FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.05-4739com.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.05-4739comv1
21/2/456    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Drenkard, D.
Right arrow Articles by Schwarz, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Drenkard, D.
Right arrow Articles by Schwarz, H.
(The FASEB Journal. 2007;21:456-463.)
© 2007 FASEB

CD137 is expressed on blood vessel walls at sites of inflammation and enhances monocyte migratory activity

Daniela Drenkard*, Florian M. Becke*, Joachim Langstein*, Thilo Spruss{dagger}, Leoni A. Kunz-Schughart*, Teng Ee Tan§, Yaw Chyn Lim{ddagger} and Herbert Schwarz§,1

* Department of Pathology and

{dagger} Veterinary Service, University of Regensburg, Regensburg, Germany; and

{ddagger} Department of Pathology and

§ Department of Physiology, Immunology Programme, National University of Singapore, Singapore

1 Correspondence: Department of Physiology, National University of Singapore, 2 Medical Dr., MD 9, Singapore 117597. E-mail: phssh{at}nus.edu.sg


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The cytokine receptor CD137 is a member of the TNF receptor family and a potent T cell costimulatory molecule. Its ligand is expressed on antigen presenting cells as a transmembrane protein and it too can deliver signals into the cells it is expressed on (reverse signaling). In monocytes, immobilized CD137 protein induces activation, prolongation of survival and proliferation. Here we show that recombinant immobilized CD137 protein enhances migration of monocytes in vitro. Further, CD137 expression on spheroids leads to a significantly enhanced infiltration by monocytes. The migration-inducing activity of CD137 could be confirmed in vivo. Matrigel, which was coated with recombinant CD137 protein and was inserted into the flanks of mice attracted large numbers of monocytes and was heavily infiltrated by these cells. In vivo, expression of CD137 by blood vessel walls at sites of inflammation was detectable by immunohistochemistry. CD137 expression is inducible by proinflammatory cytokines in endothelial cells, suggesting that a physiological function of CD137 may be the facilitation of monocyte extravasation in inflammatory tissues.—Drenkard D., Becke F. M., Langstein J., Spruss T., Kunz-Schughart L.A., Tan T.E., Lim Y.C., Schwarz H. CD137 is expressed on blood vessel walls at sites of inflammation and enhances monocyte migratory activity.


Key Words: extravasation • vascular biology


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
THE CYTOKINE RECEPTOR CD137 (ILA/4–1BB) is a member of the TNF receptor family, and is expressed activation-dependently by T-cells (1 2 3) . Costimulation through CD137 enhances T cell activity, enabling the immune system to reject tumors or transplants (4 , 5) .

The ligand for CD137 is expressed by antigen presenting cells as a transmembrane protein, and it too can deliver signals into the cells it is expressed on. Therefore, bidirectional signaling exists for the CD137 receptor/ligand system (6) .

Signaling through CD137 ligand enhances proliferation and immunoglobulin secretion of B cells (7) , and the expression of costimulatory molecules, cytokines, and cellular adherence in dendritic cells (8 9 10) . In peripheral monocytes it induces activation, prolongation of survival, and proliferation (11 12 13 14) . Monocytes are generated in the bone marrow. They enter the circulation from where they migrate into the tissues and differentiate to tissue macrophages. There they participate in the regulation of inflammatory and immune reactions, and in physiological processes such as wound healing (15) .

Leukocyte extravasation begins with binding of carbohydrate moieties on circulating leukocytes to selectins, adhesion molecules on the vascular endothelium. This slows the cells down to a "rolling". Tight binding is mediated by leukocyte integrins and endothelial cell molecules, such as intracellular adhesion molecule. Interations of integrins, molecules of the immunoglobulin family and the extracellular matrix (ECM), mediate the final step: the passage through the endothelium and the vessel wall. While the general principle of leukocyte extravasation is well established, relatively little is known about how the selective extravasation of leukocyte subsets is regulated (16 , 17) .

Here we show that (1) CD137 can be strongly expressed by blood vessel walls at sites of inflammation; (2) expression of CD137 is induced by proinflammatory cytokines in endothelial cells; and (3) CD137 induces monocyte migration in vitro and in vivo. These results imply that CD137 as an important regulator of monocyte extravasation in inflammatory tissues.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Reagents
CD137-Fc protein was purified from supernatants of stable transfected CHO cells by protein G sepharose, as described previously (18) . Human IgG1 Fc protein was purchased from Accurate Chemical and Scientific Corporation, (Westbury, NY, USA). Anti-CD14 antibody (Ab) was ordered from Immunotech, Marseille, France. Anti-CD137 Ab (clone BBK-2) and its isotype control, MOPC21, were obtained from Bioscource (Ratingen, Germany) and Sigma (Deisenhofen, Germany), respectively. Anti-CD137 Ab (clone M127) was a gift from Immunex Corp. (Seattle, WA, USA). Growth factor-reduced murine matrigel was obtained from Becton Dickinson (Mountain View, CA, USA).

Cells and cell culture
Human peripheral blood mononuclear cells (PBMC) were prepared by percoll gradient density centrifugation as described previously (7) . Primary monocytes were isolated by elutriation (19) . Elutriated monocytes were more than 95% pure, and contaminating T cells were less than 3% as estimated by morphology and antigenic phenotype (CD14, CD3, CD4, CD8 expression). Cells were cultured in polystyrene dishes (Becton Dickinson, Franklin Lakes, NJ, USA) in RPMI 1640 supplemented with 5% FCS at a concentration of 106/ml.

Primary human umbilical vein endothelial cells (HUVEC) were isolated from umbilical cord vein. The umbilical cord vein was cannulated and flashed with copious amounts of HBSS to remove red blood cells and cell debris. The vein was filled with 0.1% type 1 collagenase (Sigma) and incubated at 37°C for 10 min. Next, the cord was gently messaged to dislodge the endothelial layer, and the endothelial cells-collagenase mixture collected into a 20 ml syringe. The vein was rinsed with more HBSS, and the pooled cell suspension centrifuged at 400 g for 10 min at 4°C. The cell pellet was resuspended in medium M199 supplemented with 20% FCS, 2 mM L-glutamine, 100 U/100 mg/ml penicillin/streptomycin, 1 mg/ml heparin (Sigma) and 1x endothelial growth factor (Sigma) and plated out in a 60 mm culture dish. The cells were fed with fresh medium once every 3 d and routinely subcultured at a split ratio of 1:4. Cells were used between passages 3–6 for the experiments described below.

Murine peritoneal exudate cells were isolated by injecting a mouse intraperitoneally (i.p.) with 1 ml of PBS. After 16 h, the mouse was sacrificed and cells that had migrated into the peritoneum were recovered by injection of 3 ml of ice-cold PBS.

RT-polymerase chain reaction (RT-PCR)
Total RNA was isolated from PBMC using RNAzol B (Tel-Test, Inc., Friendswood, TX, USA) and up to 5 µg RNA was reverse-transcribed in a 20 µl vol, using random hexanucleotide primers (50 µg/ml), 25 µM dNTP, 10 mM DTT, 200 U SuperScriptTMII RNaseH-RT (Life Technologies, Inc., Eggenstein, Germany) and 20 U RNAsin (Roche, Mannheim, Germany) for 60 min at 42°C.

The RT reaction (2 µl) served as template for the subsequent PCR, which was performed in a 20 µl vol with 1 U TaqDNA polymerase (Roche); 200 µM dNTPs; 1.5 mM MgCl2; 10 mM Tris, pH 8.3; 50 mM KCl; and 10 µM of each primer. After a 5 min denaturation step at 94°C, the reaction proceeded in 30 cycles of 30 s at 94°C, 30 s at 58°C, and 1 min at 72°C, followed by 10 min at 72°C.

Primers used were:

CD137 sense: 5' ATCATG GGAAACAGCTGTTACAAC

CD137 antisense: 5' TGGTCCACAGACCACGTCCCTCTC

cyclophilin sense: 5' GTCCAGCATTTGCCATGGAC

cyclophilin antisense: 5' GACAAGGTCCCAAAGACAGC

Real-time quantitative PCR
Total RNA was extracted from endothelial cells using RNAsy® Mini Kit (Qiagen). Total RNA (1 µg) was used for first-strand cDNA synthesis with RevertAidTM First-strand cDNA Synthesis Kit (Fermentas) on Mastercycle® Gradient (Eppendorf, Hamburg, Germany) PCR machine.

Quantitative real-time PCR was performed on Lightcycler® 1.2 System (Roche) using LightCycler® FastStart DNA MasterPLUS SYBR Green I (Roche). Human cyclophilin A was used as the normalizing gene. The following primers, which have an amplicon size of 195 bp for both CD137 and Cyclophilin A, were used. Cyclophilin A forward: 5' CCATGGCAAATGCTGGACCC; Cyclophilin A reverse: 5' CGAGTTGTCCACAGTCAGCA; CD137 forward: 5' CCCTGCGAGA-GAGCCAGGA; CD137 reverse: 5' GCCATCTTCCTCTTGAGTAGTTT.

The assay was run according the manufacturer’s instructions with the following changes. The reaction volume was halved to 10 µl per reaction, and primer concentration was adjusted to 0.4 µM for normalizing reactions and 0.3 µM for CD137 reactions. cDNA (15 ng) were used from cyclophilin A reactions, and 2 µg of cDNA was used for CD137 reactions after optimization with the standard curve. The PCR conditions used in all reactions were Preincubation at 95°C for 10 min (Hot start); Amplification for 45 cycles of 5 s at 95°C, 5 s at 57°C, 8 s at 72°C; Melting Curve Analysis at 95°C for 20 s, 60°C for 20 s, and temperature gradient from 60°C to 95°C at 0.1°C/s. Data obtained were analyzed with LightCycler® Software 3.5.3 (Roche).

Generation of spheroids
COS cells (106) were transfected with an expression vector for full-length CD137 or an empty vector using the Dextran-diethylaminoethyl (DEAE) method. After 24 h, the formation of spheroids was initiated. Cells were trypsinized and resuspended at a concentration of 104/ml in Dulbecco’s modified Eagle medium (DMEM) + 10% FCS (Gibco BRL, Eggenstein, Germany). Cells 103/well were seeded into a 96-well microtiter plate. Each well was coated with 100 µl of 1.5% agarose to prevent cell attachment. After 24 h of culture, the medium was changed to RPMI + 10% FCS and 104 peripheral monocytes in 100 µl were added to the spheroids with a diameter of ~100 µm. Two days later spheroid cocultures with a final size of 200–300 µm were embedded in tissue-freezing medium (Leica Instruments, Nussloch, Germany) and frozen in liquid nitrogen. Sections of the spheroids were stained with anti-CD14 and anti-CD11c for the presence of monocytes.

Immunohistochemistry
Tissues for immunohistochemistry were obtained from the tissue bank of the Department of Pathology, at the University of Regensburg, Germany, or from archival samples from the Department of Pathology, of the National University of Singapore. Frozen tissue sections were fixed with 2% paraformaldehyde for 10 min. Endogenous peroxidases were inactivated by 6.5% hydrogen peroxide in methanol for 15 min. Unspecific staining was blocked by 3% dry milk in PBS for 30 min. Anti-CD137 (2 µg/ml; clone BBK-2, Bioscource, Ratingen, Germany) or an isotype control Ab (MOPC21, Sigma) in 3% dry milk were added overnight. Staining was continued with the avidin-biotin complex (ABC) kit (Dako, Hamburg, Germany) by using diaminobenzidine as substrate. The entire procedure was performed at room temperature, and after each step the samples were washed three times with PBS. Tissue sections were stained with hematoxylin and embedded in Entellan (Merck, Darmstadt, Germany).

Embedded spheroids were cut with a cryostat (Reichert, Heidelberg, Germany) at 5 µm, mounted on poly-L-lysin (Sigma) coated glass slides and air-dried according to a standard alkaline phosphatase antialkaline phosphatase (APAAP)-technique. Briefly, the specimens were fixed for 15 min in acetone and chloroform each at room temperature and incubated with mouse monoclonal antibodies against CD11c (Dianova, Hamburg, Germany) or CD14 (My 4, Coulter, Krefeld, Germany). After rinsing with TBS-buffer, rabbit anti-mouse immunoglobulin (Dakopatts, Hamburg, Germany) was applied as secondary Ab followed by incubation with the APAAP complex (Dianova, Hamburg, Germany). The incubation with rabbit anti-mouse Ig and APAAP complex was repeated once. Subsequent incubation with new fuchsin substrate resulted in a red precipitate. Finally, the specimens were counterstained with hematoxylin and mounted.

Mice
Female NMRI mice of 8–12 wk of age were purchased from Charles River (Sulzfeld, Germany).

Histology
At the end of the experiment mice were killed by rapid cervical dislocation. Immediately after death, tissue samples, including matrigel; adhering subcutanous tissue; and parts of the skin were carefully prepared. The specimens were fixed in Bouin’s solution and embedded for routine paraffin histology. Deparaffinized 5 µm sections were stained with hematoxilin and eosin as well as by the method of Masson and Goldner, respectively, for histological examination (20) .


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Expression of CD137 is inducible on blood vessel walls
Performing an immunohistochemical screen for CD137 expression, we found that CD137 can be expressed strongly by the walls of blood vessels (Fig. 1 A). CD137 expression on blood vessel walls was not detected in healthy tissues but was a feature of inflamed tissues.


Figure 1
View larger version (61K):
[in this window]
[in a new window]

 
Figure 1. Expression of CD137 on blood vessel walls. A) Cryosections of a skin biopsy of a vasculitis patient and of a normal skin were immunohistochemically stained for CD137 expression (dark brown) using an anti-CD137 monoclonal antibody (mAb) (clone M127). Serial sections were stained with an isotype control Ab. Cryosections of the rhinitis tissue were stained with a polyclonal chicken anti-CD137 serum or normal chicken serum. B) Endothelial cells (HUVEC) were stained with an Ab for CD31 (black curve; clone ER-MP- 12; BMA, Augst, Switzerland) and analyzed by flow cytometry. Red curve: isotype control. Positive cells in M1: 99.3%.

We could identify CD137-positive blood vessels in the skin of a patient who suffered from vasculitis caused by Borreliosis, in the nasal septum of a patient suffering from chronic rhinitis polyposa, in the colon of a Crohn’s disease patient, and in the inflamed thyroid gland of a patient with Morbus Basedow’s (Grave’s disease). Among the CD137-positive vessels were arteries, microvessels, and venules. Both, the endothelial cell lining, as well as the much thicker layer of VSMC, stained positive for CD137.

To exclude cross-reactivity of the monoclonal anti-CD137 Ab to an unrelated antigen, we confirmed expression of CD137 on blood vessel walls by staining with a different Ab, a polyclonal, affinity-purified chicken anti-CD137 serum. Also this Ab detected expression of CD137 on blood vessel walls in the nasal septum of the chronic rhinitis polyposa patient (Fig. 1A ).

The inducibility of CD137 mRNA was also verified in pure cultures of HUVEC using quantitative PCR. The purity of the endothelial cell population was verified by staining for CD31, an endothelial cell-specific marker (Fig. 1B ).

HUVEC (106) were activated with 10 ng/ml of IL-1 + 10 ng/ml of TNF for 24 h. Untreated cells were used for base line reference. The theoretical crossing point of a single copy per reaction is at cycle 37 in the Roche lightcycler system. The crossing point for CD137 in untreated endothelial cells was at 35.5 cycles with 2 µg of cDNA used. This indicates that CD137 is expressed at very low levels or not at all in resting endothelial cells. In the IL-1 + TNF-activated endothelial cells, CD137 expression was increased 79-fold relative to the untreated cells. The primers for the quantitative PCR were designed to span an intron in order to avoid amplification of genomic DNA. The inducibility of CD137 expression by proinflammatory stimuli corresponds well to the presence of CD137-positive vessels in inflamed tissues and their absence in healthy tissues.

CD137 initiates migration of monocytes in vitro
The expression of CD137 on blood vessel walls at sites of inflammation and its induction by proinflammatory stimuli, together with earlier described activities that CD137 induces activation, survival, and proliferation in monocytes, suggested that CD137 may be involved in monocyte extravasation.

We tested this hypothesis by culturing peripheral human monocytes on dishes, which were coated with a fusion protein consisting of the extracellular domain of human CD137, fused to the constant domain of human IgG1 (CD137-Fc). Fc control protein-coated and untreated plates were used as negative controls. Coating was performed with a solution of 5 µg/ml protein in PBS at 4°C overnight. Monocytes were isolated by elutriation and used without prior treatment or culture. Monocyte movements on the coated dishes were measured by time-lapse microscopy under tissue culture conditions (37°C, 5% CO2). Only 5.5 ± 0.5% of the monocytes, which were cultured in wells coated with the Fc control protein had migrated a distance of ≥20 µm in the culture dishes. This number was significantly (P=0.034) increased to 12.9 ± 2% when dishes were coated with CD137-Fc protein (Fig. 2 ).


Figure 2
View larger version (24K):
[in this window]
[in a new window]

 
Figure 2. CD137 enhances mobility of monocytes in a two-dimensional migration assay. Monocytes were cultured for 18 h on immobilized CD137-Fc or Fc-control protein. Thirty images taken by time-lapse videomicroscopy with an interval of 15 min in between each were superimposed (magnification: 200x). All cells per field were evaluated. Only monocytes that had migrated at least a distance of 20 µm were counted. The results are representative for one out of three independent experiments.

To reflect more closely the physiological situation of monocyte extravasation from CD137-positive vessels, we generated spheroids expressing CD137. COS cells were transiently transfected with an empty expression vector (pCDNA3, Invitrogen, San Diego, CA, USA) or with a vector, expressing the full-length CD137 protein (pCDNA3-CD137). About 25% of the pCDNA3-CD137 transfected COS cells stained positive for CD137 by flow cytometry after 24 h (not shown). Spheroids were generated from CD137-expressing and control cells by a 24 h incubation on agar-coated, nonadherent 96-well plate culture dishes to which the cells could not attach. Primary monocytes were then added and after 48 h cryosections were made from the spheroids. Sections from the middle of the spheroids were stained with an Ab directed against the monocyte-specific protein CD14 (Fig. 3 A). The numbers of monocytes, which had migrated into the spheroids, were determined by image analysis of four equally sized sections (median sections) of each of five spheroid/monocyte cocultures. About six-times more monocytes were found in the CD137-expressing spheroids than in the control spheroids (Fig. 3B ). Identical results were obtained when the monocytes were stained for CD11c, another monocyte marker (Fig. 3B ).


Figure 3
View larger version (41K):
[in this window]
[in a new window]

 
Figure 3. CD137 induces migration of monocytes. A) Spheroids of COS cells transfected with the empty expression vector pCDNA3 (control) and of COS cells transfected with a CD137-expressing vector (CD137) were incubated with peripheral monocytes and after 2 d were stained with anti-CD14 (red) for the presence of monocytes. Photographs are at a magnification of 200x and 600x. This experiment has been performed twice with identical results. B) Quantitative evaluation of monocyte migration into spheroids. Monocytes in three equally sized sections of each of five spheroids were counted base on anti-CD14 and anti-CD11c staining. Depicted are means ± SD.

Migration of monocytes into CD137-expressing spheroids more closely resembles the in vivo situation when monocytes migrate through blood vessel walls. It also demonstrates that CD137 is sufficient to induce monocyte migration and that the Fc domain of the CD137-Fc fusion protein is not required.

Functional immobilization of CD137
Next we wanted to determine whether CD137 also enhances migration of monocytes in vivo. As only immobilized but not soluble CD137 induces activation and cytokine secretion in monocytes (11) , we evaluated whether murine matrigel would be suitable as a carrier and matrix for immobilization of CD137. Matrigel (80 µl) was pipetted into wells of a 96-well plate and incubated at 37°C until solidified. The matrigel was coated with 20 µl of CD137-Fc solution at 2.5 µg/ml or an equimolar amount of Fc protein (20 µl of 1.25 µg/ml). As controls, CD137-Fc protein (2.5 µg/ml) and Fc protein (1.25 µg/ml) were immobilized directly in different wells of the plate. Peripheral human monocytes (105) were added per well, and the IL-8 concentrations in 24 h supernatants were determined by ELISA. Both, CD137 protein, which was immobilized onto matrigel, and CD137 protein, which was immobilized onto the plate, induced strong and comparable activation of monocytes as evidenced by IL-8 secretion, demonstrating that matrigel-bound CD137 is functional (Fig. 4 A).


Figure 4
View larger version (9K):
[in this window]
[in a new window]

 
Figure 4. Immobilization of CD137-Fc on matrigel. A) CD137-Fc and Fc proteins were immobilized directly on a plate (plate). Matrigel (80 µl) was pipetted into the wells and incubated at 37°C until solidified (matrigel). The matrigel was coated with CD137-Fc or Fc. Monocytes were added, and IL-8 concentrations in 24 h supernatants were determined by ELISA. Each condition was done in triplicates. Monocytes incubated with matrigel alone or just medium (RPMI) were used as a control. This experiment was repeated three times with similar results. B) Murine peritoneal exudate cells (106) were cultured on plates coated with 10 µg/ml of murine or human CD137-Fc protein or Fc control protein. IL-6 concentrations were analyzed in supernatants by ELISA after 24 h.

Further, we tested whether human CD137 can cross-link murine CD137 ligand. Human CD137-Fc was almost as effective in inducing IL-6 release from murine peritoneal exudate cells, which are mainly monocytes and macrophages, as murine CD137-Fc protein (Fig. 4B ).

CD137 initiates migration of monocytes in vivo
CD137-induced monocyte migration was studied in vivo by loading matrigel with CD137-Fc or Fc protein and implanting it into mice. A 10 µg/ml CD137-Fc protein solution (20 µl) or equimolar solution (20 µl) of Fc control protein (5 µg/ml) was mixed with 80 µl murine and growth factor-reduced matrigel and allow to solidify, which resulted in 100 µl of matrigel that contained either 200 ng of CD137-Fc protein or the equimolar amount of Fc control protein.

Five NMRI mice were anesthetized, and each mouse received a 5-mm-long cut on the right and left flank. CD137-Fc and Fc control protein-containing pieces of matrigel were introduced into the cuts on the right and left flank of each mouse, respectively, and the wounds were sealed with metal clips. Introduction of CD137-Fc-coated and Fc-coated matrigel on either flank of the same mouse served as a control for potential differences between individual animals. Tissues at wound sites were harvested 7 d later and embedded in paraffin. Monocytes were identified by Masson-Goldner staining. Few monocytes were present at the Fc-containing matrigel, and some adhered to the surface of the matrigel (Fig. 5 ). In contrast, a large number of monocytes had accumulated around the CD137-Fc containing matrigel and had massively infiltrated the matrigel (Fig. 5) . This experiment confirmed the migration-inducing activity of CD137, which was observed by time-lapse microscopy, and in CD137-expressing spheroids and demonstrated that CD137 exerts this activity also in vivo.


Figure 5
View larger version (99K):
[in this window]
[in a new window]

 
Figure 5. CD137 induces monocyte accumulation in vivo. Matrigel containing CD137-Fc or Fc protein was introduced into the flanks of mice and harvested 48 h later. Masson-Goldner staining was used to stain infiltrated monocytes (purple staining). Areas of matrigel are labeled with (m). Shown are sections from one mouse, which are representative for all five mice of the group, at magnifications of 200x and 600x. This experiment was repeated twice with identical results.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The CD137 receptor/ligand system is best known for its costimulatory activity on T cells and APC (21 , 22 , 6) . In this study we have identified CD137 as a molecule that can be expressed by cells of inflamed blood vessel walls and induces monocyte migration. Blood vessel walls are sites of essential biological processes, such as blood coagulation and leukocyte extravasation. These processes are generally restricted to sites of injuries and are regulated by the inducible and restricted expression of molecules, such as cell adhesion molecules, on endothelial cells.

CD137 has been shown previously to induce activation, prolonged survival, and proliferation of monocytes. Therefore, it was tempting to speculate that the most likely function of CD137 on blood vessel walls would be a facilitation of monocyte recruitment to sites of inflammation. We could support this assumption by demonstrating an enhancement of the in vitro migratory activity of monocytes by CD137 and by showing increased monocyte migration into CD137-expressing spheroids. The latter more closely resembles an in vivo situation when monocytes migrate through blood vessel walls. The experiment with CD137-expressing spheroids also clearly demonstrates that CD137 is sufficient to induce monocyte migration and that the Fc domain of the CD137-Fc fusion protein is not required.

Since human CD137 protein also activates murine monocytes, it was possible to confirm induction of monocyte migration by CD137 in vivo. Introduction of CD137-Fc-coated and Fc-coated matrigel on either flank of the mice served as an ideal control to account for potential differences between individual animals. Monocytes accumulated at and infiltrated into the CD137-Fc containing matrigel, while these processes did not occur at the Fc-containing matrigel.

These data suggest that CD137 may be haptotactic for monocytes. Attraction and recruitment of monocytes is a typical feature of chemokines, typically soluble mediators. CD137 was expressed as a membrane-bound molecule in the spheroids, which raises the question how CD137 could induce migration of monocytes into the spheroids. Most likely, monocytes were induced to migrate by CD137-expressing COS cells at the spheroid surface and kept on migrating as long as they had contact to neighboring CD137-expressing COS cells. This possible mechanism would explain the even distribution of the monocytes in the spheroids. The situation was similar in the experiment in which CD137-Fc protein was immobilized on matrigel. CD137-Fc protein was mixed into the matrigel before it solidified, ensuring an even distribution. Also in vivo CD137 appears to be homogeneously expressed throughout the entire blood vessel wall. This would ensure the continuous migration of monocytes through the vessel walls, while chemokine gradients could determine the direction.

Selectins, integrins, and molecules of the immunoglobulin family have been identified as key regulators for leukocyte extravasation, raising the question of why CD137 would be required in addition (23) . CD137 induces activation and migration of monocytes (11 12 13 14) , while it delivers inactivating signals to T cells (18 , 24) . Therefore, it is possible that CD137 expression on inflamed blood vessels favors recruitment of monocytes over recruitment of T cells. Similarly, CD134 (OX40) ligand is expressed on endothelial cells at inflammatory sites and favors recruitment of CD134-expressing CD4-positive T cells (25) . Vascular adhesion protein 1 (VAP-1) has also been shown to be expressed activation-dependently on the vascular endothelium and to facilitate extravasation of granulocytes (26) . CD137, CD134 ligand, and VAP-1 may just be examples of a much larger group of cell-type specific extravasation signals, which selectively recruit leukocyte subpopulations and thereby influence the nature and course of the inflammatory process.

CD137 is a very promising target for cancer immunotherapy. CD137 is expressed as a costimulatory receptor on activated T cells, and CD137 agonists such as antibodies have shown remarkable therapeutic effect in a range of murine tumor models and are currently being developed for human therapy (27 28 29 30 31 32) . Data from this study imply that anti-CD137 antibodies that would be administered for cancer therapy could also interfere with monocyte recruitment to sites of inflammation. This is an aspect that should be addressed before anti-CD137 antibodies are being tested in patients.

In this study we have identified expression of CD137 on cells of the blood vessel wall at sites of inflammation, and an enhancement of monocyte migratory activity in vitro and in vivo, which suggests a novel function for CD137, i.e., the recruitment of monocytes in inflammatory tissues. These data, together with earlier ones, which demonstrate induction of activation, survival, and proliferation of monocytes by CD137 substantiate CD137 as an important regulator of monocyte activities (11 12 13 14) .


   ACKNOWLEDGMENTS
 
This work was supported by the Deutsche Forschungsgemeinschaft and the Deutsche Krebshilfe. We thank Drs. Marina Kreutz and Rene Krieg for help with immunostaining and time-lapse microscopy, respectively.

Received for publication January 30, 2006. Accepted for publication February 17, 2006.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Schwarz, H., Tuckwell, J., Lotz, M. (1993) A receptor induced by lymphocyte activation (ILA): a new member of the human nerve growth factor/tumor necrosis factor receptor family. Gene 134,295-298[CrossRef][Medline]
  2. Lotz, M., Setareh, M., von Kempis, J., Schwarz, H. (1996) The nerve growth factor/tumor necrosis factor receptor family. J. Leukoc. Biol. 60,1-7[Abstract]
  3. Schwarz, H., Valbracht, J., Tuckwell, J., Kempis, J., Lotz, M. (1995) ILA, the human 4–1BB homologue is inducible in lymphoid and other cell lines. Blood 85,1043-1052[Abstract/Free Full Text]
  4. Melero, I., Shuford, W. W., Newby, S. A., Aruffo, A., Ledbetter, J. A., Hellstrom, K. E., Mittler, R. S., Chen, L. (1997) Monoclonal antibodies against 4–1BB T cell activation molecule eradicate established tumors. Nat. Med. 3,682-685[CrossRef][Medline]
  5. Shuford, W. W., Klussman, K., Tritchler, D. D., Loo, D. T., Chalupny, J., Siadak, A. W., Brown, T. J., Emswiler, J., Raecho, H., Larsen, C. P., et al (1997) 4–1BB costimulatory signals preferentially induce CD8+ T cell proliferation and lead to the amplification in vivo of cytotoxic T cell responses. J. Exp. Med. 186,47-55[Abstract/Free Full Text]
  6. Schwarz, H. (2005) Biological activities of reverse signal transduction through CD137 ligand. J. Leukoc. Biol. 77,281-286[Abstract/Free Full Text]
  7. Pauly, S., Broll, K., Giegerich, G., Schwarz, H. (2002) CD137 regulates B lymphocyte proliferation and differentiation in germinal centers. J. Leukoc. Biol. 72,35-42[Abstract/Free Full Text]
  8. Futagawa, T., Akiba, H., Kodama, T., Takeda, K., Hosoda, Y., Yagita, H., Okumura, K. (2002) Expression and function of 4–1BB and 4–1BB ligand on murine dendritic cells. Int. Immunol. 14,275-286[Abstract/Free Full Text]
  9. Kim, Y. J., Li, G., Broxmeyer, H. E. (2002) 4–1BB ligand stimulation enhances myeloid dendritic cell maturation from human umbilical cord blood CD34+ progenitor cells. J. Hematother. Stem. Cell. Res. 11,895-903[CrossRef][Medline]
  10. Laderach, D., Wesa, A., Galy, A. (2003) 4–1BB-ligand is regulated on human dendritic cells and induces the production of IL-12. Cell. Immunol. 226,37-44[CrossRef][Medline]
  11. Langstein, J., Michel, J., Fritsche, J., Kreutz, M., Andreesen, R., Schwarz, H. (1998) CD137, (ILA/4–1BB), a member of the TNF receptor family regulates monocyte activation via reverse signaling. J. Immunol. 160,2488-2492[Abstract/Free Full Text]
  12. Langstein, J., Schwarz, H. (1999) Identification of CD137 as a potent monocyte survival factor. J. Leukoc. Biol. 65,829-833[Abstract]
  13. Langstein, J., Michel, J., Schwarz, H. (1999) CD137 Induces proliferation and endomitosis in monocytes. Blood 94,3161-3168[Abstract/Free Full Text]
  14. Langstein, J., Becke, F. M., Soellner, L., Krause, G., Brockhoff, G., Kreutz, M., Andreesen, R., Schwarz, H. (2000) Comparative analysis of CD137 and LPS effects on monocyte activation, survival, and proliferation. Biochem. Biophys. Res. Com. 273,117-122[CrossRef][Medline]
  15. Duffield, J. S. (2003) The inflammatory macrophage: a story of Jekyll and Hyde. Clin. Sci. (Lond). 104,27-38[Medline]
  16. Vestweber, D. (2002) Regulation of endothelial cell contacts during leukocyte extravasation. Curr. Opin. Cell Biol. 14,587-593[CrossRef][Medline]
  17. Muller, W. A. (2003) Leukocyte-endothelial-cell interactions in leukocyte transmigration and the inflammatory response. Trends. Immunol. 24,327-334[Medline]
  18. Schwarz, H., Blanco, F., Valbracht, J., Kempis, J., Lotz, M. (1996) ILA, a member of the human NGF/TNF receptor family regulates T lymphocyte proliferation and survival. Blood 87,2839-2845[Abstract/Free Full Text]
  19. Rossiter, H., Alon, R., Kupper, T-S. (1997) Selectins, T-cell rolling and inflammation. Mol. Med. Today 3,214-222[CrossRef][Medline]
  20. Vestweber, D., Blanks, J. E. (1999) Mechanisms that regulate the function of the selectins and their ligands. Physiol. Rev. 79,181-213[Abstract/Free Full Text]
  21. Schwarz, H., Blanco, F., Valbracht, J., Kempis, J., Lotz, M. (1996) ILA, a member of the human NGF/TNF receptor family regulates T lymphocyte proliferation and survival. Blood 87,2839-2845[Abstract/Free Full Text]
  22. Andreesen, R., Brugger, W., Scheibenbogen, C., Kreutz, M., Leser, H. G., Rehm, A., Lohr, G. W. (1990) Surface phenotype analysis of human monocyte to macrophage maturation. J. Leukoc. Biol. 47,490-497[Abstract]
  23. Romeis, B. (1989) Böck, P. eds. Mikroskopische Technik ,497-499 Urban & Schwarzenberg München, Wien, Baltimore, Maryland, USA.
  24. Sica, G., Chen, L. (2000) Modulation of the immune response through 4–1BB. Adv. Exp. Med. Biol. 465,355-362[Medline]
  25. Croft, M. (2003) Co-stimulatory members of the TNFR family: keys to effective T-cell immunity?. Nat. Rev. Immunol. 3,609-620[CrossRef][Medline]
  26. Gonzalez-Amaro, R., Sanchez-Madrid, F (1999) Cell adhesion molecules: selectins and integrins. Crit. Rev. Immunol. 19,389-492[Medline]
  27. Michel, J., Pauly, S., Langstein, J., Krammer, P., Schwarz, H. (1999) CD137-induced apoptosis is independent of CD95. Immunology 98,42-46[CrossRef][Medline]
  28. Imura, A., Hori, T., Imada, K., Ishikawa, T., Tanaka, Y., Maeda, M., Imamura, S., Uchiyama, T. (1996) The human OX40/gp34 system directly mediates adhesion of activated T cells to vascular endothelial cells. Exp. Med. 183,2185-2195
  29. Tohka, S., Laukkanen, M., Jalkanen, S., Salmi, M. (2001) Vascular adhesion protein 1 (VAP-1) functions as a molecular brake during granulocyte rolling and mediates recruitment in vivo. FASEB J. 15,373-382[Abstract/Free Full Text]
  30. Melero, I., Bach, N., Hellstrom, K. E., Aruffo, A., Mittler, R. S., Chen, L. (1998) Amplification of tumor immunity by gene transfer of the co-stimulatory 4–1BB ligand: synergy with the CD28 co-stimulatory pathway. Eur. J. Immunol. 28,1116-1121[CrossRef][Medline]
  31. Guinn, B. A., DeBenedette, M. A., Watts, T. H., Berinstein, N. L. (1999) 4–1BBL cooperates with B7–1 and B7–2 in converting a B cell lymphoma cell line into a long-lasting antitumor vaccine. J. Immunol. 162,5003-5010[Abstract/Free Full Text]
  32. Mittler, R. S., Foell, J., McCausland, M., Strahotin, S., Niu, L., Bapat, A., Hewes, L. B. (2004) Anti-CD137 antibodies in the treatment of autoimmune disease and cancer. Immunol. Res. 29,197-208[CrossRef][Medline]



This article has been cited by other articles:


Home page
CirculationHome page
H. J. Jeon, J.-H. Choi, I.-H. Jung, J.-G. Park, M.-R. Lee, M.-N. Lee, B. Kim, J.-Y. Yoo, S.-J. Jeong, D.-Y. Kim, et al.
CD137 (4-1BB) Deficiency Reduces Atherosclerosis in Hyperlipidemic Mice
Circulation, March 9, 2010; 121(9): 1124 - 1133.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
J. A. Westwood, N. M. Haynes, J. Sharkey, N. McLaughlin, H. J. Pegram, R. A. Schwendener, M. J. Smyth, P. K. Darcy, and M. H. Kershaw
Toll-Like Receptor Triggering and T-Cell Costimulation Induce Potent Antitumor Immunity in Mice
Clin. Cancer Res., December 15, 2009; 15(24): 7624 - 7633.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
K. Miura and Y. Rikihisa
Liver Transcriptome Profiles Associated with Strain-Specific Ehrlichia chaffeensis-Induced Hepatitis in SCID Mice
Infect. Immun., January 1, 2009; 77(1): 245 - 254.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. Jiang, Y. Chen, and H. Schwarz
CD137 Induces Proliferation of Murine Hematopoietic Progenitor Cells and Differentiation to Macrophages
J. Immunol., September 15, 2008; 181(6): 3923 - 3932.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. S. Olofsson, L. A. Soderstrom, D. Wagsater, Y. Sheikine, P. Ocaya, F. Lang, C. Rabu, L. Chen, M. Rudling, P. Aukrust, et al.
CD137 Is Expressed in Human Atherosclerosis and Promotes Development of Plaque Inflammation in Hypercholesterolemic Mice
Circulation, March 11, 2008; 117(10): 1292 - 1301.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Sun and P. J. Fink
A New Class of Reverse Signaling Costimulators Belongs to the TNF Family
J. Immunol., October 1, 2007; 179(7): 4307 - 4312.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow All Versions of this Article:
fj.05-4739comv1
21/2/456    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Drenkard, D.
Right arrow Articles by Schwarz, H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Drenkard, D.
Right arrow Articles by Schwarz, H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS