|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,2
* Department of Physiology, and
Department of Communication Sciences and Disorders, East Carolina University, Greenville, North Carolina, USA; and
# Department of Histology, Kazan State Medical University, Kazan, Russia
1Correspondence: Department of Physiology, Brody School of Medicine, East Carolina University, 600 Moye Blvd., Greenville, NC 27834, USA. E-mail: murashoval{at}ecu.edu
| ABSTRACT |
|---|
|
|
|---|
Key Words: RNA interference axonal protein synthesis siRNA sciatic nerve DRG
| INTRODUCTION |
|---|
|
|
|---|
Recent studies have revealed that the miRNA pathway influences a variety of processes, including early development (19)
, cell proliferation (20)
, and cell death (21)
. Some miRNAs were identified in the vertebrate nervous system (22
, 23)
and in neuronal cells (24
25
26
27)
. It was also shown that miRNAs play an important role in brain development (28)
and neuronal maturation (29
, 30)
. A novel study has indicated that brain-specific miRNAs may regulate dendritic spine development in mammalian brain (31)
. The involvement of miRNAs in dendritic development is particularly interesting, given the indication that selected mRNAs in neurons are delivered to sites of synaptic contact that are remote from the neuronal cell body (32
, 33)
. Although activity of the RNAi pathway was demonstrated in dendrites, the possibility of regulation of axonal protein synthesis via RNAi awaits thorough investigation.
Recent observations demonstrated that translation of mRNAs may occur locally in axonal processes at sites long distances away from the neuronal cell body (34
35
36
37)
. Even though axonal local protein synthesis has been documented in a number of studies, the mechanism of its regulation remains unclear. A recent observation revealed that some cytoskeletal proteins (ß-actin, ß-tubulin, peripherin, vimentin, gamma-tropomyosin 3, and cofilin-1), heat-shock proteins (HSP27, HSP60, HSP70, grp75, alphaB crystallin), and proteins associated with neurodegenerative diseases [ubiquitin C-terminal hydrolase L1, rat ortholog of human DJ-1/Park7, gamma-synuclein, superoxide dismutase (SOD) 1] are synthesized in axonal fibers (38)
. The presence of mRNAs and protein synthesis in axons suggests the existence of a process that regulates protein expression locally. A potential mechanism of regulation of axonal protein synthesis may be RNAi.
In the current study, we asked whether RNAi may be one of the pathways that control local protein synthesis in axons. Here we show that murine sciatic nerve contains a multiprotein complex consisting of AGO2 nuclease, FMRP, p100 nuclease, and Gemin3 (a DEAD-box RNA helicase), which was induced by application of siRNAs. siRNA duplexes against neuronal ß-tubulin applied onto the proximal stump of the sciatic nerve initiated RISC formation, with a concomitant dramatic decrease in levels of ß-tubulin mRNA and a corresponding protein product in the sciatic nerve fibers, as well as a significant reduction in retrograde labeling of lumbar motor neurons with Fluorogold. Our observations indicate that RNAi is functional in peripheral mammalian axons and is independent from the neuronal cell body or Schwann cells. Here we propose a new concept of regulation of axonal protein synthesis via the RNAi pathway.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Surgery, ligatures, and colchicine treatment
Animals were anesthetized with ketamine (18 mg/ml) -xylazine (2 mg/ml) anesthesia (0.5 ml/10 g of body wt, i.p.). As shown in Fig. 1
, the sciatic nerve was cut in the midthigh and a 7 mm silastic tube with a 1.47 mm inner diameter was applied to the proximal nerve stump (39)
. Saline, antineuronal ß-tubulin III siRNA (accession #AF312873), nonspecific control siRNA, or a mixture of siRNA with Fluorogold was pipetted into the tube (7 µl total volume). The lower end of the tube was sealed with petroleum jelly (Vaseline) and glued to the surrounding skeletal muscles with tissue adhesive (3M 228 Vetbond 228). The incision was closed with wound clips. In sham operations, sciatic nerves were exposed but not touched. In some experiments, to investigate whether the RNAi process in sciatic nerve may exist and function independently from the neuronal cell body, a ligation or local application of colchicine was used at the time of the surgery. Ligatures or colchicine (5 mM) were applied at the proximal part of sciatic nerve,
2 cm above the end of the sciatic nerve stump submersed in the pouch, for the duration of the experiment (24 h).
|
Retrograde labeling and quantification of labeled motoneurons
For retrograde labeling of neurons, FITC-conjugated siRNA (Dharmacon, Inc.; Chicago, IL, USA; 2 µl of 20 µM of siRNA in 7 µl of PBS) and/or 7 µl of 5% Fluorogold (Fluorochrom; Denver, CO, USA) in saline was applied to the proximal stump of sciatic nerves. In some experiments, to determine whether siRNA is taken up and/or transported by the sciatic nerve, siRNA targeted at a nonmammalian sequence of firefly Luciferase and labeled with FITC or Cy3 (Dharmacon; 2 µl of 20 µM) was applied onto the sciatic nerve. As a negative control, some sciatic nerves were treated with unconjugated FITC or Cy3. The doses for siRNA and Fluorogold were chosen based on the manufacturers instruction (Dharmacon) and our published observations (39)
. To inhibit protein synthesis in axons, 10 µg/ml cycloheximide (39)
, an inhibitor of protein synthesis (Sigma; St. Louis, MO, USA), was applied onto the sciatic nerve proximal stump. In some experiments, siRNAs were applied to the nerve stump 6 h before application of a mixture containing Fluorogold to allow for the initiation of RNAi machinery. Cryostat serial transversal 30 µm sections of lumbar spinal cord were analyzed with fluorescence microscopy. Fluorogold-labeled neurons were recognized by their size, shape, and location and counted in every section, without allowing for split nucleoli, according to a protocol described elsewhere (40
, 41)
. The images were analyzed for the mean cross-sectional area of neurons using ImageJ (NIH Image). In previous studies, no difference in the mean cross-sectional area of labeled cells between control and treated animals was observed, and Abercrombies correction for neuronal counts was not required (39)
. All values are represented as the mean ± SE. Statistical analysis was performed with one-way ANOVA and Newman-Keuls Multiple Comparison Test using Prism (GraphPad Prism version 3.00 for Windows, GraphPad Software; San Diego, CA, USA).
Spinal cord and sciatic nerve collection
After sacrifice, we carefully verified that the silastic tube was still in place and that the solution did not leak out. Animals with misplaced tubes or leaked out solutions were not used for further analysis. Mice were overdosed with sodium pentobarbital, and spinal cords and sciatic nerves were quickly dissected out, snap frozen in liquid nitrogen, and stored at 80°C. For histology, animals were perfused with cold PBS, followed by cold 4% paraformaldehyde in PBS (pH 7.4). Lumbar spinal cords and sciatic nerves were removed and postfixed in 4% paraformaldehyde for 2 h, cryoprotected in 30% sucrose overnight, and embedded in TBS tissue freezing medium (Triangle Biomedical Science; Durham, NC, USA). Spinal cords and sciatic nerves were cut into 10 µm serial sections (42)
.
In experiments using sciatic nerve in vivo, it is impossible to separate axonal fibers from Schwann cells. That is why in our biochemical and histological experiments we used a portion of sciatic nerve well above the site of siRNA application (unless otherwise noted), so that the Schwann cells of sciatic nerves used in analyses were never in physical contact with siRNAs. We collected an
2 cm portion of sciatic nerve proximal stump
0.5 cm above the treatment site. Therefore, all changes in mRNA and RISC protein levels observed in the study occurred in the portion of sciatic nerve located well above the level of siRNA treatment (Fig. 1)
. We assumed that the probability for Schwann cells to transport siRNA and/or RISC proteins across two membranes or to express RISC in response to axonal uptake of siRNA was extremely low.
Real-time RT-polymerase chain reaction (RT-PCR)
To evaluate the expression of neuronal ß-tubulin III mRNA (accession #AF312873) in the sciatic nerve, real-time quantitative RT-PCR was performed. Total RNA was isolated from intact, sham-operated, or siRNA-treated samples of sciatic nerve (n=6) (43
, 44)
. Samples from the experimental and control tissue were run three times in duplicate using a thermoscript one-step quantitative RT-PCR platinum Taq kit (Invitrogen, Life Technologies; Carlsbad, CA, USA) in the Cepheid RT-PCR thermocycler (Sunnyvale, CA, USA), as described previously (44
, 45)
. The real-time PCR reactions were carried out in the presence of mouse gene-specific primers for neuronal ß-tubulin III (accession #AF312873; forward 5'-GAGGACAGAGCCAAGTGGAC-3' and reverse 5'-CAGGGCCAAGACAAGCAG-3') (46)
, and GAPDH (forward 5'-AGATCCACAACGGATACATT-3' and reverse 5'-5'-TCCCTCAAGATTGTCAGCAA-3') (45)
. The GAPDH served as an internal control to monitor cDNA synthesis efficiency. Relative quantitation of gene expression was based on the model by Pfaffl (47)
, which is based on the relative expression of a target gene vs. a reference gene. Quantification of gene expression was performed by comparing amplified products to the generated ß-actin standard curve (45)
. ß-Tubulin mRNA copy numbers from intact sciatic nerves were taken as 100%. This value was calculated by taking an average of gene copy numbers amplified from the three sets of PCR reactions performed in duplicate.
In situ hybridization
The protocol for in situ hybridization was adapted from a previously described protocol (48)
. Briefly, sections of sciatic nerves were postfixed in 4% paraformaldehyde solution in PBS (pH 7.0) at room temperature for 5 min, washed in PBS twice for 5 min, and incubated in 100% methanol + 0.3% hydrogen peroxide solution for 10 min at 4°C. After two washes in PBS for 10 min, slides were prehybridized at 42°C for 1 h in hybridization buffer containing 600 mM sodium chloride, 50 mM sodium phosphate buffer (pH 7.0), 5.0 mM EDTA (Sigma), 0.02% Ficoll (Sigma), 0.02% BSA (Sigma), 0.02% polyvinylpyrrolidone (Sigma), 200 ng/ml sheared and denatured salmon sperm DNA (Sigma), and 40% formamide (Super Pure, Fisher Scientific; Pittsburgh, PA, USA). Hybridization was performed at 42°C in the same buffer with the addition of dextran sulfate to 7%, tRNA (bakers yeast) to 0.1 mg/ml, poly-A to 10 µg/ml, and biotinylated antisense (5'-biotin-TCTGACCAAAGATAAAGTTGTCGGGCCTGAATAGGTGTCCAAAGG-biotin-3') or sense oligonucleotide probe against neuronal ß-tubulin III (accession #AF312873) to a final concentration of 30 ng/µl of hybridization mixture. After overnight incubation, sections were washed in 2x saline sodium citrate (SSC) at 40°C for 10 min, washed at room temperature for 10 min in 1x SSC, then for 10 min in 0.25x SSC. Sections were subsequently washed in PBS and incubated for 1 h with an avidin-biotin-peroxidase (ABC) reagent (Vector Laboratories; Burlingame, CA, USA). To visualize the signal, anti-horseradish peroxidase, Cy3-conjugated antibodies (Chemicon International, Inc.; Temecula, CA, USA) were applied for 2 h in 1:100 dilution. As a negative control, some sections were pretreated with RNase (42)
before viewing on an Olympus IMT-2 fluorescent microscope or a Zeiss LSM 510 confocal laser scanning microscope.
Protein lysates
Proteins were extracted from the sciatic nerves or spinal cords and subfractionated into s100 and p100 fractions according to a protocol described elsewhere (49)
. Samples of spinal cords and sciatic nerves were homogenized in ice-cold lysis buffer containing 10 mM potassium acetate, 2 mM magnesium acetate, 2 mM DTT, 5 mM HEPES (pH 7.3), 20 µM cytochalasin B, 0.5%, aprotinin, 2 µg/ml leupeptin, 2 µg/ml pepstatin and RNAsin (1 U/µl) and incubated for 10 min on ice. Samples were centrifuged at 1500 g for 15 min at 4°C. After centrifugation, the supernatant (cytoplasmic lysate) was centrifuged at 100,000 g for 45 min at 4°C, yielding supernatant (s100) and pellet (p100) fractions. The p100 fraction was gently resuspended in 1 volume of buffer B and stored at 80°C until ready to use.
Immunoblot analysis
The solubilized proteins were loaded at 20 µg per lane and separated by relative size by SDS-PAGE analysis in precast 5% Tris-HCl gels (Bio-Rad; Hercules, CA, USA), then the separated proteins were transferred to Immobilon P membranes (Millipore Corporation; Bedford, MA, USA). Membranes were probed with primary antibodies according to our standard immunoblotting laboratory procedures. Secondary horseradish peroxidase-conjugated antibodies (Roche Molecular Biochemicals; Indianapolis, IN, USA) were used at 1:5000 dilution. Protein bands were visualized using a chemiluminescence detection system (ECL kit; Amersham; Arlington Heights, IL, USA).
Immunoprecipitation
Following procedures described before (42)
, immunoprecipitation was done in a buffer containing 100 mM KCl, 5 mM EDTA, 10 mM HEPES (pH 7.3), 1 mM DTT, 2 µg/ml of leupeptin, 2 µg/ml of pepstatin, 0.5% aprotinin, and 0.5%Triton-X100. Five micrograms of protein from each sample of p100 fraction was immunoprecipitated with antibodies specific for AGO2 or p100 overnight and precipitated using BSA preblocked protein A-Sepharose beads (BD, PharMingen; San Diego, CA, USA). After overnight incubation, the beads were washed four times with 1% BSA of the previous buffer and centrifuged at 10,000 rpm for 5 min at 4°C. The supernatant was removed and 40 µl of X2 Western Stop solution was added. Samples were boiled for 5 min, centrifuged again, then the supernatant was collected and subjected to electrophoretic analysis on precast 5% Tris-HCl gels (Bio-Rad). Controls included incubation with nonimmune serum, incubation without primary antibodies, and competition of antibodies with recombinant target proteins.
Immunohistochemistry
Sections of sciatic nerves and lumbar spinal cords were processed as described previously (42
, 50)
. Serial sections were stained using the Elite ABC Kit (Vector Laboratories). Tissue antigens were visualized with DAB Substrate Kit for Peroxidase (Vector Laboratories). After staining, sections were air dried and permanently mounted with DPX (Sigma). Incubations without primary or secondary antibodies, or ABC reagent, were used as negative controls. Slides were examined with an Olympus IMT-2 fluorescent microscope. Images were recorded using the Spot digital camera system (Diagnostic Instruments; Sterling Heights, MI, USA).
Fluorescence and confocal microscopy
Sections of sciatic nerves and spinal cords were incubated with primary antibodies (1:100 dilution) overnight at 4°C on a rocker. Secondary FITC-, TX Red-, CY3-, or CY5-conjugated IgG (Jackson ImmunoResearch Laboratories, Inc.; West Grove, PA, USA) were applied in a 1:100 dilution for 1 h at room temperature. Sections were then washed with PBST and stained with 4',6'-diam idino-2-phenylidole (Sigma) for 5 min. Sections were rinsed with dH2O and mounted using antifading Gel/Mount (Biomeda; Foster City, CA, USA). Images were captured using a Spot digital camera. A Zeiss LSM 510 confocal laser scanning microscope was used for double- and triple-stained specimens and for subcellular resolution.
siRNA reagents
ß-Tubulin duplex was purchased from Dharmacon and ready to use in transfection experiments. The siRNA target sequence 5'-GACAGAGCCAAGTGGACTCAC-3' (accession #AF312873) was validated in previous RNAi gene silencing experiments (51)
. The ß-tubulin siRNA duplex consisted of the sequence 5'-CAGAGCCAAGUGGACUCACdTdT/dTdTGUCUCGGUUCACCUGAGUG-5', and the nonspecific control siRNA duplex was 5'-ACUCUAUCGCCAGCGUGACUU/UUUGAGAUAGCGGUCGCACUGP-5' (Dharmacon). Duplexes were dissolved to a final concentration of 20 µM in universal buffer (20 mM KCl, 6 mM HEPES pH 7.5, and 0.2 mM MgCl) according to the manufacturers instruction. For some experiments, the duplexes were labeled with FITC using a SilencerTM siRNA Labeling Kit (Ambion; Austin, TX, USA), according to the manufacturers manual.
General list of antibodies
The following antibodies were used for immunodetection procedures: rabbit polyclonal anti-AGO2-specific antibody (kindly donated by Tom Hobman, University of Alberta, Canada; this antibody was successfully used in an earlier study, see ref. 14
). Guinea pig polyclonal anti-p100 antibody (kindly donated by Tom Keenan, VA Polytechnic Institute and State University, Blacksburg, VA, USA) was tested for specificity (52)
and successfully used elsewhere (14)
. Mouse monoclonal anti-FMRP antibody (7G-1; Developmental Studies Hybridoma Bank) was tested for specificity and successfully used previously (14
, 53)
. Mouse monoclonal anti-Gemin3-specific antibody was from ImmuQuest Ltd., (Cleveland, UK). Anti-Gemin3 antibody (gift from Dr. Gideon Dreyfuss, University of Pennsylvania, Philadelphia, PA, USA) was tested for specificity and successfully used in previous studies (54
, 55)
. Mouse monoclonal neuron-specific beta III tubulin antibody [TUJ-1] was provided by Covance Research Products, Inc. (Denver, PA, USA).
DRG culture
Primary dissociated cultures were prepared from DRGs of adult ICR mice according to a protocol described elsewhere (38)
. Some of the rat DRG cultures were also obtained commercially from Cambrex BioScience (Walkersville, MD, USA). For immunolocalization studies, rat DRGs were cultured at low density on poly-L-lysine/laminin-coated coverslips according to the manufacturers protocol. In some experiments, DRG cultures were transfected with siRNA duplexes using DharmaFECT3 (Dharmacon) according to the manufacturers instructions.
To isolate axonal proteins, we used a culture method for isolation of DRG axons already described (38)
. Briefly, dissociated DRGs were plated into tissue culture inserts containing porous membrane (8 µm pores; BD Falcon, Bedford, MA, USA) coated with poly-L-lysine/laminin. Axons were isolated after 1620 h in culture by carefully scraping cellular contents from the upper membrane surface. For isolation of the cell body compartment, the under surface of the membrane was scraped in an identical manner. Samples obtained were used for protein isolation and subsequent Western blot analysis.
Statistical analysis
Statistical analysis was performed with one-way ANOVA and Newman-Keuls Multiple Comparison Test using Prism (GraphPad Prism version 3.00 for Windows, GraphPad Software; San Diego, CA, USA). All values are represented as the mean ± SE.
| RESULTS |
|---|
|
|
|---|
|
Components of RNAi machinery, AGO2, FMRP, p100, and Gemin3 are present in sciatic nerve fibers
To confirm our finding at the histological level, we performed immunofluorescence on sciatic nerve fibers to investigate the distribution of the known (AGO2, FMRP, and p100) and suspected (Gemin3) components of RISC. Longitudinal sections of an
2 cm portion of sciatic nerve proximal stump (
0.5 cm above the site of siRNA treatment) were incubated with primary antibodies against target proteins and subsequently incubated with secondary antibodies conjugated with Texas Red, FITC, or CY3. The sections were analyzed using a Zeiss LSM 510 confocal laser scanning microscope. Triple immunostaining of these sections revealed immunoreactivity in the sciatic nerve for p100 (blue color-coded), AGO2 (red), FMRP (green), and Gemin3 (green) proteins (Fig. 3
, upper and lower panels). A merge of the images showed coexpression of p100 (blue), AGO2 (red), Gemin3 (green) (Fig. 3
, upper panel) as well as coexpression of p100 (blue), AGO2 (red), and FMRP (green) (Fig. 3
, lower panel). These data demonstrated that AGO2, FMRP, p100, and Gemin3 coexpress in peripheral nerve fibers, providing the necessary substrates for the formation of RISC.
|
Immunostaining of dissociated DRG neurons reveals the presence of RISC proteins in axons
To investigate whether RISC proteins are present in axons of dissociated neuronal cultures, we performed immunofluorescence on rat DRG neurons plated at low density according to a protocol described elsewhere (37
, 38)
. The preparations were stained with antibodies against AGO2, p100, FMRP, and Gemin3, as well as with TUJ1 antibodies against neuronal ß-tubulin and antibodies against growth-associated protein 43 (GAP43). In some experiments, DRG cultures were treated with antitubulin siRNA or nonspecific control for 24 h before immunostaining. Immunofluorescence showed colocalization of p100 with ß-tubulin (Fig. 4
A), p100 with FMRP (Fig. 4B
), p100 with AGO2 (Fig. 4C
), and p100 with Gemin3 (Fig. 4D
). A merge of the images showed a complete overlap between immunofluorescence of the proteins of interest in axons as well as in cell bodies. Incubation of DRG cultures with siRNAs demonstrated successful uptake of siRNA duplexes. FITC-conjugated siRNAs were detected in axons and bodies of DRG neurons. Triple immunofluorescence of DRG cultures treated with antitubulin siRNA confirmed colocalization of p100 with ß-tubulin (Fig. 4E
), p100 with GAP43 (Fig. 4F
), p100 with AGO2 (Fig. 4G
), and p100 with FMRP (Fig. 4H
). These results clearly demonstrated the existence of RISC proteins in axons.
|
To confirm this finding at the protein level, we performed immunoblot analysis on axonal proteins isolated from DRG cultures according to a method described previously (38)
. This method allows the separation of DRG processes from cell body and non-neuronal cells by culturing neurons on a porous membrane that allows passage of axons but restricts the cell body and non-neuronal cells to the upper membrane surface. Proteins extracted from the cell body and axonal preparations were separated by 7.5% SDS-PAGE (10 µg/lane) and transferred to PVDF membrane. To demonstrate the purity of the DRG axonal preparation, membranes were probed with antibodies against MAP-2 and GAP43. MAP2 protein resides in the cell soma and dendrites but does not extend into the axon (37)
, whereas GAP43 is localized to the growing axons and soma (56)
. Our immunoblot showed that MAP2 was present in the cell body fraction but absent from axonal preparation, whereas GAP43 was more abundant in the axonal preparation than in the cell body fraction, thus confirming the purity of the axonal fraction. The immunoblot analysis revealed the presence of RISC proteins (p100, AGO2, FMRP, and Gemin3) in both the cell body and axonal fractions (Fig. 5
). Together with the immunofluorescence experiments on sciatic nerve fibers and dissociated DRG cultures, these data argue that axons possess proteins specific for RISC.
|
AGO2, FMRP, p100, and Gemin3 form complexes within sciatic nerve in response to antitubulin siRNA
The purpose of this experiment was to determine whether AGO2, FMRP, p100, and Gemin3 can form protein complexes in sciatic nerve fibers in response to treatment with siRNA against neuronal ß-tubulin. The proteins were isolated from
1 cm distal and
1 cm proximal parts of the proximal stump dissected out 0.5 cm above the site of siRNA application. The control treatments included saline and nonspecific siRNA. Protein lysates were incubated with AGO2 or p100 antibodies overnight and precipitated using BSA preblocked protein A-Sepharose beads. The precipitated proteins were separated according to relative size by SDS-PAGE analysis in 5% gels, transferred to membranes, and probed with antibodies against AGO2, FMRP, p100, and Gemin3. In all treatment conditions, p100 was shown to coprecipitate with FMRP and AGO2 (Fig. 6
, upper panel), whereas AGO2 was shown to coprecipitate with p100 and Gemin3 (Fig. 6
, middle panel). As expected, expression of the multiprotein complex was more pronounced in response to treatment by siRNA, indicating that the presence of siRNA induces RISC formation (14)
.
|
To investigate whether RNAi may act independently from the neuronal cell body, experiments with ligature and colchicine treatment were performed. The ligature was used to mechanically separate the sciatic nerve proximal stump from the neuronal cell bodies. Colchicine, which causes depolymerization of microtubules (57)
, was used to block axonal transport pharmacologically without affecting the nerve capacity to conduct action potentials. Ligation or colchicine were applied for 24 h at the proximal stump of the sciatic nerve
1.5 cm above the site of the treatment with siRNAs. Experiments showed that neither the ligature nor colchicine affected RISC protein levels in the proximal stump above or below the ligature/colchicine application site. This observation indicated that RISC forms locally and independently from the neuronal cell body.
To see whether Schwann cells may contribute to the expression of RISC proteins, we performed double immunostaining with antibodies against S-100 protein (to label Schwann cells) and with antibodies against RISC proteins. Immunofluorescence demonstrated a nonoverlapping pattern of expression of S-100 and RISC proteins. For example, FMRP, an abundant component of RISC, was detected in axonal fibers but not in Schwann cells (Fig. 6
, lower panel). Taken together, these findings indicate that peripheral axons contain AGO2, FMRP, p100, and Gemin3 proteins, which form multiprotein RISC in response to siRNA treatment. Moreover, our data show that induction of RISC takes place locally and independently from the neuronal cell body or Schwann cells.
Uptake and transport of siRNA by sciatic nerve in vivo
These experiments were performed to determine whether siRNA can be taken up and transported within the peripheral mammalian nerve. We selected siRNA targeted at luciferase, a nonmammalian protein, to use. siRNA firefly luciferase is a common control used elsewhere (58
, 59)
that does not interfere with expression of mammalian proteins. The sciatic nerves of anesthetized animals were severed and anti-luciferase siRNA labeled with FITC or CY3 was applied onto the proximal nerve stump. The mice were allowed to survive for 24 h. After the specified survival period, the sciatic nerves and lumbar spinal cords were removed, frozen, and sectioned on a cryostat. Localization of the siRNA in sciatic neurons was analyzed using a confocal laser scanning microscope. Analysis of these sections revealed localization of the majority of siRNAs at the tip of the severed sciatic nerve, but some fluorescence was also observed along fibers and distributed in the direction of the spinal cord (Fig. 7
). This conclusion was strengthened by our further observation of the uptake and transport of siRNA against ß-tubulin and a nonspecific siRNA control. siRNA against ß-tubulin and control siRNA were conjugated with FITC and applied onto severed sciatic nerves for 24 h. Both specific and control siRNAs were taken up by sciatic nerve fibers (Fig. 7)
. However, no labeling was observed in lumbar motor neurons, indicating that siRNAs were not transported all the way to the spinal cord. Taken together, these results reveal that siRNAs can be taken up by the sciatic nerve.
|
Application of antitubulin siRNA decreases expression of ß-tubulin in sciatic nerve fibers
The aim of this experiment was to determine whether local treatment with siRNA could diminish the local expression of protein in sciatic nerve fibers. The sciatic nerves of anesthetized animals were severed and a silastic tube containing siRNA against ß-tubulin mRNA or nonspecific control was applied onto the proximal nerve stump. Twenty-four hours after surgery, the mice were euthanized and sciatic nerves were removed for analysis. Expression of neuronal ß-tubulin protein in the distal part of the proximal stump of the sciatic nerve was examined by immunostaining using TUJ1, a monoclonal antibody (mAb) against neuron-specific ß-tubulin protein. Tissue antigens were visualized with a DAB Substrate Kit for Peroxidase. A dramatic difference in staining for ß-tubulin protein was observed in experimental vs. control sciatic nerves. Nerve stumps incubated with antitubulin siRNA had almost no ß-tubulin protein in the distal part of the sciatic nerve proximal stump in comparison with controls (Fig. 8
). Furthermore, antitubulin siRNA-treated nerves also exhibited less ß-tubulin protein in the distal part of the sciatic nerve proximal stump compared with the proximal part of the nerve. These results indicated that siRNA taken up into peripheral neurons inhibited local protein synthesis.
|
We used immunoblot analysis to confirm this observation. Proteins were extracted from proximal and distal parts of sciatic nerve proximal stumps treated with antitubulin siRNA or control siRNA for 24 h, according to our experimental procedure described above. The proteins were separated by relative size by SDS-PAGE gels, transferred to PVDF membranes, and probed with TUJ1 antibodies against neuron-specific ß-tubulin, as well as with antibodies against ß-actin. The experiments revealed markedly decreased levels of ß-tubulin in the distal part of the sciatic nerve proximal stump (Fig. 8B
), whereas expression of another cytoskeletal protein ß-actin was unchanged. ANOVA of normalized to ß-actin mean intensity values showed a significant reduction in ß-tubulin expression after siRNA treatment (Fig. 8C
). These results demonstrated that application of antitubulin siRNA markedly diminishes ß-tubulin levels in the treated sciatic nerve. These data suggest that siRNA treatment specifically inhibits protein synthesis in axons.
Real-time RT-PCR shows reduction of ß-tubulin mRNA in sciatic nerve after treatment with antitubulin siRNA
To verify our previous finding at the mRNA level, we used RT-PCR. The goal of this experiment was to examine levels of ß-tubulin mRNA in sciatic nerves treated with antitubulin siRNA or with nonspecific siRNA using real-time RT-PCR. Total RNA was extracted from proximal and distal parts of sciatic nerves treated with antitubulin siRNA or control siRNA for 24 h according to our experimental procedure described earlier. The real-time PCR reaction was carried out in the presence of gene-specific ß-tubulin forward and reverse primers. Relative levels of ß-tubulin mRNA expression were normalized to ß-actin control. Relative gene expression of ß-tubulin mRNA in the siRNA-treated nerves was significantly lower (59930±13750 n=9) than in sciatic nerves treated with control siRNA (113100±15190 n=9; P=0.0195) (Fig. 8D
). These results demonstrate that application of antitubulin siRNA markedly diminishes levels of ß-tubulin mRNA in the treated sciatic nerves. These data provide further evidence that RNAi is active in mammalian axons.
In situ hybridization analysis indicates decrease of expression of ß-tubulin mRNA in sciatic nerves treated with antitubulin siRNA
To confirm our previous observation at the histological level, in situ hybridization and immunohistochemistry were used. The aim of this experiment was to investigate whether locally applied siRNA could specifically diminish the expression of both ß-tubulin mRNA and protein in sciatic nerve fibers. The sciatic nerves of anesthetized animals were severed and incubated with siRNA against ß-tubulin or nonspecific control. Twenty-four hours after surgery, the mice were euthanized and sciatic nerves were removed for analysis. The expression of neuronal ß-tubulin mRNA in sciatic nerves incubated with antitubulin siRNA and with nonspecific control siRNA was analyzed using fluorescent in situ hybridization. After hybridization, sections were immunostained with TUJ1 antibody against neuron-specific ß-tubulin protein. The sections were examined using a Zeiss LSM 510 confocal laser scanning microscope. Analysis of these sections revealed a dramatic decrease in the expression of ß-tubulin mRNA and corresponding protein in experimental vs. control animals (Fig. 9
). These results confirmed that application of antitubulin siRNA onto sciatic nerve results in degradation of ß-tubulin mRNA and inhibition of local protein synthesis of ß-tubulin in sciatic nerve fibers.
|
Local treatment with antitubulin siRNA inhibits retrograde labeling of lumbar motor neurons
The experiments described above demonstrated formation of RNAi effector complexes and specific inhibition of ß-tubulin synthesis in sciatic nerve fibers treated with corresponding siRNA. In the following experiment, we asked whether siRNA may affect the functionality of the sciatic nerve. A specific function of peripheral nerve is anterograde and retrograde axonal transport. This transport depends on the integrity of axon microtubules built of dimers of
-tubulin and ß-tubulin. The hypothesis tested here was that the reduction in ß-tubulin synthesis in sciatic nerve fibers treated with siRNA should impair retrograde transport. For this experiment, retrograde labeling with Fluorogold was used. Mice were anesthetized, the sciatic nerve was severed at midthigh level, and the proximal nerve stump was inserted into a 7 mm silastic tube. ß-Tubulin-specific siRNA was placed in the tube (2 µl of 20 µM in 7 µl of PBS). After a 6 h incubation period to allow for initiation of RNAi machinery, a second surgery was performed in which the tube around the nerve was drained and refilled with fresh antitubulin siRNA (2 µl of 20 µM solution) and a fluorescent tracer, Fluorogold (5 µl of 7% FG). Control animals received equivalent treatment and doses of nonspecific siRNA and Fluorogold. After the second surgery, the lower end of the tube was again sealed with petroleum jelly and the incision was closed. Eighteen hours after the second surgery, mice were euthanized and perfused. The sciatic nerve and lumbar spinal cord were removed and sectioned on a cryostat. Serial coronal 30 µm sections were analyzed with fluorescent microscopy using a wide-band UV filter. Fluorogold-labeled motor neurons identified by their size, shape, and location (Fig. 10
upper panel) were counted in every section without allowing for split nucleoli according to a protocol described elsewhere (39)
.
|
The experiments revealed that the total number of Fluorogold-labeled motoneurons in animals that received antitubulin siRNA was
4.4-fold lower than in control subjects (Fig. 10
, lower panel). Performance of a standard t test revealed a strong significance in these results (204±26 n=4, and 912±107 n=8, respectively; P<0.0001). We also showed that application of the protein synthesis inhibitor cycloheximide onto the proximal stump of the nerve resulted in a significant decrease in the backlabeling (490±93, n=4; P<0.01), similar to siRNA treatment (Fig. 10
, lower panel).
Collectively, the data showed that local inhibition of ß-tubulin synthesis using either siRNA or cycloheximide resulted in a decrease in retrograde labeling. The data indicated that application of antitubulin siRNA affected sciatic nerve functionality locally, dramatically decreasing the retrolabeling of lumbar motor neurons via inhibition of local tubulin synthesis.
| DISCUSSION |
|---|
|
|
|---|
In recent years, RNAi has developed as an effective tool to specifically knock down gene expression in a wide variety of cell types. Several studies have investigated in vivo delivery of siRNA to target diseased neuronal genes of mammals. For example, intrathecal delivery of siRNA targeting the pain-related cation channel P2X3 in rats resulted in degradation of P2X3 mRNA, inhibition of P2X3 protein synthesis, and diminished neuropathic pain responses (60)
. In another study, mice implanted with U87 glioma cells into the caudate-putamen nucleus received a weekly intravenous injection of siRNA targeting the human epidermal growth factor receptor (EGFR), which resulted in reduced tumor expression of immunoreactive EGFR and an 88% increase in survival of the animals (61)
. RNAi was also shown to inhibit polyglutamine-induced neurodegeneration caused by mutant ataxin-1 in mice with spinocerebellar ataxia type 1 after intracerebellar injection of recombinant adeno-associated virus vectors expressing short hairpin RNAs (62)
. However, delivering siRNA to target cells in vivo has been only partially successful in inhibiting target gene expression, and current research efforts in this area are focused on developing effective delivery systems, which will facilitate the study of RNAi in neurons in vivo.
Although recent studies have shown that RNAi machinery exists and is functional in neurons (24
25
26
27)
, no research had been performed to investigate whether RNAi effector complexes and their components are present and can be activated in peripheral nerve axonal fibers. To answer this intriguing question, in the current study we investigated the hypothesis that application of siRNA to peripheral nerves will initiate RNAi. To test our hypothesis, we used the sciatic nerve of mice to investigate the presence of the known (AGO2, FMRP, and p100) and suspected (Gemin3) protein components of RISC and the ability of these proteins to form effector complexes, the uptake and retrograde transport of siRNA, and the action of siRNA on protein synthesis and retrograde labeling.
In experiments using sciatic nerve in vivo, it is impossible to separate axonal fibers from Schwann cells. That is why for all our biochemical and histological analyses we used
2 cm portions of sciatic nerves collected well above the site of siRNA application (
0.5 cm above the upper edge of the tube with siRNA). Thus, the Schwann cells of sciatic nerve used in our analyses were never in physical contact with siRNAs. Therefore, all changes in the levels of mRNA and RISC proteins observed in the study were due to the direct effect of siRNA on axons. The likelihood of Schwann cells transporting RISC proteins across two membranes and/or expressing RISC in response to axonal siRNA remains far from being feasible.
Components of RISC are present and form complexes in peripheral nerve fibers
There is mounting evidence in support of a common architecture for RISC that contains either siRNA or miRNA and the following protein components: AGO2, FMRP, and p100 (14
15
16
17)
. However, miRNAs have also been identified in multiprotein complexes containing eIF2C2 (eukaryotic initiation factor 2C2; the human homologue of AGO2), Gemin3 (a DEAD-box RNA helicase), and Gemin4 (a protein of unknown function that binds with Gemin3) (25
, 26
, 63)
. Considering that the RNA helicase responsible for unwinding siRNAs and miRNAs has yet to be identified, we were curious to know whether Gemin3 may be the elusive RNA helicase component of RISC. Therefore, we investigated the existence of Gemin3 in peripheral axons along with the bona fide protein components of RISC (AGO2, FMRP, and p100). We also examined whether these four proteins assemble into RISC upon application of siRNA to peripheral nerves.
Immunoblot analysis revealed AGO2, FMRP, and p100 proteins in samples from the sciatic nerves, thus providing evidence that the three known components of RISC are present in peripheral nerves. This finding was further supported by detection of immunoreactivity in the sciatic nerve for AGO2, FMRP, and p100 proteins. The presence of Gemin3 in the sciatic nerve was also detected using immunofluorescence. Coexpression of the proteins under investigation also was evident. We then used immunoprecipitation to determine whether the four proteins under investigation form a complex in peripheral nerve fibers. For all treatment conditions, p100 was shown to coprecipitate with FMRP and AGO2, whereas AGO2 was shown to coprecipitate with p100 and Gemin3. As expected, expression of the multiprotein complex was more pronounced in response to treatment by siRNA, indicating that the presence of siRNA induces RISC formation (14)
.
To investigate whether RNAi may act independently from the neuronal cell body, we conducted experiments with ligature and colchicine treatment. The ligature was used to mechanically separate the sciatic nerve from neuronal cell bodies. Colchicine, which causes depolymerization of microtubules, was used to block axonal transport without affecting the nerves capacity to conduct action potentials. Experiments showed that neither the ligature or colchicine treatment affected protein complexes in peripheral nerve, indicating that RISC forms locally and independently of the neuronal cell body. To see whether Schwann cells may contribute to RISC expression, we performed double immunostaining with antibodies against Schwann cells and with antibodies against RISC proteins. The results showed that RISC was localized within axonal fibers and was not induced in surrounding Schwann cells. Taken together, these findings indicate that peripheral axons contain AGO2, FMRP, p100, and Gemin3 proteins, which form multiprotein RISC in response to siRNA treatment. Moreover, our data show that formation of RISC takes place locally and independently from the neuronal cell body or Schwann cells.
RISC proteins are present in axonal preparations from DRG-dissociated cultures
To further confirm our findings, we used a unique method allowing preparation of axonal protein fraction from DRG-dissociated cultures (37)
. This method was successfully used previously to characterize expression of several proteins and their encoding mRNAs in axonal fibers (38)
. Dissociated DRGs are plated into special tissue culture inserts containing a porous membrane that allows passage of axons but restricts the cell body and non-neuronal cells to the upper membrane surface. Thus, axons and bodies are isolated from the opposite surfaces of the membrane and subsequently used for protein isolation and Western blot analysis. Our analysis showed that RISC proteins p100, AGO2, FMRP, and Gemin3 are abundant in both the cell body and axonal fractions.
Moreover, immunofluorescence performed on dissociated DRG neurons unequivocally confirmed our finding that key proteins involved in the RNAi pathway are present in axons. Recently, a new study also reported presence of AGO3, AGO4, and Dicer in developing DRG axons and growth cones in culture (64)
. This further implicates the RNAi pathway as a regulatory mechanism for local protein expression in axons.
Uptake and retrograde transport of siRNAs by the sciatic nerve
Spinal motor neurons and sensory neurons in DRG extend their axons over long distances; therefore, the efficiency of axonal transport in both anterograde and retrograde directions is a crucial parameter in neuronal function. Retrograde axonal transport of target-derived neurotrophic factors is critical for survival, axon growth, and path finding during development and regeneration. Neurotrophins, such as nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), and neurotrophin-3 (NT3), are delivered to the perikarya by retrograde axonal transport by receptor-mediated internalization (65
66
67
68
69)
. In our experiments, we observed the uptake of specific and nonspecific fluorescently labeled siRNAs by the sciatic nerve. While the mechanism of siRNA uptake and delivery remains to be elucidated, further investigation of siRNA retrograde delivery along the sciatic nerve may provide insight into targeted retrograde delivery of siRNA for the inhibition of protein expression in specific populations of neurons.
Action of siRNA on protein synthesis and retrograde labeling
While recent studies have shown that RNAi machinery exists in neurons (24
25
26
27)
and dendrites (31)
, no research had investigated whether siRNAs applied to peripheral nerve axons can affect local protein synthesis. Our experiments showed that application of antitubulin siRNA onto the proximal sciatic nerve stump significantly reduced the level of ß-tubulin mRNA, resulting in markedly diminished synthesis of ß-tubulin protein, whereas the ligatures or colchicine did not interrupt formation of RISC. These data were confirmed using immunohistochemistry, in situ hybridization, and real-time RT-PCR. Furthermore, antitubulin siRNA was shown to sufficiently impair microtubule structure and function, as evidenced by a significantly reduced number of retrogradedly labeled motor neurons (Fig. 11
).
|
Our data provide the first direct evidence that the RNAi machinery exists and is functional in peripheral mammalian axons and is independent from the neuronal cell body or Schwann cells. We hypothesize that RNAi in peripheral nerves may be a mechanism for regulating local axonal protein synthesis. Further studies should provide important insight into the RNAi pathway that regulates local protein synthesis in axons. The ability to specifically modulate expression of axonal proteins using RNAi may have significant clinical potential in the treatment of neurodegenerative diseases, specifically those involving peripheral nerves.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Received for publication April 12, 2006. Accepted for publication September 25, 2006.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
Y. Ye, K. K. Wang, J. Gu, H. Yang, J. Lin, J. A. Ajani, and X. Wu Genetic Variations in MicroRNA-Related Genes Are Novel Susceptibility Loci for Esophageal Cancer Risk Cancer Prevention Research, November 1, 2008; 1(6): 460 - 469. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. R. Mercer, M. E. Dinger, J. Mariani, K. S. Kosik, M. F. Mehler, and J. S. Mattick Noncoding RNAs in Long-Term Memory Formation Neuroscientist, October 1, 2008; 14(5): 434 - 445. [Abstract] [PDF] |
||||
![]() |
J.-F. Mouillet, X. Yan, Q. Ou, L. Jin, L. J. Muglia, P. A. Crawford, and Y. Sadovsky DEAD-Box Protein-103 (DP103, Ddx20) Is Essential for Early Embryonic Development and Modulates Ovarian Morphology and Function Endocrinology, May 1, 2008; 149(5): 2168 - 2175. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Yang, C. P. Dinney, Y. Ye, Y. Zhu, H. B. Grossman, and X. Wu Evaluation of Genetic Variants in MicroRNA-Related Genes and Risk of Bladder Cancer Cancer Res., April 1, 2008; 68(7): 2530 - 2537. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Giuditta, J. Tai Chun, M. Eyman, C. Cefaliello, A. P. Bruno, and M. Crispino Local Gene Expression in Axons and Nerve Endings: The Glia-Neuron Unit Physiol Rev, April 1, 2008; 88(2): 515 - 555. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Price, M. H. Rashid, M. Millecamps, R. Sanoja, J. M. Entrena, and F. Cervero Decreased Nociceptive Sensitization in Mice Lacking the Fragile X Mental Retardation Protein: Role of mGluR1/5 and mTOR J. Neurosci., December 19, 2007; 27(51): 13958 - 13967. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Xing and E. Kieff Epstein-Barr Virus BHRF1 Micro- and Stable RNAs during Latency III and after Induction of Replication J. Virol., September 15, 2007; 81(18): 9967 - 9975. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |