 (B) for 10 min and then enzyme activity was measured. Results were subtracted from controls with no peptide substrate added and are the mean ± SEM; n = 4 in duplicate. Results at 40 µM are statistically (P<0.01) different than the values obtained at 55 µM.

We also examined the effect of the acyl chain composition of PA, as well as the potency of other charged phospholipids. Results presented in Fig. 5B parallel those obtained in cell-derived immunoprecipitated p70S6K, in that cardiolipin, PI 4-P, and PI4,5P2 are also activators of S6K activity, while saturated PA (10:0) is not. It is worth noting that the amount of recombinant S6K enzyme for the in vitro assays of Figs. 5A, B (200–400 ng) is slightly higher than that calculated for endogenous (immunoprecipitated 70S6K) of Fig. 4A, B , but still in the same order of magnitude, and yet activation levels in the cell-derived set are quantitatively higher, possibly due to the positive effect of other cell factors not present in the immuoprecipitated beads.

PLD2 overexpression in cells leads to p70S6K activation
Having demonstrated that PA binds and activates p70S6K in vitro, we next examined whether the results could be reproduced in vivo. To this end, we designed a way to generate PA within the living cell and tested its ability to activate p70S6K in the same cell. The source of PA was an overexpression of a pcDNA-mycPLD2 construct encoding myc-tagged PLD2, which was transfected into cultured COS-7 cells. Optimization experiments demonstrated that 36 h of transfection was enough to produce RNA as detected by RT-PCR with specific primers (56) . COS-7 cells were transfected with either the wild-type construct or a lipase inactive mutant (PLD2-K758R). The presence of PLD2 at the RNA level (Fig. 6 A, upper panel) as well as at the protein level (Fig. 6A , lower panel), was demonstrated for both the wild-type and the lipase inactive mutant. The expression of both RNA and protein is seen at comparable quantities and did not affect the level of endogenous p70S6K.


Figure 6
View larger version (21K):
[in this window]
[in a new window]

 
Figure 6. PLD2 overexpression and correlation to p70S6K activity. A) Evaluation of overexpressed PLD2 RNA and protein. COS-7 cells were mock-transfected, or transfected with either wild-type mycPLD2 or mycPLD2-K758R mutant constructs for 48–60 h. RNA was isolated and used for RT-PCR analysis (upper panel) or for PAGE and Western blots, which were developed with anti-myc antibodies (lower panel). B) Analysis of p70S6K phosphorylation. Immunoblotting with antiphospho(T389)-p70S6K or antiphospho(T421/S424)-p70S6K antibodies was processed in parallel samples. As loading control, after films were obtained for one of those antibodies, the blots were stripped and reprobed with anti-p70S6K. Other samples were immunoblotted with antiphospho(S235/S236)-S6 protein and the ~32 kDa region is shown. C) Quantitation of data in (B) by densitometry of the indicated bands. D) Evaluation of enzyme activity. Lysates of cells treated as indicated in the previous panel were used to measure PLD (filled bars) or p70S6K (open bars) enzymatic activities, as indicated in Materials and Methods. For each activity, data are normalized to controls which represent, 1003 ± 80 cpm for PLD activity and 2,296 ± 150 cpm for S6K activity. Results are mean ± SEM; n = 3 in duplicate.

We also investigated the phosphorylation status of endogenous S6K using two different antiphospho antibodies targeting known regulatory amino acids involved in the activation of the enzyme: T389 and T421/S424 (Fig. 6B ). The figure shows that phosphorylation of p70S6K is evident in PLD2-transfected cells (quantitative scans of phospho-bands are presented in Fig. 6C ). Conversely, COS-7 cells that were overexpressing the lipase-inactive mutant of mycPLD2 (K758R) failed to increase phosphorylation of p70S6K and S6 protein. These results suggest that PLD2 activity is required for phosphorylation/activation of p70S6K. Figure 6B also includes a phospho-S235/S236 blot (bottom panel), which shows the phosphorylation status of p70S6K’s natural substrate, ribosomal protein S6 that it is also augmented with PLD2 transfection. As reported extensively by other authors (57 58 59 60) , phosphorylation of protein S6 on S235/S236 is one of the most reliable readouts of phosphorylation/activity for p70S6K and since it parallels results of phosphorylation in residues T389 and T421/S424, it was used in subsequent experiments.

Next, we measured the activity levels of both enzymes (PLD and p70S6K) in cells overexpressing the wild-type or the lipase inactive mutant. Figure 6D shows that both PLD and p70S6K activities were increased in cells transfected with the wild-type mycPLD2 construct, which paralleled the phosphorylation data of Fig. 6B, C . Conversely, transfection with the lipase inactive PLD2-K758R mutant did not result in PLD and p70S6K activity augmentation. This occurred even though the levels of expressed RNA and protein for PLD2-K758R were comparable with those of wild-type (Fig. 6A ). Thus, the effect of PLD2 on p70S6K is not mediated simply through a direct interaction of the PLD molecule but its enzymatic activity (i.e., the synthesis of PA) must be present.

Neither mTOR kinase activity inhibition nor mTOR gene expression silencing prevents p70S6K activation by PA
As shown previously (36 37 38) , PLD-derived PA binds to mTOR. Since mTOR is one of the upstream activators of p70S6K, it is possible that the observed results of PA activation in vivo were mediated, at least in part, by PA interaction with mTOR. This could result in an activation of p70S6K, without a direct PA-p70S6K interaction. To shed light on this, we designed two complementary experiments aimed at eliminating the contribution of mTOR. The first approach was a pharmacological one, using rapamycin to inhibit mTOR activity in nontransfected cells. Results from these experiments indicate that, while rapamycin does not affect the level of PLD2 activity (Fig. 7 A), it inhibits p70S6K phosphorylation (Fig. 7B ), as expected [also demonstrated in our lab before (10) ], while it is still evident in PLD2+rapamycin. Rapamycin also inhibits S6K activity (Fig. 7C ). Importantly, this inhibition was rescued with increasing concentrations of exogenous dioleoyl-PA (Fig. 7C ).


Figure 7
View larger version (17K):
[in this window]
[in a new window]

 
Figure 7. Effect of pharmacological inhibition of mTOR kinase activity and rescue with PA. A) Lack of effect on PLD activity. Cells were transfected with mycPLD2 as indicated above for two days. Cells were treated with 1 nM rapamycin for 20 min at 37°C followed by preparation of lysates and analysis of PLD activity. A phosphorylation analysis with antiphospho(S235/S236)-S6 antibodies (B) was performed as indicated in the legend of Fig. 6 . C) Untransfected cells were treated with 1 nM rapamycin for 20 min at 37°C followed by an additional 10-min incubation with the indicated concentrations of PA. Cell extracts were obtained, and p70S6K activity was measured in immunocomplexes. Results are mean ± SEM; n = 3 in duplicate.

As speculated in (36 , 37) , however, PA can compete for the same binding site as rapamycin on mTOR, and the rescue of inhibition with PA in Fig. 7C might play a role at the level of mTOR in addition to p70S6K. To rule out this possibility, we performed an experiment designed to silence mTOR gene expression with siRNA. COS-7 cells were cotransfected with wild-type PLD2 in the presence or absence of siRNA, and the levels of involved proteins and p70S6K activity were measured afterward. Figure 8 A indicates that the level of mTOR protein expression after siRNA transfection is considerably reduced. Densitometric values of bands in Fig. 8A , for Control, PLD2, simTOR, simTOR+PLD2 are 277.8, 238.0, 94.5, 95.6; therefore, the inhibition caused by simTOR+PLD2 is 76% with respect to Control and 60% with respect to PLD2 alone (mean value=68%). While Fig. 8A , upper panel, shows that mTOR protein expression is diminished, Fig. 8A , middle panel, indicates that endogenous p70S6K remains unaffected. Additionally, Fig. 8A , lower panel, shows that overexpression of PLD2 was not affected by mTOR gene silencing. Further, silencing mTOR expression did not alter the augmentative effect of PLD2 on p70S6K phosphorylation (Fig. 8B and companion densitometry analysis, Fig. 8C ) or activity (Fig. 8D ). This means that PLD-derived PA can still bind and activate p70S6K even in the absence of mTOR. Note that the basal level of p70S6K activity in siRNA-transfected cells (Fig. 8D ) is lower than in control cells, indicating that mTOR could activate p70S6K in the absence of PLD2. However, mTOR is no longer needed for p70S6K activation in PLD2 siRNA-transfected cells.


Figure 8
View larger version (18K):
[in this window]
[in a new window]

 
Figure 8. mTOR-targeted gene knockdown. A) Verification of protein silencing. COS-7 cells were transfected with either mycPLD2 (2 µg DNA) alone, double-stranded mTOR-siRNA (100 nM) alone, or they were cotransfected with mycPLD2 and siRNA. Western blots derived from harvested lysates were probed with anti-mTOR antibodies, and a duplicate set of samples was immunoprecipitated with anti-S6K and probed with anti-P70S6K. Lastly, some samples were immunoprecipitated with anti-myc and Western blots were probed with same antibodies to quantitate PLD2 expression (lower panel). B) Phosphorylation analysis with anti-S6-phospho-S235/S236 antibodies was performed as indicated in the legend of Fig. 6 and a densitometry of the bands (C) is also presented. D) Analysis of p70S6K enzyme activity after gene silencing of mTOR. Cells treated as indicated in (A) were lysed, immunoprecipitated with anti-p70S6K antibodies, and assayed for p70S6K activity. Results are mean ± SEM; n = 4 in duplicate.

The last series of experiments was aimed at investigating whether the transfection with PLD2 as presented in earlier figures would modify p70S6K at COS-7 membranes or whether p70S6K would exhibit any pattern(s) of colocalization with PLD2. As presented in Fig. 9 A, PLD2 (WT or lipase inactive mutant, PLD2-K758R) immunofluorescence stain is diffusely present around the cytoplasm and localized in the perinuclear region, in agreement with previous reports (61) . Figure 8A also indicates that S6K is localized around the cell cytoplasm, also in agreement with other authors for S6K1 (62) .


Figure 9
View larger version (33K):
[in this window]
[in a new window]

 
Figure 9. Immunofluorescence study of PLD2/p70S6K expression. A) Single transfection with His-PLD2-WT, His-PLD2-K758R, or myc-pRK5-S6K. Two days after transfection, COS-7 cells growing in coverslips were fixed and immunostained with anti-His (for PLD) or antimyc (for S6K) antibodies. They were further treated with FITC-conjugated or TRITC-conjugated secondary antibodies, respectively, as well as with DAPI, in a sequential order, and finally observed by fluorescence microscopy. B, C) Cotransfection PLD2/S6K. Cells were cotransfected with either His-PLD2-WT plus myc-S6K (B) or with His-PLD2-K758R lipase inactive mutant plus myc-S6K (C), as processed as indicated in (A).

Interestingly, the localization of S6K seems to change when PLD2 is transfected, with a pattern of the more dense accumulation of immunofluorescence stain shifting away form perinuclear regions and, importantly, PLD2 and S6K colocalize in the cell (Fig. 9B ). The same effect was observed using the inactive mutant of PLD2 (Fig. 9C ), suggesting that colocalization is independent of enzyme activity.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
We present here evidence that PA specifically binds to p70S6K, that PA activates the p70S6K enzyme in vitro, and that PLD2 overexpression in cells leads to p70S6K activation and phosphorylation. Further, we demonstrate that PA still activates p70S6K in the absence of mTOR or its activity. A connection between PLD and mTOR has been established previously (36 37 38 , 63) . The other mammalian PLD isoform, PLD1, regulates mTOR and cell growth control through a mechanism mediated by Cdc42 activation of p70S6K1 (64) . The present report is the first to show a direct effect of PA, generated by the PLD2 isoform, on p70S6K.

A role of PLD1 in the regulation of mTOR and PI3K and an interaction of PA with the PI3K/AKt survival signaling pathway has also been indicated earlier (63 64 65 66 67) . However, the aforementioned studies did not address whether an overexpression of PLD leads to changes in p70S6K enzymatic activity in vivo, in addition to phosphorylation changes, or whether there was a direct effect of PA on p70S6K activation. PA-directed activation of mTOR does not preclude the existence of PA also activating p70S6K. The present report fills that gap and serves to indicate a participation of the isoform PLD2 on the regulation of the p70S6K pathway.

How an interaction of PA with p70S6K occurs in vivo is not yet known. We have observed a selective binding of p70S6K to PA compared to PI and PS. As relatively high amounts of PA (>10 mol%) are necessary to detect a significant p70S6K binding, questions arise as to whether the binding of PA to p70S6K has a physiological function. However, our findings using liposomes are similar to those obtained by others for Type I PIP 5-kinase (33) and Raf-1 (52) . The ultimate experiment will be to determine the binding site for PA on p70S6K and to assess the effect of eliminating binding using site-directed mutagenesis on the in vivo function of the enzyme.

At present, we can only speculate as to how PA is accessible for interaction with p70S6K in the cell. It is possible that PA, generated at sites of PLD localization, could attract p70S6K to the membrane, as PA does with Raf-1 (16 , 52) . As such, PA could also serve as a docking site for p70S6K. Results presented here indicate that PLD2 transfection changed the pattern of subcellular expression, and a colocalization of S6K and PLD2 was observed by immunofluorescence microscopy. Some evidence for a geographical proximity of p70S6K to the cell membrane can be found in the literature. P70S6K binds to F-actin and is localized to submembranous actin in Swiss 3T3 fibroblasts (68) . In addition, p70S6K interacts directly with the small GTPase Rac (69) , which regulates the actin cytoskeleton (70) . Finally, p70S6K interacts with the scaffolding protein spinophilin, which forms a plasma membrane-associated complex with Tiam1 that activates p70S6K (71) . Since PLD also binds to F-actin and regulates cytoskeletal function (72) , it is reasonable to propose that p70S6K may come into close proximity to this enzyme and to membrane-associated PLD-generated PA.

After establishing a PA/p70S6K interaction in vitro, the next logical question to answer was whether that lipid/protein interaction leads to an increase in the activity of the kinase. Indeed, PA selectively enhanced p70S6K activity both in vitro and in vivo, indicating that PA had a functional effect on the enzyme. The mechanism by which PA activates p70S6K is unknown, but it clearly must involve a direct effect on the enzyme, since enzyme activity was enhanced in vitro when only PA and recombinant p70S6K were present. The stoichiometry of both binding of PA to p70S6K and activation of the enzyme was between 100–200:1 (PA:p70S6K), indicating that binding is not likely mediated by insertion of the headgroup of PA into a binding pocket on the protein. Our data demonstrate that the acyl chains of PA also contribute to the interaction and that certain other acidic phospholipids with free phosphate groups (cardiolipin, PI 4-P) have similar effects as PA. The pattern of binding of PI 4,5-P2 was clearly different, in that no cooperativity was observed, and it was not as effective as PA for increasing p70S6K activity. The basis for these differences requires further investigation, but it is interesting that another phosphoinositide-bisphosphate (PI 3,4-P2) bound poorly to p70S6K (data not shown), suggesting that a phosphate on the 5 position of the inositol ring was important for the effect. It is reasonable then to conclude that p70S6K acts within a hydrophobic environment provided by a micellar PA, near a membrane bilayer, that leads to an increase in its enzymatic activity.

In this study, the binding experiments were performed with recombinant, constitutively active enzyme. The activity experiments were carried over with the recombinant enzyme, but also with the immunoprecipitated, cell-derived, enzyme. Based on the phospho-antibody immunoblots, we have to assume that the cell-derived enzyme was obtained, at least in some degree, in a phosphorylated form. Thus, would speculate that the phosphorylation state of p70S6K impacts on lipid binding/activation, so much so that PA might act only on the phosphorylated enzyme state. For the purpose of binding and concomitant activation, a phosphorylated enzyme, derived from the cell, could be mimicked by the recombinant, constitutively active enzyme, and either one would provide the results indicated.

As for the point at which PA bind to the kinase, the evidence indicates that PA binds to the N terminus of p70S6K, since the protein used for the lipid binding experiments was truncated at the C-terminus ({Delta}C-end/T412E). But it seems clear that it binds to the full-length protein in vivo, since PA also activates the enzyme in cell-derived immunoprecipitates. A consensus binding site for PA in proteins has not been identified. PA binds electrostatically to similar regions of basic amino acids in Raf-1, SHP-1, and cAMP phosphodiesterase PDE4 (29 , 73 , 74) .

Homology searches based on amino acid sequences are not particularly helpful in finding putative PA binding sites, and particular 3D conformations might be involved. A putative shallow binding pocket for PA and other acidic phospholipids has been identified in the phox homology domain of the NADPH oxidase component p47phox (75) . In addition, Jones et al. (76) recently identified a novel PA binding region on phosphatase PP1c{gamma} that is mostly hydrophobic and contains a unique loop-strand structural fold. Additional homology modeling and mutagenesis experiments will be needed to define the binding site for PA on p70S6K.

In conclusion, the data presented in this manuscript suggest an alternative mechanism of p70S6K activation that is dependent on PLD but independent of mTOR and thus expands the list of signaling proteins that are directly regulated by PA. As the present study defines the ability of phospholipids to directly impact an enzyme activity in isolated systems, as well as transfected cell systems, it addresses the fundamental question of network interaction between cell lipases and kinases in vivo. The intricacies of the functional regulation of a key signaling protein kinase and a key phospholipase (both involved in cell growth and signal transduction), certainly warrant continued investigation.


   ACKNOWLEDGMENTS
 
This work has been supported by NIH grants HL056653 (J.G.-C.) and AI22564 (L.M.).

Received for publication June 2, 2006. Accepted for publication October 31, 2006.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Nemenoff, R. A., Price, D. J., Mendelsohn, M. J., Carter, E. A., Avruch, J. (1988) An S6 kinase activated during liver regeneration is related to the insulin-stimulated S6 kinase in H4 hepatoma cells. J. Biol. Chem. 263,19455-19460[Abstract/Free Full Text]
  2. Pullen, N., Thomas, G. (1997) The modular phosphorylation and activation of p70s6k. FEBS Lett. 410,78-82[CrossRef][Medline]
  3. Avruch, J., Belham, C., Weng, Q., Hara, K., Yonezawa, K. (2001) The p70 S6 kinase integrates nutrient and growth signals to control translational capacity. Prog. Mol. Subcell. Biol. 26,115-154[Medline]
  4. Dufner, A., Thomas, G. (1999) Ribosomal S6 kinase signaling and the control of translation. Exp. Cell Res. 253,100-109[CrossRef][Medline]
  5. Han, J. W., Pearson, R. B., Dennis, P. B., Thomas, G. (1995) Rapamycin, wortmannin, and the methylxanthine SQ20006 inactivate p70s6k by inducing dephosphorylation of the same subset of sites. J. Biol. Chem. 270,21396-21403[Abstract/Free Full Text]
  6. Balendran, A., Currie, R., Armstrong, C. G., Avruch, J., Alessi, D. R. (1999) Evidence that 3-phosphoinositide-dependent protein kinase-1 mediates phosphorylation of p70 S6 kinase in vivo at Thr-412 as well as Thr-252. J. Biol. Chem. 274,37400-37406[Abstract/Free Full Text]
  7. Alessi, D. R., Kozlowski, M. T., Weng, Q. P., Morrice, N., Avruch, J. (1998) 3-Phosphoinositide-dependent protein kinase 1 (PDK1) phosphorylates and activates the p70 S6 kinase in vivo and in vitro. Curr. Biol. 8,69-81[CrossRef][Medline]
  8. Pullen, N., Dennis, P. B., Andjelkovic, M., Dufner, A., Kozma, S. C., Hemmings, B. A., Thomas, G. (1998) Phosphorylation and activation of p70s6k by PDK1. Science 279,707-710[Abstract/Free Full Text]
  9. Weng, Q. P., Kozlowski, M., Belham, C., Zhang, A., Comb, M. J., Avruch, J. (1998) Regulation of the p70 S6 kinase by phosphorylation in vivo. Analysis using site-specific anti-phosphopeptide antibodies. J. Biol. Chem. 273,16621-16629[Abstract/Free Full Text]
  10. Gomez-Cambronero, J., Horn, J., Paul, C. C., Baumann, M. A. (2003) GM-CSF is a chemoattractant cytokine for neutrophils: involvement of the ribosomal p70S6K signaling pathway. J. Immunol. 171,6486-6855
  11. Gomez-Cambronero, J. (2003) Rapamycin inhibits GM-CSF-induced neutrophil migration. FEBS Lett. 550,94-100[CrossRef][Medline]
  12. Al-Shami, R., Sorensen, E. S., Ek-Rylander, B., Andersson, G., Carson, D. D., Farach-Carson, M. C. (2005) Phosphorylated osteopontin promotes migration of human choriocarcinoma cells via a p70 S6 kinase-dependent pathway. J. Cell. Biochem. 94,1218-1233[CrossRef][Medline]
  13. Cockcroft, S., Thomas, G. M., Fensome, A., Geny, B., Cunningham, E., Gout, I., Hiles, I., Totty, N. F., Truong, O., Hsuan, J. J. (1994) Phospholipase D: a downstream effector of ARF in granulocytes. Science 263,523-526[Abstract/Free Full Text]
  14. Bowman, E. P., Uhlinger, D. J., Lambeth, J. D. (1993) Neutrophil phospholipase D is activated by a membrane-associated Rho family small molecular weight GTP-binding protein. J. Biol. Chem. 268,21509-21512[Abstract/Free Full Text]
  15. Malcolm, K. C., Ross, A. H., Qiu, R. G., Symons, M., Exton, J. H. (1994) Activation of rat liver phospholipase D by the small GTP-binding protein RhoA. J. Biol. Chem. 269,25951-25954[Abstract/Free Full Text]
  16. Rizzo, M. A., Shome, K., Vasudevan, C., Stolz, D. B., Sung, T. C., Frohman, M. A., Watkins, S. C., Romero, G. (1999) Phospholipase D and its product, phosphatidic acid, mediate agonist-dependent raf-1 translocation to the plasma membrane and the activation of the mitogen-activated protein kinase pathway. J. Biol. Chem. 274,1131-1139[Abstract/Free Full Text]
  17. Rossi, F., Grzeskowiak, M., Della Bianca, V., Calzetti, F., Gandini, G. (1990) Phosphatidic acid and not diacylglycerol generated by phospholipase D is functionally linked to the activation of the NADPH oxidase by FMLP in human neutrophils. Biochem. Biophys. Res. Commun. 168,320-327[CrossRef][Medline]
  18. Bauldry, S. A., Bass, D. A., Cousart, S. L., McCall, C. E. (1991) Tumor necrosis factor alpha priming of phospholipase D in human neutrophils. Correlation between phosphatidic acid production and superoxide generation. J. Biol. Chem. 266,4173-4179[Abstract/Free Full Text]
  19. Bellavite, P., Corso, F., Dusi, S., Grzeskowiak, M., Della-Bianca, V., Rossi, F. (1988) Activation of NADPH-dependent superoxide production in plasma membrane extracts of pig neutrophils by phosphatidic acid. J. Biol. Chem. 263,8210-8214[Abstract/Free Full Text]
  20. McPhail, L. C., Qualliotine-Mann, D., Waite, K. A. (1995) Cell-free activation of neutrophil NADPH oxidase by a phosphatidic acid-regulated protein kinase. Proc. Natl. Acad. Sci. U. S. A. 92,7931-7935[Abstract/Free Full Text]
  21. Waite, K. A., Wallin, R., Qualliotine-Mann, D., McPhail, L. C. (1997) Phosphatidic acid-mediated phosphorylation of the NADPH oxidase component p47-phox. Evidence that phosphatidic acid may activate a novel protein kinase. J. Biol. Chem. 272,15569-15578[Abstract/Free Full Text]
  22. Bonser, R. W., Thompson, N. T., Randall, R. W., Garland, L. G. (1989) Phospholipase D activation is functionally linked to superoxide generation in the human neutrophil. Biochem. J. 264,617-620[Medline]
  23. Olson, S. C., Tyagi, S. R., Lambeth, J. D. (1990) Fluoride activates diradylglycerol and superoxide generation in human neutrophils via PLD/PA phosphohydrolase-dependent and -independent pathways. FEBS Lett. 272,19-24[CrossRef][Medline]
  24. Ding, J., Badwey, J. A. (1994) Wortmannin and 1-butanol block activation of a novel family of protein kinases in neutrophils. FEBS Lett. 348,149-152[CrossRef][Medline]
  25. Sergeant, S., Waite, K. A., Heravi, J., McPhail, L. C. (2001) Phosphatidic acid regulates tyrosine phosphorylating activity in human neutrophils: enhancement of Fgr activity. J. Biol. Chem. 276,4737-4746[Abstract/Free Full Text]
  26. Frank, C., Keilhack, H., Opitz, F., Zschornig, O., Bohmer, F. D. (1999) Binding of phosphatidic acid to the protein-tyrosine phosphatase SHP-1 as a basis for activity modulation. Biochemistry 38,11993-12002[CrossRef][Medline]
  27. Kishikawa, K., Chalfant, C. E., Perry, D. K., Bielawska, A., Hannun, Y. A. (1999) Phosphatidic acid is a potent and selective inhibitor of protein phosphatase 1 and an inhibitor of ceramide-mediated responses. J. Biol. Chem. 274,21335-21341[Abstract/Free Full Text]
  28. Jones, J. A., Hannun, Y. A. (2002) Tight binding inhibition of protein phosphatase-1 by phosphatidic acid. Specificity of inhibition by the phospholipid. J. Biol. Chem. 277,15530-15538[Abstract/Free Full Text]
  29. Pyne, S., Pyne, N. J. (2000) Sphingosine 1-phosphate signalling in mammalian cells. Biochem. J. 349,385-402[CrossRef][Medline]
  30. Delon, C., Manifava, M., Wood, E., Thompson, D., Krugmann, S., Pyne, S., Ktistakis, N. T. (2004) Sphingosine kinase 1 is an intracellular effector of phosphatidic acid. J. Biol. Chem. 279,44763-44774[Abstract/Free Full Text]
  31. Grange, M., Sette, C., Cuomo, M., Conti, M., Lagarde, M., Prigent, A. F., Nemoz, G. (2000) The cAMP-specific phosphodiesterase PDE4D3 is regulated by phosphatidic acid binding. Consequences for cAMP signaling pathway and characterization of a phosphatidic acid binding site. J. Biol. Chem. 275,33379-33387[Abstract/Free Full Text]
  32. Moritz, A., De Graan, P. N., Gispen, W. H., Wirtz, K. W. (1992) Phosphatidic acid is a specific activator of phosphatidylinositol-4-phosphate kinase. J. Biol. Chem. 267,7207-7210[Abstract/Free Full Text]
  33. Jenkins, G. H., Fisette, P. L., Anderson, R. A. (1994) Type I phosphatidylinositol 4-phosphate 5-kinase isoforms are specifically stimulated by phosphatidic acid. J. Biol. Chem. 269,11547-11554[Abstract/Free Full Text]
  34. Abraham, R. T. (1998) Mammalian target of rapamycin: immunosuppressive drugs uncover a novel pathway of cytokine receptor signaling. Curr. Opin. Immunol. 10,330-336[CrossRef][Medline]
  35. Joseph, T., Bryant, A., Frankel, P., Wooden, R., Kerkhoff, E., Rapp, U. R., Foster, D. A. (2002) Phospholipase D overcomes cell cycle arrest induced by high-intensity Raf signaling. Oncogene 21,3651-3658[CrossRef][Medline]
  36. Fang, Y., Vilella-Bach, M., Bachmann, R., Flanigan, A., Chen, J. (2001) Phosphatidic acid-mediated mitogenic activation of mTOR signaling. Science 294,1942-1945[Abstract/Free Full Text]
  37. Chen, J., Fang, Y. (2002) A novel pathway regulating the mammalian target of rapamycin (mTOR) signaling. Biochem. Pharmacol. 64,1071-1077[CrossRef][Medline]
  38. Chen, Y., Zheng, Y., Foster, D. A. (2003) Phospholipase D confers rapamycin resistance in human breast cancer cells. Oncogene 22,3937-3942[CrossRef][Medline]
  39. Ballou, L. M., Jiang, Y. P., Du, G., Frohman, M. A., Lin, R. Z. (2003) Ca(2+)- and phospholipase D-dependent and -independent pathways activate mTOR signaling. FEBS Lett. 550,51-56[CrossRef][Medline]
  40. Sekulic, A., Hudson, C. C., Homme, J. L., Yin, P., Otterness, D. M., Karnitz, L. M., Abraham, R. T. (2000) A direct linkage between the phosphoinositide 3-kinase-AKT signaling pathway and the mammalian target of rapamycin in mitogen-stimulated and transformed cells. Cancer Res. 60,3504-3513[Abstract/Free Full Text]
  41. Nave, B. T., Ouwens, M., Withers, D. J., Alessi, D. R., Shepherd, P. R. (1999) Mammalian target of rapamycin is a direct target for protein kinase B: identification of a convergence point for opposing effects of insulin and amino-acid deficiency on protein translation. Biochem. J. 344(Pt. 2),427-431[CrossRef][Medline]
  42. Eliasson, J., Elfegoun, T., Nilsson, J., Kohnke, R., Ekblom, B. T., Blomstrand, E. (2006) Maximal lengthening contractions increase p70S6 kinase phosphorylation in human skeletal muscle in the absence of nutritional supply. Am. J. Physiol. Endocrinol Metab. 291,E1197-1205[Abstract/Free Full Text]
  43. Cho, D. H., Choi, Y. J., Jo, S. A., Ryou, J., Kim, J. Y., Chung, J., Jo, I. (2006) Troglitazone acutely inhibits protein synthesis in endothelial cells via a novel mechanism involving protein phosphatase 2A-dependent p70 S6 kinase inhibition. Am. J. Physiol. Cell. Physiol. 291,C317-326[Abstract/Free Full Text]
  44. Talvas, J., Obled, A., Fafournoux, P., Mordier, S. (2006) Regulation of protein synthesis by leucine starvation involves distinct mechanisms in mouse C2C12 myoblasts and myotubes. J. Nutr. 136,1466-1471[Abstract/Free Full Text]
  45. Rebholz, H., Panasyuk, G., Fenton, T., Nemazanyy, I., Valovka, T., Flajolet, M., Ronnstrand, L., Stephens, L., West, A., Gout, I. T. (2006) Receptor association and tyrosine phosphorylation of S6 kinases. FEBS J. 273,2023-2036[CrossRef][Medline]
  46. Moolenaar, W. H., Kruijer, W., Tilly, B. C., Verlaan, I., Bierman, A. J., de Laat, S. W. (1986) Growth factor-like action of phosphatidic acid. Nature 323,171-173[CrossRef][Medline]
  47. Stace, C. L., Ktistakis, N. T. (2006) Phosphatidic acid- and phosphatidylserine-binding proteins. Biochim. Biophys. Acta 1761,913-926[Medline]
  48. Banerjee, P., Ahmad, M. F., Grove, J. R., Kozlosky, C., Price, D. J., Avruch, J. (1990) Molecular structure of a major insulin/mitogen-activated 70-kDa S6 protein kinase. Proc. Natl. Acad. Sci. U. S. A. 87,8550-8554[Abstract/Free Full Text]
  49. Lopez, I., Arnold, R. S., Lambeth, J. D. (1998) Cloning and initial characterization of a human phospholipase D2 (hPLD2). ADP-ribosylation factor regulates hPLD2. J. Biol. Chem. 273,12846-12852[Abstract/Free Full Text]
  50. Sung, T. C., Roper, R. L., Zhang, Y., Rudge, S. A., Temel, R., Hammond, S. M., Morris, A. J., Moss, B., Engebrecht, J., Frohman, M. A. (1997) Mutagenesis of phospholipase D defines a superfamily including a trans-Golgi viral protein required for poxvirus pathogenicity. EMBO J. 16,4519-4530[CrossRef][Medline]
  51. Horn, J. M., Lehman, J. A., Alter, G., Horwitz, J., Gomez-Cambronero, J. (2001) Presence of a phospholipase D (PLD) distinct from PLD1 or PLD2 in human neutrophils: immunobiochemical characterization and initial purification. Biochim. Biophys. Acta 1530,97-110[Medline]
  52. Ghosh, S., Strum, J. C., Sciorra, V. A., Daniel, L., Bell, R. M. (1996) Raf-1 kinase possesses distinct binding domains for phosphatidylserine and phosphatidic acid. Phosphatidic acid regulates the translocation of Raf-1 in 12-O-tetradecanoylphorbol-13-acetate-stimulated Madin-Darby canine kidney cells. J. Biol. Chem. 271,8472-8480[Abstract/Free Full Text]
  53. Tortorella, D., Ulbrandt, N. D., London, E. (1993) Simple centrifugation method for efficient pelleting of both small and large unilamellar vesicles that allows convenient measurement of protein binding. Biochemistry 32,9181-9188[CrossRef][Medline]
  54. Lehman, J. A., Calvo, V., Gomez-Cambronero, J. (2003) Mechanism of ribosomal p70S6 kinase activation by granulocyte macrophage colony-stimulating factor in neutrophils: cooperation of a MEK-related, THR421/SER424 kinase and a rapamycin-sensitive, m-TOR-related THR389 kinase. J. Biol. Chem. 278,28130-28138[Abstract/Free Full Text]
  55. Lehman, N., Di Fulvio, M., McCray, N., Campos, I., Tabatabaian, F., Gomez-Cambronero, J. (2006) Phagocyte cell migration is mediated by phospholipases PLD1 and PLD2. Blood 108,3564-3572[Abstract/Free Full Text]
  56. Di Fulvio, M., Lehman, N., Lin, X., Lopez, I., Gomez-Cambronero, J. (2006) The elucidation of novel SH2 binding sites on PLD2. Oncogene 25,3032-3040[CrossRef][Medline]
  57. Shahbazian, D., Roux, P. P., Mieulet, V., Cohen, M. S., Raught, B., Taunton, J., Hershey, J. W., Blenis, J., Pende, M., Sonenberg, N. (2006) The mTOR/PI3K and MAPK pathways converge on eIF4B to control its phosphorylation and activity. EMBO J. 25,2781-2791[CrossRef][Medline]
  58. Yan, L., Findlay, G. M., Jones, R., Procter, J., Cao, Y., Lamb, R. F. (2006) Hyperactivation of mammalian target of rapamycin (mTOR) signaling by a gain-of-function mutant of the Rheb GTPase. J. Biol. Chem. 281,19793-19797[Abstract/Free Full Text]
  59. Riemenschneider, M. J., Betensky, R. A., Pasedag, S. M., Louis, D. N. (2006) AKT activation in human glioblastomas enhances proliferation via TSC2 and S6 kinase signaling. Cancer Res. 66,5618-5623[Abstract/Free Full Text]
  60. Jacinto, E., Facchinetti, V., Liu, D., Soto, N., Wei, S., Jung, S. Y., Huang, Q., Qin, J., Su, B. (2006) SIN1/MIP1 maintains rictor-mTOR complex integrity and regulates Akt phosphorylation and substrate specificity. Cell 127,125-137[CrossRef][Medline]
  61. Freyberg, Z., Bourgoin, S., Shields, D. (2002) Phospholipase D2 is localized to the rims of the Golgi apparatus in mammalian cells. Mol. Biol. Cell 13,3930-3942[Abstract/Free Full Text]
  62. Lee-Fruman, K. K., Kuo, C. J., Lippincott, J., Terada, N., Blenis, J. (1999) Characterization of S6K2, a novel kinase homologous to S6K1. Oncogene 18,5108-5114[CrossRef][Medline]
  63. Kam, Y., Exton, J. H. (2004) Role of phospholipase D1 in the regulation of mTOR activity by lysophosphatidic acid. FASEB J. 18,311-319[Abstract/Free Full Text]
  64. Fang, Y., Park, I. H., Wu, A. L., Du, G., Huang, P., Frohman, M. A., Walker, S. J., Brown, H. A., Chen, J. (2003) PLD1 regulates mTOR signaling and mediates Cdc42 activation of S6K1. Curr. Biol. 13,2037-2044[CrossRef][Medline]
  65. Zheng, X., Bollag, W. B. (2003) AngII induces transient phospholipase D activity in the H295R glomerulosa cell model. Mol. Cell. Endocrinol. 206,113-122[CrossRef][Medline]
  66. Hui, L., Abbas, T., Pielak, R. M., Joseph, T., Bargonetti, J., Foster, D. A. (2004) Phospholipase D elevates the level of MDM2 and suppresses DNA damage-induced increases in p53. Mol. Cell. Biol. 24,5677-5686[Abstract/Free Full Text]
  67. Banno, Y., Takuwa, Y., Akao, Y., Okamoto, H., Osawa, Y., Naganawa, T., Nakashima, S., Suh, P. G., Nozawa, Y. (2001) Involvement of phospholipase D in sphingosine 1-phosphate-induced activation of phosphatidylinositol 3-kinase and Akt in Chinese hamster ovary cells overexpressing EDG3. J. Biol. Chem. 276,35622-35628[Abstract/Free Full Text]
  68. Berven, L. A., Willard, F. S., Crouch, M. F. (2004) Role of the p70(S6K) pathway in regulating the actin cytoskeleton and cell migration. Exp. Cell Res. 296,183-195[CrossRef][Medline]
  69. Chou, M. M., Blenis, J. (1996) The 70 kDa S6 kinase complexes with and is activated by the Rho family G proteins Cdc42 and Rac1. Cell 85,573-583[CrossRef][Medline]
  70. Burridge, K., Wennerberg, K. (2004) Rho and Rac take center stage. Cell 116,167-179[CrossRef][Medline]
  71. Buchsbaum, R. J., Connolly, B. A., Feig, L. A. (2003) Regulation of p70 S6 kinase by complex formation between the Rac guanine nucleotide exchange factor (Rac-GEF) Tiam1 and the scaffold spinophilin. J. Biol. Chem. 278,18833-18841[Abstract/Free Full Text]
  72. Kusner, D. J., Barton, J. A., Wen, K. K., Wang, X., Rubenstein, P. A., Iyer, S. S. (2002) Regulation of phospholipase D activity by actin. Actin exerts bidirectional modulation of Mammalian phospholipase D activity in a polymerization-dependent, isoform-specific manner. J. Biol. Chem. 277,50683-50692[Abstract/Free Full Text]
  73. Miles, D. J., Thompson, K. D., Lilley, J. H., Adams, A. (2003) Immunofluorescence of the epizootic ulcerative syndrome pathogen, Aphanomyces invadans, using a monoclonal antibody. Dis. Aquat. Organ. 55,77-84[Medline]
  74. Picq, M., Huang, Y., Lagarde, M., Doutheau, A., Nemoz, G. (2002) Synthesis of photoreactive phosphatidic acid analogues displaying activatory properties on cyclic AMP-phosphodiesterases. Photoaffinity labeling of an isoform of phosphodiesterase. J. Med. Chem. 45,1678-1685[CrossRef][Medline]
  75. Karathanassis, D., Stahelin, R. V., Bravo, J., Perisic, O., Pacold, C. M., Cho, W., Williams, R. L. (2002) Binding of the PX domain of p47(phox) to phosphatidylinositol 3,4-bisphosphate and phosphatidic acid is masked by an intramolecular interaction. EMBO J. 21,5057-5068[CrossRef][Medline]
  76. Jones, J. A., Rawles, R., Hannun, Y. A. (2005) Identification of a novel phosphatidic acid binding domain in protein phosphatase-1. Biochemistry 44,13235-13245[CrossRef][Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
M. Makam, D. Diaz, J. Laval, Y. Gernez, C. K. Conrad, C. E. Dunn, Z. A. Davies, R. B. Moss, L. A. Herzenberg, L. A. Herzenberg, et al.
Activation of critical, host-induced, metabolic and stress pathways marks neutrophil entry into cystic fibrosis lungs
PNAS, April 7, 2009; 106(14): 5779 - 5783.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
J. Tannerstedt, W. Apro, and E. Blomstrand
Maximal lengthening contractions induce different signaling responses in the type I and type II fibers of human skeletal muscle
J Appl Physiol, April 1, 2009; 106(4): 1412 - 1418.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. A. Kraft, J. L. Garrido, E. Fluharty, L. Leiva-Vega, and G. Romero
Role of Phosphatidic Acid in the Coupling of the ERK Cascade
J. Biol. Chem., December 26, 2008; 283(52): 36636 - 36645.
[Abstract] [Full Text] [PDF]


Home page
Annals of Clinical & Laboratory ScienceHome page
W. Feng, R. E. Brown, C. D. Trung, W. Li, L. Wang, T. Khoury, S. Alrawi, J. Yao, K. Xia, and D. Tan
Morphoproteomic Profile of mTOR, Ras/Raf Kinase/ERK, and NF-{kappa}B Pathways in Human Gastric Adenocarcinoma
Ann. Clin. Lab. Sci., January 1, 2008; 38(3): 195 - 209.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. Gomez-Cambronero, M. Di Fulvio, and K. Knapek
Understanding phospholipase D (PLD) using leukocytes: PLD involvement in cell adhesion and chemotaxis
J. Leukoc. Biol., August 1, 2007; 82(2): 272 - 281.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-6652comv1
21/4/1075    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lehman, N.
Right arrow Articles by Gomez-Cambronero, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lehman, N.
Right arrow Articles by Gomez-Cambronero, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS