FASEB J. Uncover Your Biological Pathway
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.06-6155com.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-6155comv1
21/3/656    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murashov, A. K.
Right arrow Articles by Van Scott, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murashov, A. K.
Right arrow Articles by Van Scott, M. R.
(The FASEB Journal. 2007;21:656-670.)
© 2007 FASEB

RNAi pathway is functional in peripheral nerve axons

Alexander K. Murashov*,1, Vishnu Chintalgattu*,2, Rustem R. Islamov#,2, Teresa E. Lever{dagger},2, Elena S. Pak*, Paulina L. Sierpinski*, Laxmansa C. Katwa* and Michael R. Van Scott*

* Department of Physiology, and

{dagger} Department of Communication Sciences and Disorders, East Carolina University, Greenville, North Carolina, USA; and

# Department of Histology, Kazan State Medical University, Kazan, Russia

1Correspondence: Department of Physiology, Brody School of Medicine, East Carolina University, 600 Moye Blvd., Greenville, NC 27834, USA. E-mail: murashoval{at}ecu.edu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Recent observations demonstrated that translation of mRNAs may occur in axonal processes at sites that are long distances away from the neuronal perikaria. While axonal protein synthesis has been documented in several studies, the mechanism of its regulation remains unclear. The aim of this study was to investigate whether RNA interference (RNAi) may be one of the pathways that control local protein synthesis in axons. Here we show that sciatic nerve contains Argonaute2 nuclease, fragile X mental retardation protein, p100 nuclease, and Gemin3 helicase—components of the RNA-induced silencing complex (RISC). Application of short-interfering RNAs against neuronal ß-tubulin to the sciatic nerve initiated RISC formation, causing a decrease in levels of neuronal ß-tubulin III mRNA and corresponding protein, as well as a significant reduction in retrograde labeling of lumbar motor neurons. Our observations indicate that RNAi is functional in peripheral mammalian axons and is independent from the neuronal cell body or Schwann cells. We introduce a concept of local regulation of axonal translation via RNAi.—Murashov, A. K., Chintalgattu, V., Islamov, R. R., Lever, T. E., Pak, E. S., Sierpinski, P. L., Katwa, L. C., Van Scott, M. R. RNAi pathway is functional in peripheral nerve axons.


Key Words: RNA interference • axonal protein synthesis • siRNA • sciatic nerve • DRG


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
RNA INTERFERENCE (RNAI) IS A NATURAL MECHANISM that acts to selectively suppress gene expression (1 2 3 4) . The RNAi machinery appears to have appeared early in evolution to protect the eukaryotic genome from endogenous transposable elements and from viral infections (5) . Recent observations demonstrated that in addition to its protective action, RNAi plays an important role during cell growth and differentiation (6) and in early development (7 , 8) . Regulation of protein synthesis via RNAi is based on the expression of a group of small endogenous RNA molecules, called microRNAs (miRNAs). miRNAs are produced by special enzymes called Drosha and Dicer (9 , 10) , with subsequent initiation of the RNA-induced silencing complex (RISC). RISC is a multiprotein complex that is considered to be the effector mechanism of the RNAi pathway (11 12 13) . A common architecture for RISC includes a strand of either miRNA or short interfering RNA (siRNA) and several proteins, including Argonaute2 (AGO2), fragile X mental retardation protein (FMRP), and Tudor-SN/p100 mammalian homologue (14 15 16 17) . The strand of miRNA or siRNA retained within RISC serves as a template to identify the complementary nucleotide sequence of mRNAs within the cell. Finally, through a catalytic process, RISC cleaves target mRNAs, rendering them incapable of protein synthesis (18) .

Recent studies have revealed that the miRNA pathway influences a variety of processes, including early development (19) , cell proliferation (20) , and cell death (21) . Some miRNAs were identified in the vertebrate nervous system (22 , 23) and in neuronal cells (24 25 26 27) . It was also shown that miRNAs play an important role in brain development (28) and neuronal maturation (29 , 30) . A novel study has indicated that brain-specific miRNAs may regulate dendritic spine development in mammalian brain (31) . The involvement of miRNAs in dendritic development is particularly interesting, given the indication that selected mRNAs in neurons are delivered to sites of synaptic contact that are remote from the neuronal cell body (32 , 33) . Although activity of the RNAi pathway was demonstrated in dendrites, the possibility of regulation of axonal protein synthesis via RNAi awaits thorough investigation.

Recent observations demonstrated that translation of mRNAs may occur locally in axonal processes at sites long distances away from the neuronal cell body (34 35 36 37) . Even though axonal local protein synthesis has been documented in a number of studies, the mechanism of its regulation remains unclear. A recent observation revealed that some cytoskeletal proteins (ß-actin, ß-tubulin, peripherin, vimentin, gamma-tropomyosin 3, and cofilin-1), heat-shock proteins (HSP27, HSP60, HSP70, grp75, alphaB crystallin), and proteins associated with neurodegenerative diseases [ubiquitin C-terminal hydrolase L1, rat ortholog of human DJ-1/Park7, gamma-synuclein, superoxide dismutase (SOD) 1] are synthesized in axonal fibers (38) . The presence of mRNAs and protein synthesis in axons suggests the existence of a process that regulates protein expression locally. A potential mechanism of regulation of axonal protein synthesis may be RNAi.

In the current study, we asked whether RNAi may be one of the pathways that control local protein synthesis in axons. Here we show that murine sciatic nerve contains a multiprotein complex consisting of AGO2 nuclease, FMRP, p100 nuclease, and Gemin3 (a DEAD-box RNA helicase), which was induced by application of siRNAs. siRNA duplexes against neuronal ß-tubulin applied onto the proximal stump of the sciatic nerve initiated RISC formation, with a concomitant dramatic decrease in levels of ß-tubulin mRNA and a corresponding protein product in the sciatic nerve fibers, as well as a significant reduction in retrograde labeling of lumbar motor neurons with Fluorogold. Our observations indicate that RNAi is functional in peripheral mammalian axons and is independent from the neuronal cell body or Schwann cells. Here we propose a new concept of regulation of axonal protein synthesis via the RNAi pathway.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Animals
Experiments were performed on 8-wk-old male ICR mice obtained from Charles River Laboratories (Wilmington, MA, USA). Animals were housed one per cage under standard laboratory conditions, with a 12 h light/dark schedule and unlimited access to food and water. Animal protocols were approved by the Animal Care and Use Committee of East Carolina University, an AAALAC-accredited facility.

Surgery, ligatures, and colchicine treatment
Animals were anesthetized with ketamine (18 mg/ml) -xylazine (2 mg/ml) anesthesia (0.5 ml/10 g of body wt, i.p.). As shown in Fig. 1 , the sciatic nerve was cut in the midthigh and a 7 mm silastic tube with a 1.47 mm inner diameter was applied to the proximal nerve stump (39) . Saline, antineuronal ß-tubulin III siRNA (accession #AF312873), nonspecific control siRNA, or a mixture of siRNA with Fluorogold was pipetted into the tube (7 µl total volume). The lower end of the tube was sealed with petroleum jelly (Vaseline) and glued to the surrounding skeletal muscles with tissue adhesive (3M 228 Vetbond 228). The incision was closed with wound clips. In sham operations, sciatic nerves were exposed but not touched. In some experiments, to investigate whether the RNAi process in sciatic nerve may exist and function independently from the neuronal cell body, a ligation or local application of colchicine was used at the time of the surgery. Ligatures or colchicine (5 mM) were applied at the proximal part of sciatic nerve, ~2 cm above the end of the sciatic nerve stump submersed in the pouch, for the duration of the experiment (24 h).


Figure 1
View larger version (31K):
[in this window]
[in a new window]

 
Figure 1. Schematic of experimental procedure for retrograde labeling. See Materials and Methods for details.

Retrograde labeling and quantification of labeled motoneurons
For retrograde labeling of neurons, FITC-conjugated siRNA (Dharmacon, Inc.; Chicago, IL, USA; 2 µl of 20 µM of siRNA in 7 µl of PBS) and/or 7 µl of 5% Fluorogold (Fluorochrom; Denver, CO, USA) in saline was applied to the proximal stump of sciatic nerves. In some experiments, to determine whether siRNA is taken up and/or transported by the sciatic nerve, siRNA targeted at a nonmammalian sequence of firefly Luciferase and labeled with FITC or Cy3 (Dharmacon; 2 µl of 20 µM) was applied onto the sciatic nerve. As a negative control, some sciatic nerves were treated with unconjugated FITC or Cy3. The doses for siRNA and Fluorogold were chosen based on the manufacturer’s instruction (Dharmacon) and our published observations (39) . To inhibit protein synthesis in axons, 10 µg/ml cycloheximide (39) , an inhibitor of protein synthesis (Sigma; St. Louis, MO, USA), was applied onto the sciatic nerve proximal stump. In some experiments, siRNAs were applied to the nerve stump 6 h before application of a mixture containing Fluorogold to allow for the initiation of RNAi machinery. Cryostat serial transversal 30 µm sections of lumbar spinal cord were analyzed with fluorescence microscopy. Fluorogold-labeled neurons were recognized by their size, shape, and location and counted in every section, without allowing for split nucleoli, according to a protocol described elsewhere (40 , 41) . The images were analyzed for the mean cross-sectional area of neurons using ImageJ (NIH Image). In previous studies, no difference in the mean cross-sectional area of labeled cells between control and treated animals was observed, and Abercrombie’s correction for neuronal counts was not required (39) . All values are represented as the mean ± SE. Statistical analysis was performed with one-way ANOVA and Newman-Keuls Multiple Comparison Test using Prism (GraphPad Prism version 3.00 for Windows, GraphPad Software; San Diego, CA, USA).

Spinal cord and sciatic nerve collection
After sacrifice, we carefully verified that the silastic tube was still in place and that the solution did not leak out. Animals with misplaced tubes or leaked out solutions were not used for further analysis. Mice were overdosed with sodium pentobarbital, and spinal cords and sciatic nerves were quickly dissected out, snap frozen in liquid nitrogen, and stored at –80°C. For histology, animals were perfused with cold PBS, followed by cold 4% paraformaldehyde in PBS (pH 7.4). Lumbar spinal cords and sciatic nerves were removed and postfixed in 4% paraformaldehyde for 2 h, cryoprotected in 30% sucrose overnight, and embedded in TBS tissue freezing medium (Triangle Biomedical Science; Durham, NC, USA). Spinal cords and sciatic nerves were cut into 10 µm serial sections (42) .

In experiments using sciatic nerve in vivo, it is impossible to separate axonal fibers from Schwann cells. That is why in our biochemical and histological experiments we used a portion of sciatic nerve well above the site of siRNA application (unless otherwise noted), so that the Schwann cells of sciatic nerves used in analyses were never in physical contact with siRNAs. We collected an ~2 cm portion of sciatic nerve proximal stump ~0.5 cm above the treatment site. Therefore, all changes in mRNA and RISC protein levels observed in the study occurred in the portion of sciatic nerve located well above the level of siRNA treatment (Fig. 1) . We assumed that the probability for Schwann cells to transport siRNA and/or RISC proteins across two membranes or to express RISC in response to axonal uptake of siRNA was extremely low.

Real-time RT-polymerase chain reaction (RT-PCR)
To evaluate the expression of neuronal ß-tubulin III mRNA (accession #AF312873) in the sciatic nerve, real-time quantitative RT-PCR was performed. Total RNA was isolated from intact, sham-operated, or siRNA-treated samples of sciatic nerve (n=6) (43 , 44) . Samples from the experimental and control tissue were run three times in duplicate using a thermoscript one-step quantitative RT-PCR platinum Taq kit (Invitrogen, Life Technologies; Carlsbad, CA, USA) in the Cepheid RT-PCR thermocycler (Sunnyvale, CA, USA), as described previously (44 , 45) . The real-time PCR reactions were carried out in the presence of mouse gene-specific primers for neuronal ß-tubulin III (accession #AF312873; forward 5'-GAGGACAGAGCCAAGTGGAC-3' and reverse 5'-CAGGGCCAAGACAAGCAG-3') (46) , and GAPDH (forward 5'-AGATCCACAACGGATACATT-3' and reverse 5'-5'-TCCCTCAAGATTGTCAGCAA-3') (45) . The GAPDH served as an internal control to monitor cDNA synthesis efficiency. Relative quantitation of gene expression was based on the model by Pfaffl (47) , which is based on the relative expression of a target gene vs. a reference gene. Quantification of gene expression was performed by comparing amplified products to the generated ß-actin standard curve (45) . ß-Tubulin mRNA copy numbers from intact sciatic nerves were taken as 100%. This value was calculated by taking an average of gene copy numbers amplified from the three sets of PCR reactions performed in duplicate.

In situ hybridization
The protocol for in situ hybridization was adapted from a previously described protocol (48) . Briefly, sections of sciatic nerves were postfixed in 4% paraformaldehyde solution in PBS (pH 7.0) at room temperature for 5 min, washed in PBS twice for 5 min, and incubated in 100% methanol + 0.3% hydrogen peroxide solution for 10 min at 4°C. After two washes in PBS for 10 min, slides were prehybridized at 42°C for 1 h in hybridization buffer containing 600 mM sodium chloride, 50 mM sodium phosphate buffer (pH 7.0), 5.0 mM EDTA (Sigma), 0.02% Ficoll (Sigma), 0.02% BSA (Sigma), 0.02% polyvinylpyrrolidone (Sigma), 200 ng/ml sheared and denatured salmon sperm DNA (Sigma), and 40% formamide (Super Pure, Fisher Scientific; Pittsburgh, PA, USA). Hybridization was performed at 42°C in the same buffer with the addition of dextran sulfate to 7%, tRNA (baker’s yeast) to 0.1 mg/ml, poly-A to 10 µg/ml, and biotinylated antisense (5'-biotin-TCTGACCAAAGATAAAGTTGTCGGGCCTGAATAGGTGTCCAAAGG-biotin-3') or sense oligonucleotide probe against neuronal ß-tubulin III (accession #AF312873) to a final concentration of 30 ng/µl of hybridization mixture. After overnight incubation, sections were washed in 2x saline sodium citrate (SSC) at 40°C for 10 min, washed at room temperature for 10 min in 1x SSC, then for 10 min in 0.25x SSC. Sections were subsequently washed in PBS and incubated for 1 h with an avidin-biotin-peroxidase (ABC) reagent (Vector Laboratories; Burlingame, CA, USA). To visualize the signal, anti-horseradish peroxidase, Cy3-conjugated antibodies (Chemicon International, Inc.; Temecula, CA, USA) were applied for 2 h in 1:100 dilution. As a negative control, some sections were pretreated with RNase (42) before viewing on an Olympus IMT-2 fluorescent microscope or a Zeiss LSM 510 confocal laser scanning microscope.

Protein lysates
Proteins were extracted from the sciatic nerves or spinal cords and subfractionated into s100 and p100 fractions according to a protocol described elsewhere (49) . Samples of spinal cords and sciatic nerves were homogenized in ice-cold lysis buffer containing 10 mM potassium acetate, 2 mM magnesium acetate, 2 mM DTT, 5 mM HEPES (pH 7.3), 20 µM cytochalasin B, 0.5%, aprotinin, 2 µg/ml leupeptin, 2 µg/ml pepstatin and RNAsin (1 U/µl) and incubated for 10 min on ice. Samples were centrifuged at 1500 g for 15 min at 4°C. After centrifugation, the supernatant (cytoplasmic lysate) was centrifuged at 100,000 g for 45 min at 4°C, yielding supernatant (s100) and pellet (p100) fractions. The p100 fraction was gently resuspended in 1 volume of buffer B and stored at –80°C until ready to use.

Immunoblot analysis
The solubilized proteins were loaded at 20 µg per lane and separated by relative size by SDS-PAGE analysis in precast 5% Tris-HCl gels (Bio-Rad; Hercules, CA, USA), then the separated proteins were transferred to Immobilon P membranes (Millipore Corporation; Bedford, MA, USA). Membranes were probed with primary antibodies according to our standard immunoblotting laboratory procedures. Secondary horseradish peroxidase-conjugated antibodies (Roche Molecular Biochemicals; Indianapolis, IN, USA) were used at 1:5000 dilution. Protein bands were visualized using a chemiluminescence detection system (ECL kit; Amersham; Arlington Heights, IL, USA).

Immunoprecipitation
Following procedures described before (42) , immunoprecipitation was done in a buffer containing 100 mM KCl, 5 mM EDTA, 10 mM HEPES (pH 7.3), 1 mM DTT, 2 µg/ml of leupeptin, 2 µg/ml of pepstatin, 0.5% aprotinin, and 0.5%Triton-X100. Five micrograms of protein from each sample of p100 fraction was immunoprecipitated with antibodies specific for AGO2 or p100 overnight and precipitated using BSA preblocked protein A-Sepharose beads (BD, PharMingen; San Diego, CA, USA). After overnight incubation, the beads were washed four times with 1% BSA of the previous buffer and centrifuged at 10,000 rpm for 5 min at 4°C. The supernatant was removed and 40 µl of X2 Western Stop solution was added. Samples were boiled for 5 min, centrifuged again, then the supernatant was collected and subjected to electrophoretic analysis on precast 5% Tris-HCl gels (Bio-Rad). Controls included incubation with nonimmune serum, incubation without primary antibodies, and competition of antibodies with recombinant target proteins.

Immunohistochemistry
Sections of sciatic nerves and lumbar spinal cords were processed as described previously (42 , 50) . Serial sections were stained using the Elite ABC Kit (Vector Laboratories). Tissue antigens were visualized with DAB Substrate Kit for Peroxidase (Vector Laboratories). After staining, sections were air dried and permanently mounted with DPX (Sigma). Incubations without primary or secondary antibodies, or ABC reagent, were used as negative controls. Slides were examined with an Olympus IMT-2 fluorescent microscope. Images were recorded using the Spot digital camera system (Diagnostic Instruments; Sterling Heights, MI, USA).

Fluorescence and confocal microscopy
Sections of sciatic nerves and spinal cords were incubated with primary antibodies (1:100 dilution) overnight at 4°C on a rocker. Secondary FITC-, TX Red-, CY3-, or CY5-conjugated IgG (Jackson ImmunoResearch Laboratories, Inc.; West Grove, PA, USA) were applied in a 1:100 dilution for 1 h at room temperature. Sections were then washed with PBST and stained with 4',6'-diam idino-2-phenylidole (Sigma) for 5 min. Sections were rinsed with dH2O and mounted using antifading Gel/Mount (Biomeda; Foster City, CA, USA). Images were captured using a Spot digital camera. A Zeiss LSM 510 confocal laser scanning microscope was used for double- and triple-stained specimens and for subcellular resolution.

siRNA reagents
ß-Tubulin duplex was purchased from Dharmacon and ready to use in transfection experiments. The siRNA target sequence 5'-GACAGAGCCAAGTGGACTCAC-3' (accession #AF312873) was validated in previous RNAi gene silencing experiments (51) . The ß-tubulin siRNA duplex consisted of the sequence 5'-CAGAGCCAAGUGGACUCACdTdT/dTdTGUCUCGGUUCACCUGAGUG-5', and the nonspecific control siRNA duplex was 5'-ACUCUAUCGCCAGCGUGACUU/UUUGAGAUAGCGGUCGCACUGP-5' (Dharmacon). Duplexes were dissolved to a final concentration of 20 µM in universal buffer (20 mM KCl, 6 mM HEPES pH 7.5, and 0.2 mM MgCl) according to the manufacturer’s instruction. For some experiments, the duplexes were labeled with FITC using a SilencerTM siRNA Labeling Kit (Ambion; Austin, TX, USA), according to the manufacturer’s manual.

General list of antibodies
The following antibodies were used for immunodetection procedures: rabbit polyclonal anti-AGO2-specific antibody (kindly donated by Tom Hobman, University of Alberta, Canada; this antibody was successfully used in an earlier study, see ref. 14 ). Guinea pig polyclonal anti-p100 antibody (kindly donated by Tom Keenan, VA Polytechnic Institute and State University, Blacksburg, VA, USA) was tested for specificity (52) and successfully used elsewhere (14) . Mouse monoclonal anti-FMRP antibody (7G-1; Developmental Studies Hybridoma Bank) was tested for specificity and successfully used previously (14 , 53) . Mouse monoclonal anti-Gemin3-specific antibody was from ImmuQuest Ltd., (Cleveland, UK). Anti-Gemin3 antibody (gift from Dr. Gideon Dreyfuss, University of Pennsylvania, Philadelphia, PA, USA) was tested for specificity and successfully used in previous studies (54 , 55) . Mouse monoclonal neuron-specific beta III tubulin antibody [TUJ-1] was provided by Covance Research Products, Inc. (Denver, PA, USA).

DRG culture
Primary dissociated cultures were prepared from DRGs of adult ICR mice according to a protocol described elsewhere (38) . Some of the rat DRG cultures were also obtained commercially from Cambrex BioScience (Walkersville, MD, USA). For immunolocalization studies, rat DRGs were cultured at low density on poly-L-lysine/laminin-coated coverslips according to the manufacturer’s protocol. In some experiments, DRG cultures were transfected with siRNA duplexes using DharmaFECT3 (Dharmacon) according to the manufacturer’s instructions.

To isolate axonal proteins, we used a culture method for isolation of DRG axons already described (38) . Briefly, dissociated DRGs were plated into tissue culture inserts containing porous membrane (8 µm pores; BD Falcon, Bedford, MA, USA) coated with poly-L-lysine/laminin. Axons were isolated after 16–20 h in culture by carefully scraping cellular contents from the upper membrane surface. For isolation of the cell body compartment, the under surface of the membrane was scraped in an identical manner. Samples obtained were used for protein isolation and subsequent Western blot analysis.

Statistical analysis
Statistical analysis was performed with one-way ANOVA and Newman-Keuls Multiple Comparison Test using Prism (GraphPad Prism version 3.00 for Windows, GraphPad Software; San Diego, CA, USA). All values are represented as the mean ± SE.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Immunodetection of components of RISC in sciatic nerve and spinal cord lysates
The aim of this experiment was to determine whether the known components of mammalian RISC (AGO2, FMRP, and p100) were present in the sciatic nerve fibers. For these experiments we chose to target neuronal ß-tubulin because it is one of the abundant cytoskeletal proteins known to be synthesized locally in the axonal fibers (38) . Proximal stumps of sciatic nerves transected at midthigh level were incubated with antitubulin siRNA, nonspecific control siRNA, or vehicle for 24 h. For protein extraction we used a 2 cm portion of sciatic nerve 0.5 cm above the site of treatment (Fig. 1) . For spinal cord protein extracts we used lumbar spinal cord from the corresponding animals. Protein samples isolated from sciatic nerves and spinal cords were resolved by SDS/PAGE electrophoresis and transferred to membranes, which were subsequently probed with antibodies against AGO2, FMRP, and p100. These antibodies have been successfully used elsewhere (14) . Immunoblot analysis revealed the presence of AGO2, FMRP, and p100 proteins in samples from the spinal cord (Fig. 2 , upper panel) and sciatic nerves (Fig. 2 , lower panel). In sciatic nerves, pretreatment with antitubulin siRNA visibly increased the level of p100 expression, which may be a sign of induction by siRNA. The data of this experiment demonstrated that the three known components of RISC (AGO2, FMRP, and p100) were present in sciatic nerve fibers.


Figure 2
View larger version (67K):
[in this window]
[in a new window]

 
Figure 2. Immunoblot analysis provides evidence of AGO2, FMRP, and p100 proteins in spinal cords and sciatic nerves. Protein lysates isolated from sciatic nerves or spinal cords were resolved by electrophoresis, transferred to membranes, then probed with antibodies against AGO2 (1:1000), FMRP (1:1000), and p100 (1:1000). 20 µg of protein was loaded per each lane. Immunoblot analysis revealed AGO2, FMRP, and p100 proteins in samples from the spinal cords (upper panel) and sciatic nerves (lower panel). Note that in sciatic nerves, pretreatment with siRNA increased the level of p100 expression.

Components of RNAi machinery, AGO2, FMRP, p100, and Gemin3 are present in sciatic nerve fibers
To confirm our finding at the histological level, we performed immunofluorescence on sciatic nerve fibers to investigate the distribution of the known (AGO2, FMRP, and p100) and suspected (Gemin3) components of RISC. Longitudinal sections of an ~2 cm portion of sciatic nerve proximal stump (~0.5 cm above the site of siRNA treatment) were incubated with primary antibodies against target proteins and subsequently incubated with secondary antibodies conjugated with Texas Red, FITC, or CY3. The sections were analyzed using a Zeiss LSM 510 confocal laser scanning microscope. Triple immunostaining of these sections revealed immunoreactivity in the sciatic nerve for p100 (blue color-coded), AGO2 (red), FMRP (green), and Gemin3 (green) proteins (Fig. 3 , upper and lower panels). A merge of the images showed coexpression of p100 (blue), AGO2 (red), Gemin3 (green) (Fig. 3 , upper panel) as well as coexpression of p100 (blue), AGO2 (red), and FMRP (green) (Fig. 3 , lower panel). These data demonstrated that AGO2, FMRP, p100, and Gemin3 coexpress in peripheral nerve fibers, providing the necessary substrates for the formation of RISC.


Figure 3
View larger version (76K):
[in this window]
[in a new window]

 
Figure 3. Confocal immunofluorescence for p100, AGO2, Gemin3, and FMRP proteins in sciatic nerve fibers. Longitudinal sections of sciatic nerves were incubated with primary antibodies against p100, AGO2, and Gemin3 or FMRP and subsequently incubated with secondary antibodies conjugated with Texas Red, FITC, or CY5. All primary antibodies were applied in a concentration of 1:100. Upper panel shows triple staining against p100 (blue), AGO2 (red), and Gemin3 (green). Lower panel shows triple staining against p100 (blue), AGO2 (red), and FMRP (green). The fluorescent signals indicate that the major components of RISC (p100, AGO2, Gemin3, and FMRP) are expressed in sciatic nerve fibers (indicated by white arrows).

Immunostaining of dissociated DRG neurons reveals the presence of RISC proteins in axons
To investigate whether RISC proteins are present in axons of dissociated neuronal cultures, we performed immunofluorescence on rat DRG neurons plated at low density according to a protocol described elsewhere (37 , 38) . The preparations were stained with antibodies against AGO2, p100, FMRP, and Gemin3, as well as with TUJ1 antibodies against neuronal ß-tubulin and antibodies against growth-associated protein 43 (GAP43). In some experiments, DRG cultures were treated with antitubulin siRNA or nonspecific control for 24 h before immunostaining. Immunofluorescence showed colocalization of p100 with ß-tubulin (Fig. 4 A), p100 with FMRP (Fig. 4B ), p100 with AGO2 (Fig. 4C ), and p100 with Gemin3 (Fig. 4D ). A merge of the images showed a complete overlap between immunofluorescence of the proteins of interest in axons as well as in cell bodies. Incubation of DRG cultures with siRNAs demonstrated successful uptake of siRNA duplexes. FITC-conjugated siRNAs were detected in axons and bodies of DRG neurons. Triple immunofluorescence of DRG cultures treated with antitubulin siRNA confirmed colocalization of p100 with ß-tubulin (Fig. 4E ), p100 with GAP43 (Fig. 4F ), p100 with AGO2 (Fig. 4G ), and p100 with FMRP (Fig. 4H ). These results clearly demonstrated the existence of RISC proteins in axons.


Figure 4
View larger version (43K):
[in this window]
[in a new window]

 
Figure 4. RISC proteins in dissociated DRG cultures imaged by confocal microscopy. Cultures of rat DRG neurons were colabeled with antibodies to p100 (blue) and to A) neuronal ß-tubulin (red); B) FMRP (red); C) AGO2 (red); D) Gemin3 (red). Merges of the images indicate colocalization of the studied proteins in soma and axons. E–H) Fluorescent images of neurons in DRG cultures treated with antitubulin siRNA conjugated with FITC (green). E) Colocalization of p100 (blue) and ß-tubulin (red). F) colocalization of p100 (blue) and GAP43 (red). G) Colocalization of p100 (blue) and AGO2 (red). H) Colocalization of p100 (blue) and FMRP (red). Merged images reveal colocalization of investigated proteins and siRNA to soma and axons. White arrows indicate cell bodies, arrowheads show axons.

To confirm this finding at the protein level, we performed immunoblot analysis on axonal proteins isolated from DRG cultures according to a method described previously (38) . This method allows the separation of DRG processes from cell body and non-neuronal cells by culturing neurons on a porous membrane that allows passage of axons but restricts the cell body and non-neuronal cells to the upper membrane surface. Proteins extracted from the cell body and axonal preparations were separated by 7.5% SDS-PAGE (10 µg/lane) and transferred to PVDF membrane. To demonstrate the purity of the DRG axonal preparation, membranes were probed with antibodies against MAP-2 and GAP43. MAP2 protein resides in the cell soma and dendrites but does not extend into the axon (37) , whereas GAP43 is localized to the growing axons and soma (56) . Our immunoblot showed that MAP2 was present in the cell body fraction but absent from axonal preparation, whereas GAP43 was more abundant in the axonal preparation than in the cell body fraction, thus confirming the purity of the axonal fraction. The immunoblot analysis revealed the presence of RISC proteins (p100, AGO2, FMRP, and Gemin3) in both the cell body and axonal fractions (Fig. 5 ). Together with the immunofluorescence experiments on sciatic nerve fibers and dissociated DRG cultures, these data argue that axons possess proteins specific for RISC.


Figure 5
View larger version (64K):
[in this window]
[in a new window]

 
Figure 5. Immunoblot analysis for p100, AGO2, Gemin3, and FMRP proteins in axonal protein fraction. Protein were extracted from the neuronal cell body (N) and axonal preparations (A) from mouse DRG cultures. Samples were loaded 10 µg per lane and separated by 7.5% SDS-PAGE. MAP2, which resides in the cell soma and dendrites but is restricted from axons, was present in the cell body fraction but absent from axonal preparation. By immunoblotting, a band corresponding to GAP43 was more abundant in the axonal preparation than in the cell body fraction. RISC proteins p100, AGO2, FMRP, and Gemin3 were present in both cell body and axonal fractions.

AGO2, FMRP, p100, and Gemin3 form complexes within sciatic nerve in response to antitubulin siRNA
The purpose of this experiment was to determine whether AGO2, FMRP, p100, and Gemin3 can form protein complexes in sciatic nerve fibers in response to treatment with siRNA against neuronal ß-tubulin. The proteins were isolated from ~1 cm distal and ~1 cm proximal parts of the proximal stump dissected out 0.5 cm above the site of siRNA application. The control treatments included saline and nonspecific siRNA. Protein lysates were incubated with AGO2 or p100 antibodies overnight and precipitated using BSA preblocked protein A-Sepharose beads. The precipitated proteins were separated according to relative size by SDS-PAGE analysis in 5% gels, transferred to membranes, and probed with antibodies against AGO2, FMRP, p100, and Gemin3. In all treatment conditions, p100 was shown to coprecipitate with FMRP and AGO2 (Fig. 6 , upper panel), whereas AGO2 was shown to coprecipitate with p100 and Gemin3 (Fig. 6 , middle panel). As expected, expression of the multiprotein complex was more pronounced in response to treatment by siRNA, indicating that the presence of siRNA induces RISC formation (14) .


Figure 6
View larger version (52K):
[in this window]
[in a new window]

 
Figure 6. AGO2, FMRP, p100, and Gemin3 form a complex within sciatic nerves in response to application of siRNA onto proximal sciatic nerve stump. Upper panel: immunoprecipitation with p100 antibodies. 5 µg of protein of each sample of p100 fraction were incubated with specific antibodies against p100, resolved in 5% Tris-HCl gels, and transferred to membranes. Membranes were probed with primary antibodies against FMRP (1:1000) and AGO2 (1:1000) according to our standard immunoblotting laboratory procedures. p100 was shown to coprecipitate with FMRP and AGO2 in response to siRNA treatment while AGO2 was shown to coprecipitate with p100 and Gemin3. Middle panel: immunoprecipitation with Ago2 antibodies. Samples were precipitated with antibodies against AGO2, resolved in 5% gels, transferred to membranes, and probed with primary antibodies against p100 (1:1000) and Gemin3 (1:500). As shown, AGO2 was coprecipitated with p100 and Gemin3 in response to siRNA treatment. Lower panel: double immunostaining with antibodies against S-100 (1:100) to label Schwann cells and with antibodies against FMRP (1:100) demonstrated nonoverlapping pattern of expression in axonal fibers where the proximal stump was treated with siRNA. White arrows indicate Schwann cells.

To investigate whether RNAi may act independently from the neuronal cell body, experiments with ligature and colchicine treatment were performed. The ligature was used to mechanically separate the sciatic nerve proximal stump from the neuronal cell bodies. Colchicine, which causes depolymerization of microtubules (57) , was used to block axonal transport pharmacologically without affecting the nerve capacity to conduct action potentials. Ligation or colchicine were applied for 24 h at the proximal stump of the sciatic nerve ~1.5 cm above the site of the treatment with siRNAs. Experiments showed that neither the ligature nor colchicine affected RISC protein levels in the proximal stump above or below the ligature/colchicine application site. This observation indicated that RISC forms locally and independently from the neuronal cell body.

To see whether Schwann cells may contribute to the expression of RISC proteins, we performed double immunostaining with antibodies against S-100 protein (to label Schwann cells) and with antibodies against RISC proteins. Immunofluorescence demonstrated a nonoverlapping pattern of expression of S-100 and RISC proteins. For example, FMRP, an abundant component of RISC, was detected in axonal fibers but not in Schwann cells (Fig. 6 , lower panel). Taken together, these findings indicate that peripheral axons contain AGO2, FMRP, p100, and Gemin3 proteins, which form multiprotein RISC in response to siRNA treatment. Moreover, our data show that induction of RISC takes place locally and independently from the neuronal cell body or Schwann cells.

Uptake and transport of siRNA by sciatic nerve in vivo
These experiments were performed to determine whether siRNA can be taken up and transported within the peripheral mammalian nerve. We selected siRNA targeted at luciferase, a nonmammalian protein, to use. siRNA firefly luciferase is a common control used elsewhere (58 , 59) that does not interfere with expression of mammalian proteins. The sciatic nerves of anesthetized animals were severed and anti-luciferase siRNA labeled with FITC or CY3 was applied onto the proximal nerve stump. The mice were allowed to survive for 24 h. After the specified survival period, the sciatic nerves and lumbar spinal cords were removed, frozen, and sectioned on a cryostat. Localization of the siRNA in sciatic neurons was analyzed using a confocal laser scanning microscope. Analysis of these sections revealed localization of the majority of siRNAs at the tip of the severed sciatic nerve, but some fluorescence was also observed along fibers and distributed in the direction of the spinal cord (Fig. 7 ). This conclusion was strengthened by our further observation of the uptake and transport of siRNA against ß-tubulin and a nonspecific siRNA control. siRNA against ß-tubulin and control siRNA were conjugated with FITC and applied onto severed sciatic nerves for 24 h. Both specific and control siRNAs were taken up by sciatic nerve fibers (Fig. 7) . However, no labeling was observed in lumbar motor neurons, indicating that siRNAs were not transported all the way to the spinal cord. Taken together, these results reveal that siRNAs can be taken up by the sciatic nerve.


Figure 7
View larger version (73K):
[in this window]
[in a new window]

 
Figure 7. Uptake and retrograde transport of siRNA in sciatic nerves. Upper left image: the proximal stump of a sciatic nerve was incubated for 24 h in FITC-labeled anti-luciferase siRNA. Arrows show uptake of siRNA (green fluorescence) into sciatic nerve fibers. Upper right image: sciatic stump incubated with FITC alone as a negative control. Lower left image: arrows show uptake and retrograde transport of siRNA (green fluorescence) into sciatic nerve fibers. Red indicates immunofluorescence for tubulin protein. Lower right image: anti-ß-tubulin siRNA is indicated by green/yellow fluorescence (arrows) in sciatic nerve fibers. Red indicates immunofluorescence for tubulin protein.

Application of antitubulin siRNA decreases expression of ß-tubulin in sciatic nerve fibers
The aim of this experiment was to determine whether local treatment with siRNA could diminish the local expression of protein in sciatic nerve fibers. The sciatic nerves of anesthetized animals were severed and a silastic tube containing siRNA against ß-tubulin mRNA or nonspecific control was applied onto the proximal nerve stump. Twenty-four hours after surgery, the mice were euthanized and sciatic nerves were removed for analysis. Expression of neuronal ß-tubulin protein in the distal part of the proximal stump of the sciatic nerve was examined by immunostaining using TUJ1, a monoclonal antibody (mAb) against neuron-specific ß-tubulin protein. Tissue antigens were visualized with a DAB Substrate Kit for Peroxidase. A dramatic difference in staining for ß-tubulin protein was observed in experimental vs. control sciatic nerves. Nerve stumps incubated with antitubulin siRNA had almost no ß-tubulin protein in the distal part of the sciatic nerve proximal stump in comparison with controls (Fig. 8 ). Furthermore, antitubulin siRNA-treated nerves also exhibited less ß-tubulin protein in the distal part of the sciatic nerve proximal stump compared with the proximal part of the nerve. These results indicated that siRNA taken up into peripheral neurons inhibited local protein synthesis.


Figure 8
View larger version (31K):
[in this window]
[in a new window]

 
Figure 8. Decrease in immunohistochemical staining against ß-III tubulin protein and reduction of neuronal ß-tubulin mRNA in sciatic nerve fibers treated with antitubulin siRNA. A) Immunohistochemical staining against neuronal tubulin using TUJ1 antibodies (1:1000). Left image shows a sciatic nerve treated with nonspecific control siRNA. Right image shows a sciatic nerve treated with siRNA targeted at ß-tubulin mRNA. Black arrow indicates a decrease in tubulin immunoreactivity in the distal end of the proximal nerve stump after incubation with antitubulin siRNA. B) Western blot analysis of neuronal ß-III tubulin levels in sciatic nerve using TUJ1 antibodies. PN, proximal part of the proximal sciatic nerve stump treated with nonspecific control siRNA; PT, proximal part of the proximal sciatic nerve stump treated with antitubulin siRNA; DN, distal part of the proximal sciatic nerve stump treated with nonspecific control siRNA; DT, distal part of the proximal sciatic nerve stump treated with antitubulin siRNA. Note the lower level of ß-III tubulin in distal part of the proximal sciatic nerve stump treated with antitubulin siRNA. Immunostaining for ß-actin shows no change in ß-actin expression in response to siRNA application. C) Bar graph represents mean optical density (OD) values of neuronal ß-III tubulin registered from autoradiographs. Data are expressed as mean of five separate measurements normalized to ß -actin. Level of ß-III tubulin was significantly lower in the distal part of sciatic nerve stumps treated with siRNA (P<0.01). D) Real-time quantitative RT-PCR of ß-tubulin mRNA. Graph indicates relative change in ß-tubulin gene expression. Abbreviations are the same as in the previous graph. Levels of ß-tubulin mRNA were significantly lower in the distal part of sciatic nerve stumps treated with siRNA when compared with nonspecific control siRNA (P<0.05).

We used immunoblot analysis to confirm this observation. Proteins were extracted from proximal and distal parts of sciatic nerve proximal stumps treated with antitubulin siRNA or control siRNA for 24 h, according to our experimental procedure described above. The proteins were separated by relative size by SDS-PAGE gels, transferred to PVDF membranes, and probed with TUJ1 antibodies against neuron-specific ß-tubulin, as well as with antibodies against ß-actin. The experiments revealed markedly decreased levels of ß-tubulin in the distal part of the sciatic nerve proximal stump (Fig. 8B ), whereas expression of another cytoskeletal protein ß-actin was unchanged. ANOVA of normalized to ß-actin mean intensity values showed a significant reduction in ß-tubulin expression after siRNA treatment (Fig. 8C ). These results demonstrated that application of antitubulin siRNA markedly diminishes ß-tubulin levels in the treated sciatic nerve. These data suggest that siRNA treatment specifically inhibits protein synthesis in axons.

Real-time RT-PCR shows reduction of ß-tubulin mRNA in sciatic nerve after treatment with antitubulin siRNA
To verify our previous finding at the mRNA level, we used RT-PCR. The goal of this experiment was to examine levels of ß-tubulin mRNA in sciatic nerves treated with antitubulin siRNA or with nonspecific siRNA using real-time RT-PCR. Total RNA was extracted from proximal and distal parts of sciatic nerves treated with antitubulin siRNA or control siRNA for 24 h according to our experimental procedure described earlier. The real-time PCR reaction was carried out in the presence of gene-specific ß-tubulin forward and reverse primers. Relative levels of ß-tubulin mRNA expression were normalized to ß-actin control. Relative gene expression of ß-tubulin mRNA in the siRNA-treated nerves was significantly lower (59930±13750 n=9) than in sciatic nerves treated with control siRNA (113100±15190 n=9; P=0.0195) (Fig. 8D ). These results demonstrate that application of antitubulin siRNA markedly diminishes levels of ß-tubulin mRNA in the treated sciatic nerves. These data provide further evidence that RNAi is active in mammalian axons.

In situ hybridization analysis indicates decrease of expression of ß-tubulin mRNA in sciatic nerves treated with antitubulin siRNA
To confirm our previous observation at the histological level, in situ hybridization and immunohistochemistry were used. The aim of this experiment was to investigate whether locally applied siRNA could specifically diminish the expression of both ß-tubulin mRNA and protein in sciatic nerve fibers. The sciatic nerves of anesthetized animals were severed and incubated with siRNA against ß-tubulin or nonspecific control. Twenty-four hours after surgery, the mice were euthanized and sciatic nerves were removed for analysis. The expression of neuronal ß-tubulin mRNA in sciatic nerves incubated with antitubulin siRNA and with nonspecific control siRNA was analyzed using fluorescent in situ hybridization. After hybridization, sections were immunostained with TUJ1 antibody against neuron-specific ß-tubulin protein. The sections were examined using a Zeiss LSM 510 confocal laser scanning microscope. Analysis of these sections revealed a dramatic decrease in the expression of ß-tubulin mRNA and corresponding protein in experimental vs. control animals (Fig. 9 ). These results confirmed that application of antitubulin siRNA onto sciatic nerve results in degradation of ß-tubulin mRNA and inhibition of local protein synthesis of ß-tubulin in sciatic nerve fibers.


Figure 9
View larger version (42K):
[in this window]
[in a new window]

 
Figure 9. Decrease of mRNA and protein levels of neuronal ß-tubulin in sciatic nerve fibers after application of antitubulin siRNA onto the proximal stump of sciatic nerve. Fluorescent in situ hybridization for ß-tubulin mRNA and immunofluorescence for ß-tubulin protein in sciatic nerves. Upper panel shows sciatic nerve fibers of the proximal stump treated with nonspecific control siRNA. Lower panel shows sciatic nerve fibers of the proximal stump treated with antitubulin siRNA. Green fluorescence shows the distribution of retrogradely transported FITC-conjugated specific or nonspecific siRNAs in sciatic nerve fibers. Red fluorescence indicates immunodetection of tubulin protein with TUJ1 antibodies (1:100). Blue and purple signals indicate ß-tubulin mRNA. White arrows indicate the location of fluorescent signals within the nerve fibers. Note that the levels of ß-tubulin mRNA and tubulin protein are abundant in the upper panel and diminished in the lower panel.

Local treatment with antitubulin siRNA inhibits retrograde labeling of lumbar motor neurons
The experiments described above demonstrated formation of RNAi effector complexes and specific inhibition of ß-tubulin synthesis in sciatic nerve fibers treated with corresponding siRNA. In the following experiment, we asked whether siRNA may affect the functionality of the sciatic nerve. A specific function of peripheral nerve is anterograde and retrograde axonal transport. This transport depends on the integrity of axon microtubules built of dimers of {alpha}-tubulin and ß-tubulin. The hypothesis tested here was that the reduction in ß-tubulin synthesis in sciatic nerve fibers treated with siRNA should impair retrograde transport. For this experiment, retrograde labeling with Fluorogold was used. Mice were anesthetized, the sciatic nerve was severed at midthigh level, and the proximal nerve stump was inserted into a 7 mm silastic tube. ß-Tubulin-specific siRNA was placed in the tube (2 µl of 20 µM in 7 µl of PBS). After a 6 h incubation period to allow for initiation of RNAi machinery, a second surgery was performed in which the tube around the nerve was drained and refilled with fresh antitubulin siRNA (2 µl of 20 µM solution) and a fluorescent tracer, Fluorogold (5 µl of 7% FG). Control animals received equivalent treatment and doses of nonspecific siRNA and Fluorogold. After the second surgery, the lower end of the tube was again sealed with petroleum jelly and the incision was closed. Eighteen hours after the second surgery, mice were euthanized and perfused. The sciatic nerve and lumbar spinal cord were removed and sectioned on a cryostat. Serial coronal 30 µm sections were analyzed with fluorescent microscopy using a wide-band UV filter. Fluorogold-labeled motor neurons identified by their size, shape, and location (Fig. 10 upper panel) were counted in every section without allowing for split nucleoli according to a protocol described elsewhere (39) .


Figure 10
View larger version (45K):
[in this window]
[in a new window]

 
Figure 10. Reduction in retrograde labeling of lumbar motor neurons with Fluorogold after application of antitubulin siRNA onto the proximal stump of sciatic nerve. Upper panel: coronal section of the lumbar spinal cord showing Fluorogold-labeled motoneurons (arrows) 18 h after application of a mixture of Fluorogold with siRNA to the proximal stump of the transected sciatic nerve. Top left image: sciatic nerve proximal stump treated with nonspecific control siRNA. Top right image: sciatic nerve proximal stump treated with antitubulin siRNA. Lower graph: total number of Fluorogold-labeled lumbar motor neurons after application of nonspecific siRNA, cycloheximide, or antitubulin siRNA onto sciatic nerves. C, sciatic nerves treated with control siRNA; CH, sciatic nerves treated with cycloheximide; siRNA, sciatic nerves treated with antitubulin siRNA.

The experiments revealed that the total number of Fluorogold-labeled motoneurons in animals that received antitubulin siRNA was ~4.4-fold lower than in control subjects (Fig. 10 , lower panel). Performance of a standard t test revealed a strong significance in these results (204±26 n=4, and 912±107 n=8, respectively; P<0.0001). We also showed that application of the protein synthesis inhibitor cycloheximide onto the proximal stump of the nerve resulted in a significant decrease in the backlabeling (490±93, n=4; P<0.01), similar to siRNA treatment (Fig. 10 , lower panel).

Collectively, the data showed that local inhibition of ß-tubulin synthesis using either siRNA or cycloheximide resulted in a decrease in retrograde labeling. The data indicated that application of antitubulin siRNA affected sciatic nerve functionality locally, dramatically decreasing the retrolabeling of lumbar motor neurons via inhibition of local tubulin synthesis.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Studies of axonal growth and remodeling of peripheral nerves in response to developmental clues and injury indicate that translation can occur outside the soma, in axons and nerve terminals (34 35 36 37 38) . Recent observation revealed that several proteins and the encoding mRNAs for the cytoskeletal proteins ß-actin, ß-tubulin, peripherin, vimentin, gamma-tropomyosin 3, and cofilin-1 were present in the axonal fibers (38) . In addition to the cytoskeletal elements, several heat-shock proteins (HSP27, HSP60, HSP70, grp75, alphaB crystallin), resident endoplasmic reticulum proteins (calreticulin, grp78/BiP, ERp29), proteins associated with neurodegenerative diseases (ubiquitin C-terminal hydrolase L1, rat ortholog of human DJ-1/Park7, gamma-synuclein, SOD 1), antioxidant proteins (peroxiredoxins 1 and 6), and metabolic proteins (e.g., phosphoglycerate kinase 1 (PGK 1), alpha enolase, and aldolase C/Zebrin II) were found among the axonally synthesized proteins (38) . The presence of RNAs and protein synthesis in axons implies the existence of a process that regulates protein synthesis locally. One of the potential mechanisms in regulating axonal protein synthesis may be RNAi.

In recent years, RNAi has developed as an effective tool to specifically knock down gene expression in a wide variety of cell types. Several studies have investigated in vivo delivery of siRNA to target diseased neuronal genes of mammals. For example, intrathecal delivery of siRNA targeting the pain-related cation channel P2X3 in rats resulted in degradation of P2X3 mRNA, inhibition of P2X3 protein synthesis, and diminished neuropathic pain responses (60) . In another study, mice implanted with U87 glioma cells into the caudate-putamen nucleus received a weekly intravenous injection of siRNA targeting the human epidermal growth factor receptor (EGFR), which resulted in reduced tumor expression of immunoreactive EGFR and an 88% increase in survival of the animals (61) . RNAi was also shown to inhibit polyglutamine-induced neurodegeneration caused by mutant ataxin-1 in mice with spinocerebellar ataxia type 1 after intracerebellar injection of recombinant adeno-associated virus vectors expressing short hairpin RNAs (62) . However, delivering siRNA to target cells in vivo has been only partially successful in inhibiting target gene expression, and current research efforts in this area are focused on developing effective delivery systems, which will facilitate the study of RNAi in neurons in vivo.

Although recent studies have shown that RNAi machinery exists and is functional in neurons (24 25 26 27) , no research had been performed to investigate whether RNAi effector complexes and their components are present and can be activated in peripheral nerve axonal fibers. To answer this intriguing question, in the current study we investigated the hypothesis that application of siRNA to peripheral nerves will initiate RNAi. To test our hypothesis, we used the sciatic nerve of mice to investigate the presence of the known (AGO2, FMRP, and p100) and suspected (Gemin3) protein components of RISC and the ability of these proteins to form effector complexes, the uptake and retrograde transport of siRNA, and the action of siRNA on protein synthesis and retrograde labeling.

In experiments using sciatic nerve in vivo, it is impossible to separate axonal fibers from Schwann cells. That is why for all our biochemical and histological analyses we used ~2 cm portions of sciatic nerves collected well above the site of siRNA application (~0.5 cm above the upper edge of the tube with siRNA). Thus, the Schwann cells of sciatic nerve used in our analyses were never in physical contact with siRNAs. Therefore, all changes in the levels of mRNA and RISC proteins observed in the study were due to the direct effect of siRNA on axons. The likelihood of Schwann cells transporting RISC proteins across two membranes and/or expressing RISC in response to axonal siRNA remains far from being feasible.

Components of RISC are present and form complexes in peripheral nerve fibers
There is mounting evidence in support of a common architecture for RISC that contains either siRNA or miRNA and the following protein components: AGO2, FMRP, and p100 (14 15 16 17) . However, miRNAs have also been identified in multiprotein complexes containing eIF2C2 (eukaryotic initiation factor 2C2; the human homologue of AGO2), Gemin3 (a DEAD-box RNA helicase), and Gemin4 (a protein of unknown function that binds with Gemin3) (25 , 26 , 63) . Considering that the RNA helicase responsible for unwinding siRNAs and miRNAs has yet to be identified, we were curious to know whether Gemin3 may be the elusive RNA helicase component of RISC. Therefore, we investigated the existence of Gemin3 in peripheral axons along with the bona fide protein components of RISC (AGO2, FMRP, and p100). We also examined whether these four proteins assemble into RISC upon application of siRNA to peripheral nerves.

Immunoblot analysis revealed AGO2, FMRP, and p100 proteins in samples from the sciatic nerves, thus providing evidence that the three known components of RISC are present in peripheral nerves. This finding was further supported by detection of immunoreactivity in the sciatic nerve for AGO2, FMRP, and p100 proteins. The presence of Gemin3 in the sciatic nerve was also detected using immunofluorescence. Coexpression of the proteins under investigation also was evident. We then used immunoprecipitation to determine whether the four proteins under investigation form a complex in peripheral nerve fibers. For all treatment conditions, p100 was shown to coprecipitate with FMRP and AGO2, whereas AGO2 was shown to coprecipitate with p100 and Gemin3. As expected, expression of the multiprotein complex was more pronounced in response to treatment by siRNA, indicating that the presence of siRNA induces RISC formation (14) .

To investigate whether RNAi may act independently from the neuronal cell body, we conducted experiments with ligature and colchicine treatment. The ligature was used to mechanically separate the sciatic nerve from neuronal cell bodies. Colchicine, which causes depolymerization of microtubules, was used to block axonal transport without affecting the nerve’s capacity to conduct action potentials. Experiments showed that neither the ligature or colchicine treatment affected protein complexes in peripheral nerve, indicating that RISC forms locally and independently of the neuronal cell body. To see whether Schwann cells may contribute to RISC expression, we performed double immunostaining with antibodies against Schwann cells and with antibodies against RISC proteins. The results showed that RISC was localized within axonal fibers and was not induced in surrounding Schwann cells. Taken together, these findings indicate that peripheral axons contain AGO2, FMRP, p100, and Gemin3 proteins, which form multiprotein RISC in response to siRNA treatment. Moreover, our data show that formation of RISC takes place locally and independently from the neuronal cell body or Schwann cells.

RISC proteins are present in axonal preparations from DRG-dissociated cultures
To further confirm our findings, we used a unique method allowing preparation of axonal protein fraction from DRG-dissociated cultures (37) . This method was successfully used previously to characterize expression of several proteins and their encoding mRNAs in axonal fibers (38) . Dissociated DRGs are plated into special tissue culture inserts containing a porous membrane that allows passage of axons but restricts the cell body and non-neuronal cells to the upper membrane surface. Thus, axons and bodies are isolated from the opposite surfaces of the membrane and subsequently used for protein isolation and Western blot analysis. Our analysis showed that RISC proteins p100, AGO2, FMRP, and Gemin3 are abundant in both the cell body and axonal fractions.

Moreover, immunofluorescence performed on dissociated DRG neurons unequivocally confirmed our finding that key proteins involved in the RNAi pathway are present in axons. Recently, a new study also reported presence of AGO3, AGO4, and Dicer in developing DRG axons and growth cones in culture (64) . This further implicates the RNAi pathway as a regulatory mechanism for local protein expression in axons.

Uptake and retrograde transport of siRNAs by the sciatic nerve
Spinal motor neurons and sensory neurons in DRG extend their axons over long distances; therefore, the efficiency of axonal transport in both anterograde and retrograde directions is a crucial parameter in neuronal function. Retrograde axonal transport of target-derived neurotrophic factors is critical for survival, axon growth, and path finding during development and regeneration. Neurotrophins, such as nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), and neurotrophin-3 (NT3), are delivered to the perikarya by retrograde axonal transport by receptor-mediated internalization (65 66 67 68 69) . In our experiments, we observed the uptake of specific and nonspecific fluorescently labeled siRNAs by the sciatic nerve. While the mechanism of siRNA uptake and delivery remains to be elucidated, further investigation of siRNA retrograde delivery along the sciatic nerve may provide insight into targeted retrograde delivery of siRNA for the inhibition of protein expression in specific populations of neurons.

Action of siRNA on protein synthesis and retrograde labeling
While recent studies have shown that RNAi machinery exists in neurons (24 25 26 27) and dendrites (31) , no research had investigated whether siRNAs applied to peripheral nerve axons can affect local protein synthesis. Our experiments showed that application of antitubulin siRNA onto the proximal sciatic nerve stump significantly reduced the level of ß-tubulin mRNA, resulting in markedly diminished synthesis of ß-tubulin protein, whereas the ligatures or colchicine did not interrupt formation of RISC. These data were confirmed using immunohistochemistry, in situ hybridization, and real-time RT-PCR. Furthermore, antitubulin siRNA was shown to sufficiently impair microtubule structure and function, as evidenced by a significantly reduced number of retrogradedly labeled motor neurons (Fig. 11 ).


Figure 11
View larger version (20K):
[in this window]
[in a new window]

 
Figure 11. Schematic representation of the proposed local RNAi mechanism in axonal fibers. The schematic shows that application of antitubulin siRNA onto the sciatic nerve induces the cascade of events including RISC formation, degradation of ß-tubulin mRNA, inhibition of ß-tubulin protein synthesis, and impairment of retrograde axonal transport.

Our data provide the first direct evidence that the RNAi machinery exists and is functional in peripheral mammalian axons and is independent from the neuronal cell body or Schwann cells. We hypothesize that RNAi in peripheral nerves may be a mechanism for regulating local axonal protein synthesis. Further studies should provide important insight into the RNAi pathway that regulates local protein synthesis in axons. The ability to specifically modulate expression of axonal proteins using RNAi may have significant clinical potential in the treatment of neurodegenerative diseases, specifically those involving peripheral nerves.


   ACKNOWLEDGMENTS
 
We are grateful to Dr. Jeffery Twiss for helpful comments and suggestions and to Dr. Dianna Willis for sharing DRG culture protocol. We would like to acknowledge the following scientists for their kind donation of antibodies for use in our research: Dr. Tom Hobman (University of Alberta, Canada; rabbit polyclonal anti-AGO2 antibody), Dr. Tom Keenan (Virginia Polytechnic Institute and State University, Blacksburg, VA, USA; guinea pig polyclonal anti-p100 antibody), and Dr. Gideon Dreyfuss (University of Pennsylvania, Philadelphia, PA, USA; anti-Gemin3 antibody). We also thank Dr. Douglas Weidner (East Carolina University, Greenville, NC, USA) for assistance with confocal microscopy. This work was partially supported by Rosnauka contract #02.442.11.7319 (R.R.I).


   FOOTNOTES
 
2 These authors contributed equally to this work.

Received for publication April 12, 2006. Accepted for publication September 25, 2006.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Ambros, V. (2003) MicroRNA pathways in flies and worms: growth, death, fat, stress, and timing. Cell 113,673-676[CrossRef][Medline]
  2. Cerutti, H. (2003) RNA interference: traveling in the cell and gaining functions?. Trends Genet. 19,39-46[CrossRef][Medline]
  3. Hannon, G. J. (2002) RNA interference. Nature 418,244-251[CrossRef][Medline]
  4. Scherr, M., Eder, M. (2004) RNAi in functional genomics. Curr. Opin. Mol. Ther. 6,129-135[Medline]
  5. Shi, Y. (2003) Mammalian RNAi for the masses. Trends Genet. 19,9-12[CrossRef][Medline]
  6. McManus, M. T., Sharp, P. A. (2002) Gene silencing in mammals by small interfering RNAs. Nat. Rev. Genet. 3,737-747[CrossRef][Medline]
  7. Carrington, J. C., Ambros, V. (2003) Role of microRNAs in plant and animal development. Science 301,336-338[Abstract/Free Full Text]
  8. Wienholds, E., Koudijs, M. J., van Eeden, F. J., Cuppen, E., Plasterk, R. H. (2003) The microRNA-producing enzyme Dicer1 is essential for zebrafish development. Nat. Genet. 35,217-218[CrossRef][Medline]
  9. Bernstein, E., Caudy, A. A., Hammond, S. M., Hannon, G. J. (2001) Role for a bidentate ribonuclease in the initiation step of RNA interference. Nature 409,363-366[CrossRef][Medline]
  10. Lee, Y., Ahn, C., Han, J., Choi, H., Kim, J., Yim, J., Lee, J., Provost, P., Radmark, O., Kim, S., Kim, V. N. (2003) The nuclear RNase III Drosha initiates microRNA processing. Nature 425,415-419[CrossRef][Medline]
  11. Hammond, S. M., Bernstein, E., Beach, D., Hannon, G. J. (2000) An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature 404,293-296[CrossRef][Medline]
  12. Hammond, S. M., Boettcher, S., Caudy, A. A., Kobayashi, R., Hannon, G. J. (2001) Argonaute2, a link between genetic and biochemical analyses of RNAi. Science 293,1146-1150[Abstract/Free Full Text]
  13. Sharp, P. A., Zamore, P. D. (2000) Molecular biology. RNA interference. Science 287,2431-2433[Free Full Text]
  14. Caudy, A. A., Ketting, R. F., Hammond, S. M., Denli, A. M., Bathoorn, A. M., Tops, B. B., Silva, J. M., Myers, M. M., Hannon, G. J., Plasterk, R. H. (2003) A micrococcal nuclease homologue in RNAi effector complexes. Nature 425,411-414[CrossRef][Medline]
  15. Doench, J. G., Petersen, C. P., Sharp, P. A. (2003) siRNAs can function as miRNAs. Genes Dev. 17,438-442[Abstract/Free Full Text]
  16. Hutvagner, G., Zamore, P. D. (2002) A microRNA in a multiple-turnover RNAi enzyme complex. Science 297,2056-2060[Abstract/Free Full Text]
  17. Zeng, Y., Yi, R., Cullen, B. R. (2003) MicroRNAs and small interfering RNAs can inhibit mRNA expression by similar mechanisms. Proc. Natl. Acad. Sci. U. S. A. 100,9779-9784[Abstract/Free Full Text]
  18. Tijsterman, M., Plasterk, R. H. (2004) Dicers at RISC; the mechanism of RNAi. Cell 117,1-3[CrossRef][Medline]
  19. Reinhart, B. J., Slack, F. J., Basson, M., Pasquinelli, A. E., Bettinger, J. C., Rougvie, A. E., Horvitz, H. R., Ruvkun, G. (2000) The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403,901-906[CrossRef][Medline]
  20. Chen, J. F., Mandel, E. M., Thomson, J. M., Wu, Q., Callis, T. E., Hammond, S. M., Conlon, F. L., Wang, D. Z. (2005) The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. Nat. Genet. 38,228-233
  21. Brennecke, J., Hipfner, D. R., Stark, A., Russell, R. B., Cohen, S. M. (2003) bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila. Cell 113,25-36[CrossRef][Medline]
  22. Kim, J., Krichevsky, A., Grad, Y., Hayes, G. D., Kosik, K. S., Church, G. M., Ruvkun, G. (2004) Identification of many microRNAs that copurify with polyribosomes in mammalian neurons. Proc. Natl. Acad. Sci. U. S. A. 101,360-365[Abstract/Free Full Text]
  23. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. (2003) A microRNA array reveals extensive regulation of microRNAs during brain development. RNA 9,1274-1281[Abstract/Free Full Text]
  24. Caudy, A. A., Myers, M., Hannon, G. J., Hammond, S. M. (2002) Fragile X-related protein and VIG associate with the RNA interference machinery. Genes Dev. 16,2491-2496[Abstract/Free Full Text]
  25. Nelson, P. T., Hatzigeorgiou, A. G., Mourelatos, Z. (2004) miRNP:mRNA association in polyribosomes in a human neuronal cell line. RNA 10,387-394[Abstract/Free Full Text]
  26. Dostie, J., Mourelatos, Z., Yang, M., Sharma, A., Dreyfuss, G. (2003) Numerous microRNPs in neuronal cells containing novel microRNAs. RNA 9,180-186[Abstract/Free Full Text]
  27. Krichevsky, A. M., Kosik, K. S. (2002) RNAi functions in cultured mammalian neurons. Proc. Natl. Acad. Sci. U. S. A. 99,11926-11929[Abstract/Free Full Text]
  28. Giraldez, A. J., Cinalli, R. M., Glasner, M. E., Enright, A. J., Thomson, J. M., Baskerville, S., Hammond, S. M., Bartel, D. P., Schier, A. F. (2005) MicroRNAs regulate brain morphogenesis in zebrafish. Science 308,833-838[Abstract/Free Full Text]
  29. Miska, E. A., Alvarez-Saavedra, E., Townsend, M., Yoshii, A., Sestan, N., Rakic, P., Constantine-Paton, M., Horvitz, H. R. (2004) Microarray analysis of microRNA expression in the developing mammalian brain. Genome Biol. 5,R68[CrossRef][Medline]
  30. Sempere, L. F., Freemantle, S., Pitha-Rowe, I., Moss, E., Dmitrovsky, E., Ambros, V. (2004) Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol. 5,R13[CrossRef][Medline]
  31. Schratt, G. M., Tuebing, F., Nigh, E. A., Kane, C. G., Sabatini, M. E., Kiebler, M., Greenberg, M. E. (2006) A brain-specific microRNA regulates dendritic spine development. Nature 439,283-289[CrossRef][Medline]
  32. Eberwine, J., Belt, B., Kacharmina, J. E., Miyashiro, K. (2002) Analysis of subcellularly localized mRNAs using in situ hybridization, mRNA amplification, and expression profiling. Neurochem. Res. 27,1065-1077[CrossRef][Medline]
  33. Kiebler, M. A., DesGroseillers, L. (2000) Molecular insights into mRNA transport and local translation in the mammalian nervous system. Neuron 25,19-28[CrossRef][Medline]
  34. Brittis, P. A., Lu, Q., Flanagan, J. G. (2002) Axonal protein synthesis provides a mechanism for localized regulation at an intermediate target. Cell 110,223-235[CrossRef][Medline]
  35. Giuditta, A., Kaplan, B. B., van Minnen, J., Alvarez, J., Koenig, E. (2002) Axonal and presynaptic protein synthesis: new insights into the biology of the neuron. Trends Neurosci. 25,400-404[CrossRef][Medline]
  36. Lee, S. K., Hollenbeck, P. J. (2003) Organization and translation of mRNA in sympathetic axons. J. Cell Sci. 116,4467-4478[Abstract/Free Full Text]
  37. Zheng, J. Q., Kelly, T. K., Chang, B., Ryazantsev, S., Rajasekaran, A. K., Martin, K. C., Twiss, J. L. (2001) A functional role for intra-axonal protein synthesis during axonal regeneration from adult sensory neurons. J. Neurosci. 21,9291-9303[Abstract/Free Full Text]
  38. Willis, D., Li, K. W., Zheng, J. Q., Chang, J. H., Smit, A., Kelly, T., Merianda, T. T., Sylvester, J., van Minnen, J., Twiss, J. L. (2005) Differential transport and local translation of cytoskeletal, injury-response, and neurodegeneration protein mRNAs in axons. J. Neurosci. 25,778-791[Abstract/Free Full Text]
  39. Murashov, A. K., Islamov, R. R., McMurray, R. J., Pak, E. S., Weidner, D. A. (2004) Estrogen increases retrograde labeling of motoneurons: evidence of a nongenomic mechanism. Am. J. Physiol. 287,C320-C326
  40. Wagey, R., Lurot, S., Perrelet, D., Pelech, S. L., Sagot, Y., Krieger, C. (2001) Phosphatidylinositol 3-kinase activity in murine motoneuron disease: the progressive motor neuropathy mouse. Neuroscience 103,257-266[CrossRef][Medline]
  41. McMurray, R., Islamov, R., Murashov, A. K. (2003) Raloxifene analog LY117018 enhances the regeneration of sciatic nerve in ovariectomized female mice. Brain Res. 980,140-145[CrossRef][Medline]
  42. Murashov, A. K., Ul Haq, I., Hill, C., Park, E., Smith, M., Wang, X., Goldberg, D. J., Wolgemuth, D. J. (2001) Crosstalk between p38, Hsp25 and Akt in spinal motor neurons after sciatic nerve injury. Brain Res. Mol. Brain Res. 93,199-208[Medline]
  43. Islamov, R. R., Chintalgattu, V., McMurray, R. J., Pak, E. S., Murashov, A. K., Katwa, L. C. (2003) Differential expression of endothelin receptors in regenerating spinal motor neurons in mice. Brain Res. Mol. Brain Res. 116,163-167[Medline]
  44. Islamov, R. R., Chintalgattu, V., Pak, E. S., Katwa, L. C., Murashov, A. K. (2004) Induction of VEGF and its Flt-1 receptor after sciatic nerve crush injury. NeuroReport 15,2117-2121[CrossRef][Medline]
  45. Chintalgattu, V., Nair, D. M., Katwa, L. C. (2003) Cardiac myofibroblasts: a novel source of vascular endothelial growth factor (VEGF) and its receptors Flt-1 and KDR. J. Mol. Cell Cardiol. 35,277-286[CrossRef][Medline]
  46. Sharifi, N., Reuss, A. E., Wray, S. (2002) Prenatal LHRH neurons in nasal explant cultures express estrogen receptor beta transcript. Endocrinology 143,2503-2507[Abstract/Free Full Text]
  47. Pfaffl, M. W. (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29,e45[Abstract/Free Full Text]
  48. Murashov, A. K., Wolgemuth, D. J. (1996) Sense and antisense transcripts of the developmentally regulated murine hsp70.2 gene are expressed in distinct and only partially overlapping areas in the adult brain. Brain Res. Mol. Brain Res. 37,85-95[Medline]
  49. Siomi, M. C., Zhang, Y., Siomi, H., Dreyfuss, G. (1996) Specific sequences in the fragile X syndrome protein FMR1 and the FXR proteins mediate their binding to 60S ribosomal subunits and the interactions among them. Mol. Cell Biol. 16,3825-3832[Abstract]
  50. Murashov, A. K., Talebian, S., Wolgemuth, D. J. (1998) Role of heat shock protein Hsp25 in the response of the orofacial nuclei motor system to physiological stress. Brain Res. Mol. Brain Res. 63,14-24[Medline]
  51. Yu, J. Y., DeRuiter, S. L., Turner, D. L. (2002) RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc. Natl. Acad. Sci. U. S. A. 99,6047-6052[Abstract/Free Full Text]
  52. Keenan, T. W., Winter, S., Rackwitz, H. R., Heid, H. W. (2000) Nuclear coactivator protein p100 is present in endoplasmic reticulum and lipid droplets of milk secreting cells. Biochim. Biophys. Acta 1523,84-90[Medline]
  53. Brown, V., Jin, P., Ceman, S., Darnell, J. C., O’Donnell, W. T., Tenenbaum, S. A., Jin, X., Feng, Y., Wilkinson, K. D., Keene, J. D., Darnell, R. B., Warren, S. T. (2001) Microarray identification of FMRP-associated brain mRNAs and altered mRNA translational profiles in fragile X syndrome. Cell 107,477-487[CrossRef][Medline]
  54. Gubitz, A. K., Mourelatos, Z., Abel, L., Rappsilber, J., Mann, M., Dreyfuss, G. (2002) Gemin5, a novel WD repeat protein component of the SMN complex that binds Sm proteins. J. Biol. Chem. 277,5631-5636[Abstract/Free Full Text]
  55. Pushkin, S., Cubits, A. K., Massenet, S., Dreyfuss, G. (2002) The SMN complex, an assemblyosome of ribonucleoproteins. Curr. Opin. Cell Biol. 14,305-312[CrossRef][Medline]
  56. Shen, Y., Mani, S., Donovan, S. L., Schwob, J. E., Meiri, K. F. (2002) Growth-associated protein-43 is required for commissural axon guidance in the developing vertebrate nervous system. J. Neurosci. 22,239-247[Abstract/Free Full Text]
  57. Mader, K., Andermahr, J., Angelov, D. N., Neiss, W. F. (2004) Dual mode of signalling of the axotomy reaction: retrograde electric stimulation or block of retrograde transport differently mimic the reaction of motoneurons to nerve transection in the rat brainstem. J. Neurotrauma 21,956-968[CrossRef][Medline]
  58. Guo, S., Tschammer, N., Mohammed, S., Guo, P. (2005) Specific delivery of therapeutic RNAs to cancer cells via the dimerization mechanism of phi29 motor pRNA. Hum. Gene. Ther. 16,1097-1109[CrossRef][Medline]
  59. Soutschek, J., Akinc, A., Bramlage, B., Charisse, K., Constien, R., Donoghue, M., Elbashir, S., Geick, A., Hadwiger, P., Harborth, J., et al (2004) Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs. Nature 432,173-178[CrossRef][Medline]
  60. Dorn, G., Patel, S., Wotherspoon, G., Hemmings-Mieszczak, M., Barclay, J., Natt, F. J., Martin, P., Bevan, S., Fox, A., Ganju, P., et al (2004) siRNA relieves chronic neuropathic pain. Nucleic Acids Res. 32,e49[Abstract/Free Full Text]
  61. Zhang, Y., Zhang, Y. F., Bryant, J., Charles, A., Boado, R. J., Pardridge, W. M. (2004) Intravenous RNA interference gene therapy targeting the human epidermal growth factor receptor prolongs survival in intracranial brain cancer. Clin. Cancer Res. 10,3667-3677[Abstract/Free Full Text]
  62. Xia, H., Mao, Q., Eliason, S. L., Harper, S. Q., Martins, I. H., Orr, H. T., Paulson, H. L., Yang, L., Kotin, R. M., Davidson, B. L. (2004) RNAi suppresses polyglutamine-induced neurodegeneration in a model of spinocerebellar ataxia. Nat. Med. 10,816-820[CrossRef][Medline]
  63. Mourelatos, Z., Dostie, J., Paushkin, S., Sharma, A., Charroux, B., Abel, L., Rappsilber, J., Mann, M., Dreyfuss, G. (2002) miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs. Genes Dev. 16,720-728[Abstract/Free Full Text]
  64. Hengst, U., Cox, L. J., Macosko, E. Z., Jaffrey, S. R. (2006) Functional and selective RNA interference in developing axons and growth cones. J. Neurosci. 26,5727-5232[Abstract/Free Full Text]
  65. Markus, A., Patel, T. D., Snider, W. D. (2002) Neurotrophic factors and axonal growth. Curr. Opin. Neurobiol. 12,523-531[CrossRef][Medline]
  66. Ginty, D. D., Segal, R. A. (2002) Retrograde neurotrophin signaling: Trk-ing along the axon. Curr. Opin. Neurobiol. 12,268-274[CrossRef][Medline]
  67. Kuruvilla, R., Ye, H., Ginty, D. D. (2000) Spatially and functionally distinct roles of the PI3-K effector pathway during NGF signaling in sympathetic neurons. Neuron 27,499-512[CrossRef][Medline]
  68. Delcroix, J. D., Valletta, J. S., Wu, C., Hunt, S. J., Kowal, A. S., Mobley, W. C. (2003) NGF signaling in sensory neurons: evidence that early endosomes carry NGF retrograde signals. Neuron 39,69-84[CrossRef][Medline]
  69. Ye, H., Kuruvilla, R., Zweifel, L. S., Ginty, D. D. (2003) Evidence in support of signaling endosome-based retrograde survival of sympathetic neurons. Neuron 39,57-68[CrossRef][Medline]



This article has been cited by other articles:


Home page
Cancer Prevention ResearchHome page
Y. Ye, K. K. Wang, J. Gu, H. Yang, J. Lin, J. A. Ajani, and X. Wu
Genetic Variations in MicroRNA-Related Genes Are Novel Susceptibility Loci for Esophageal Cancer Risk
Cancer Prevention Research, November 1, 2008; 1(6): 460 - 469.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
T. R. Mercer, M. E. Dinger, J. Mariani, K. S. Kosik, M. F. Mehler, and J. S. Mattick
Noncoding RNAs in Long-Term Memory Formation
Neuroscientist, October 1, 2008; 14(5): 434 - 445.
[Abstract] [PDF]


Home page
EndocrinologyHome page
J.-F. Mouillet, X. Yan, Q. Ou, L. Jin, L. J. Muglia, P. A. Crawford, and Y. Sadovsky
DEAD-Box Protein-103 (DP103, Ddx20) Is Essential for Early Embryonic Development and Modulates Ovarian Morphology and Function
Endocrinology, May 1, 2008; 149(5): 2168 - 2175.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Yang, C. P. Dinney, Y. Ye, Y. Zhu, H. B. Grossman, and X. Wu
Evaluation of Genetic Variants in MicroRNA-Related Genes and Risk of Bladder Cancer
Cancer Res., April 1, 2008; 68(7): 2530 - 2537.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
A. Giuditta, J. Tai Chun, M. Eyman, C. Cefaliello, A. P. Bruno, and M. Crispino
Local Gene Expression in Axons and Nerve Endings: The Glia-Neuron Unit
Physiol Rev, April 1, 2008; 88(2): 515 - 555.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
T. J. Price, M. H. Rashid, M. Millecamps, R. Sanoja, J. M. Entrena, and F. Cervero
Decreased Nociceptive Sensitization in Mice Lacking the Fragile X Mental Retardation Protein: Role of mGluR1/5 and mTOR
J. Neurosci., December 19, 2007; 27(51): 13958 - 13967.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. Xing and E. Kieff
Epstein-Barr Virus BHRF1 Micro- and Stable RNAs during Latency III and after Induction of Replication
J. Virol., September 15, 2007; 81(18): 9967 - 9975.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-6155comv1
21/3/656    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Murashov, A. K.
Right arrow Articles by Van Scott, M. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Murashov, A. K.
Right arrow Articles by Van Scott, M. R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS