FASEB J. Uncover Your Biological Pathway
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.06-6130com.
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
fj.06-6130comv1
21/2/415    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wulczyn, F. G.
Right arrow Articles by Nitsch, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wulczyn, F. G.
Right arrow Articles by Nitsch, R.
(The FASEB Journal. 2007;21:415-426.)
© 2007 FASEB

Post-transcriptional regulation of the let-7 microRNA during neural cell specification

F. Gregory Wulczyn*,1,2, Lena Smirnova*,1, Agnieszka Rybak*, Christine Brandt*, Erik Kwidzinski*, Olaf Ninnemann*, Michael Strehle{ddagger}, Andrea Seiler{dagger}, Stefan Schumacher* and Robert Nitsch*

* Center for Anatomy, Institute of Cell Biology and Neurobiology, Charité-Universitätsmedizin Berlin, Berlin, Germany;

{dagger} National Center for Documentation and Evaluation of Alternative Methods to Animal Experiments (ZEBET), Federal Institute for Risk Assessment (BfR), Berlin, Germany; and

{ddagger} Max-Delbrück-Centrum für Molekulare Medizin, Berlin-Buch, Berlin, Germany

2Correspondence: Center for Anatomy, Institute of Cell Biology and Neurobiology, Charité-Universitätsmedizin Berlin, Schumannstrasse 20–21, 10098 Berlin, Germany. E-mail: gregory.wulczyn{at}charite.de


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The let-7 miRNA regulates developmental timing in C. elegans and is an important paradigm for investigations of miRNA functions in mammalian development. We have examined the role of miRNA precursor processing in the temporal control and lineage specificity of the let-7 miRNA. In situ hybridization (ISH) in E9.5 mouse embryos revealed early induction of let-7 in the developing central nervous system. The expression pattern of three let-7 family members closely resembled that of the brain-enriched miRNAs mir-124, mir-125 and mir-128. Comparison of primary, precursor, and mature let-7 RNA levels during both embryonic brain development and neural differentiation of embryonic stem cells and embryocarcinoma (EC) cells suggest post-transcriptional regulation of let-7 accumulation. Reflecting these results, let-7 sensor constructs were strongly down-regulated during neural differentiation of EC cells and displayed lineage specificity in primary cells. Neural differentiation of EC cells was accompanied by an increase in let-7 precursor processing activity in vitro. Furthermore, undifferentiated and differentiated cells contained distinct precursor RNA binding complexes. A neuron-enhanced binding complex was shown by antibody challenge to contain the miRNA pathway proteins Argonaute1 and FMRP. Developmental regulation of the processing pathway correlates with differential localization of the proteins Argonaute, FMRP, MOV10, and TNRC6B in self-renewing stem cells and neurons.—Wulczyn, F. G., Smirnova, L., Rybak, A., Brandt, C., Kwidzinski, E., Ninnemann, O., Strehle, M., Seiler, A., Schumacher, S., Nitsch, R. Post-transcriptional regulation of the let-7 microRNA during neural cell specification.


Key Words: embryonic stem cells • neurogenesis • fragile X mental retardation protein • miRISC • P/GW bodies


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
MICRORNA, OR MIRNA, represent a large class of small (~22 nt) RNA molecules that act as antisense regulators of mRNA utilization. Various mouse and human tissues and cell lines have been shown to express distinct and characteristic repertoires of miRNAs, and it is apparent that miRNAs significantly influence protein expression patterns during mammalian development. The salient features of miRNA genetics, biogenesis, and function have been presented in several comprehensive reviews (1 2 3) . The mechanisms responsible for tissue and developmental specificity of miRNA expression have yet to be defined. In the first step of miRNA biogenesis, primary nuclear transcripts (termed pri-miRNA) are synthesized by RNA-polymerase II. The pri-miRNA are then processed by a nuclear protein complex containing the Drosha RNase (reviewed in ref. 4 ). Nuclear cleavage releases an ~ 70 nt hairpin precursor (pre-miRNA) that is exported to the cytoplasm (reviewed in ref. 4 ). Understanding of cytoplasmic events is rapidly evolving. The pre-miRNA is subject to a second round of processing by the RNase Dicer, acting in concert with a dsRNA binding protein (TRBP in mammals) and an Argonaute protein (5 6 7) . The mature miRNA is incorporated into an effector complex alternately referred to as the miRNP, RISC, or miRISC, reflecting the considerable functional and biochemical overlap between the miRNA and RNAi pathways (miRNA biogenesis is reviewed in refs. 1 , 3 , 8 ). Recently, trafficking of miRNP components to processing bodies (also called GW bodies or P/GW bodies) has been shown to be an essential feature of the pathway (9 10 11 12 13 14 15) . P/GW bodies are cytoplasmic subcompartments involved in mRNA metabolism, degradation, and translational control.

The original C. elegans miRNAs, lin-4 and let-7, control the developmental timing of progenitor cell maturation (reviewed in refs. 2 , 16 ), a finding that has been extended to additional let-7 family members (17) . Johnson et al. have demonstrated widespread and evolutionarily conserved regulation of the RAS family of growth control proteins by let-7 (18) . In addition, let-7 and lin-4 cooperate in the post-transcriptional regulation of the C. elegans hunchback homologue hbl-1 (17 , 19 , 20) , a key gene in the specification of neural progenitor cell fate. Premature let-7 expression in zebrafish and Xenopus led to a generalized developmental arrest and prominent failure of eye development (21) .

In humans and mice, the let-7 family consists of 12 precursor genes that encode nine distinct, mature 22-nucleotide sequences. The mature forms (designated let-7a through let-7i together with the highly related mir-98) differ at one to four positions from the canonical let-7a sequence. Lagos-Quintana et al. were the first to demonstrate high representation of let-7 family members in miRNA populations from mouse brain (22) , findings that were subsequently extended to primates (23) . Expression of let-7 in the developing nervous system of zebrafish has recently been characterized by ISH (24) , and the technique has been extended to mouse embryogenesis (25) . However, the function of let-7 during brain development has not been specifically addressed. Given increasing evidence for the importance of miRNA in pathways controlling cell specification and patterning in the nervous system (reviewed in refs. 26 27 28 ), we have investigated the control of let-7 expression in the embryonic mouse brain and differentiating ES cells. We present evidence for an important post-transcriptional component in the regulation of let-7 during neural differentiation and lineage specification.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
ISH
All animal procedures were performed in accordance with relevant European Union guidelines for animal use in laboratory research. Sample preparation and hybridization with LNA probes (Exiqon, Woburn, MA, USA) were based on published protocols (25 , 57) ; details are provided in the Supplemental material.

Cell culture
Protocols for maintenance and differentiation of EC and ES cells, as well as primary cell culture, have been recently described (29) ; a summary is provided in Supplemental material.

Transfections and immunofluorescence microscopy
Details of sensor plasmid construction and use in stable and transient transfection asays have been described (29) and are provided in the Supplemental material. For immunohistochemistry, EC and HEK293 cell were transfected with Fugene6 reagent (Roche, Nutley, NJ, USA) using 250 ng of FLAG-tagged Ago1, Ago2, or FMRP expression plasmids. MOV10 and TNRC6B constructs, described in (12) , were Myc-tagged and visualized with rabbit anti-Myc antibody (Sigma, St. Louis, MO, USA). Twenty-four to 48 h after transfection, cells were fixed and stained with the following primary antibodies: mouse anti-Flag (M2, Sigma), mouse anti-GW182 (4B6, Abcam, Cambridge, MA, USA), rabbit anti-Ago1 (Upstate, Charlottesville, VA, USA), rabbit anti-Ago2 (Upstate), or mouse anti-FMRP (1C3, Euromedex, Strasbourg, France). Secondary antibodies were conjugated to Alexa-488 and –568 goat (Molecular Probes, Carlsbad, CA, USA). Images were obtained by confocal microscopy (Leica TCS SL) and analyzed with Leica confocal software, Volocity, and ImageJ software packages.

Northern blot analysis
Oligonucleotide probes for Northern blots correspond to miRNA sequences at the miRNA registry (http://www.sanger.ac.uk/Software/Rfam/mirna/index.shtml). Preparation of the mouse brain Northern blot has been described (29) ; see also Supplemental material. The miRNA Northern blot procedure, including hybridization conditions and end-labeling with T4 polynucleotide kinase, followed published protocols (29 , 58) . The same procedure was followed for LNA probes, hybridization temperature was increased to 55°C and washes were at 65°C.

In vitro miRNA processing assay
The following primer pairs were used to generate templates for in vitro transcription: 5'TAATACGACTCACTATAGGAGGTAGTAGGTTGTATAG3' and 5'GGAAAGACAGTAGATTGTA3' (let-7a); 5'TAATACGACTCACTATAGGAGGTAGGAGGTTGTATAG3' and 5'GGAAAGCTAGGAGGCCGTA3' (let-7e); 5'CGTAATACGACTCACTATAGGGGGGCCGATGCACTGTA3' and 5'GAAAGAGACCGGTTCACTG3' (mir-128). The polymerase chain reaction (PCR) products were purified and used in in vitro transcription reactions with T7 RNA polymerase in the presence of 32P {alpha}-uridine triphosphate. Cytoplasmic extracts for the in vitro reaction were prepared in lysis buffer (0.5% Nonidet P-40, 150 mM NaCl, 20 mM Tris-HCl, pH 7.5, 2 mM MgCl2, 10 mM NaF, 1 mM DTT, 20% glycerol, and protease inhibitors). For processing reactions, 10 µg protein was incubated for 90 min with 20,000 cpm RNA in 75mM NaCl, 20 mM Tris-HCl, pH 7.5, 3.0 mM MgCl2, and 0.1 U/µl RNAsin. Digestion with recombinant Dicer (0.1 U/reaction) was performed according to the manufacturer’s recommendations (Ambion, Austin, TX, USA). Reaction products were resolved by denaturing electrophoresis; gels were stained with ethidium bromide to visualize size standards, dried, and visualized by autoradiography.

EMSA
Cell extracts (2 µg protein) were incubated with 20,000 cpm 32P-labeled precursor RNAs for 30 min at 37° in 20 mM Tris-HCl, pH 8.0, 100 mM KCl, 1.5 mM MgCl2, and 1 mM DTT. Ficoll was added to 2%, followed by electrophoresis on a 5% polyacrylamide gel. Anti-FMRP monoclonal antibody (mAb) 7G1–1 and anti-Rip1 were obtained from the Developmental Studies Hybridoma Bank as concentrated hybridoma supernatant.

Chromatin immunoprecipitation assay (ChIP)
RNA-pol-ChIP experiments were performed essentially as described in ref. 32 using the ChIP assay kit (Upstate) according to the manufacturer’s recommendations. PCR primers are described in Supplemental methods.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Patterns of let-7 expression in E9.5 mouse embryos
We previously analyzed the regulation of several highly expressed neural miRNA in embryonic brain development and neural differentiation of ES and EC cells (29) . To extend these studies to let-7, we employed recently developed protocols for ISH of miRNAs (24) on early mouse embryos. The LNA-modified probes used have been shown to be sensitive to single-nucleotide exchanges (25) , minimizing potential cross-hybridization. For three let-7 isoforms tested (let-7a, let-7c, and let-7e), similar expression patterns were obtained in whole mounts of E9.5 embryos. Staining was observed primarily in the neuroepithelium of the brain and spinal cord, the first and second branchial arches, and the forelimb primordia (Fig. 1 A). In the case of let-7a but not let-7c or let-7e, most embryos demonstrated weaker signal in the developing heart and vasculature. The staining pattern obtained was strikingly similar to that observed with the brain-specific miRNAs mir-124 and mir-128 (Fig. 1A ). To demonstrate specificity of the hybridization conditions, mir-1 strongly and specifically stained the heart and major vessels but not the neuroepithelium; no signal was obtained for mir-140, a cartilage-specific miRNA (Fig. 1A ). These results are consistent with an extensive ISH study in zebrafish (24) and with many expression studies in the mouse using Northern blot or microarray technologies.


Figure 1
View larger version (89K):
[in this window]
[in a new window]

 
Figure 1. let-7 ISH. A) E 9.5 mouse embryos were stained with digoxigenin-labeled LNA oligonucleotides directed against let-7 isoforms. For comparison, staining obtained with probes specific for brain-enriched miRNAs (mir-124, mir-125, and mir-128) and the control miRNA mir-1 (mesoderm-specific) and mir-140 (cartilage-specific) are shown. B–D) Sections of a representative E9.5 whole mount stained for let-7e; structures referred to in the text are marked. B) A coronal section through midbrain (m), optic vesicles (o), first branchial arch (b), and heart chambers (h). C) A higher magnification of a similar section. D) Detailed staining of the spinal cord, somites (s), and hindgut (g) at the level of the forelimb bud (f). E) Autoradiograph of E13.5 sagittal section probed with let-7a. Level of section displays lateral and third ventricles, cortex, striatum and midbrain, anterior spinal cord and dorsal root ganglia, jaw primordia and tongue, left ventricle, lung and pleural cavity, liver, stomach, and hind limb (see text). F) Autoradiographs of ISH on adult mouse brain using the miRNA probes indicated below each image. Strong let-7 signal is apparent in the hippocampal formation and the cerebellum.

Tissue specificity was examined in sections of a representative E9.5 embryo stained for let-7 (let-7e). The section in Fig. 1B provides an overview of the heart, branchial arches, and cranium. The neuroepithelium of the midbrain and forebrain are uniformly stained, as are the mandibular and maxillary parts of the first branchial arch. let-7e expression was not detected in heart muscle or vasculature. Figure 1C provides a higher magnification of brain and branchial arch staining. For each let-7 probe tested, staining was evenly distributed throughout the hindbrain, midbrain, and forebrain, as well as the otic and optic vesicles (data not shown). Staining of the branchial arches is consistent with the initiation of expression in cells of the migrating neural crest. At the level of the forelimb bud (Fig. 1D ), let-7 was expressed in the limb bud mesoderm as well as in the ventral and dorsal neural tube. Within the somites, staining was most intense in the dorsal and lateral cell layers of the dermamyotome. Prominent staining in the developing nervous system encouraged us to conduct additional experiments at later time points.

To follow expression after E9.5, we employed ISH with 35S-labeled LNA probes. Staining of a sagittal section of an E13.5 embryo for let-7a revealed widespread expression, most prominently in the neuroepithelium of the brain and spinal cord, and in the cranial and dorsal root ganglia (Fig. 1E ). Expression in the limb buds was also conspicuous, particularly in the cartilage. Organs of the gut stained less intensely, and the heart and lungs showed the lowest levels of expression.

In general, in sections of the developing brain we observed high levels of expression in the embryonic hippocampal formation and cortical layers; expression in the granular layer of the cerebellum increased postnatally (A. Rybak and F. G. Wulczyn, unpublished results). In the adult brain, let-7 expression was reduced in comparison to the neonate, with high levels of expression in the neuron-rich layers of the hippocampus and cerebellum. Representative results for let-7a, let-7c, and the mir-1 control are shown in Fig. 1F . These results are consistent with a Northern blot analysis of let-7 expression during brain development (see Supplemental Fig. 1A), in which 22 nt forms of let-7 increase in parallel with the major periods of neurogenesis in the cortex between E13 and E18 and in the postnatal cerebellum.

Comparison of primary, precursor, and mature let-7 expression in embryonic stem cells
In principle, signals obtained in ISH could represent primary transcripts, hairpin precursor forms, or the mature 22 nt let-7 miRNA. At the earliest stages of development, Northern blots reveal that levels of the 22 nt mature forms are low and the ratio of precursor to mature RNA is high (Supplemental Fig. 1A). We therefore turned to two well-established model systems: neural differentiation of embryonic stem (ES) cells and the P19 embryocarcinoma (EC) cell line to study early regulation of the primary transcript, precursor and mature forms during neurogenesis. We began by inducing ES cell differentiation either in the absence of exogenous inducer (cardiomyocyte differentiation) or in the presence of retinoic acid (RA) as an inducer of neural cell phenotypes. In agreement with published reports (30 , 31) , mature ~ 22 nt forms of let-7 (let-7a,c,e) were strongly induced during either cardiomyocyte or neural differentiation protocols (Fig. 2 A). No expression of mature forms was detected in either undifferentiated cells or at the embryoid body stage. As a control for RNA integrity, the blot was also probed for mir-294, a miRNA specifically expressed in undifferentiated cells and embryoid bodies (30) .


Figure 2
View larger version (28K):
[in this window]
[in a new window]

 
Figure 2. A) Comparison of miRNA induction in embryoid body (EB), cardiomyocyte, and neural ES cells. RNA was isolated from undifferentiated ES cells cultured in the presence of LIF (U, lane 1), after cultivation for 7 days as EB (EB, lane 2), on day 13 of cardiomyocyte differentiation (D-RA, lane 3), or on day 24 after induction of neural differentiation by RA (D+RA, lane 4) (see Supplemental material). Images were cropped to show all specific signals obtained with each probe. Precursor forms are marked by an arrow. B) let-7 induction during in vitro differentiation of EC cells. Total RNA was prepared from undifferentiated EC cells at day 0 (U, lane 1) or 12 days after RA treatment (D, lane 2). Precursor forms are indicated by an arrow to the right. C) Expression of primary let-7 miRNA transcripts in undifferentiated (lanes 1, 3) and differentiated (lanes 2, 4) EC cells. cDNAs were amplified with primers specific for let-7a-1/let-7f-1 (pri-let-7a) or mir-99/let-7e/mir-125a (pri-let-7e). For both miRNA clusters, differentiation was accompanied by a modest increase in the level of primary transcripts. Differentiation was monitored using the pattern of {alpha}6-integrin transcripts. Undifferentiated cells exclusively expressed the characteristic short isoform (lane 1). In differentiated cells, alternative splicing generates a long transcript as predominant isoform (lane 2). Control reactions with mock cDNA are shown in lanes 3, 4. D) ChIP assay for pri-let-7a, pri-let-7e, and Oct4. DNA eluted from precipitates obtained with or without anti-RNA pol II antibody, as indicated above each lane, was amplified with specific primers for pri-let-7 transcripts or Oct4, as indicated on the right. Specific association of RNA pol II with each let-7 cluster was independent of differentiation state. Oct4 transcription was significantly diminished in differentiated cells. E) miRNA expression in primary embryonic neurons and astrocytes. Northern blots were probed for the miRNA indicated to the right of each exposure; precursor hybridization is shown for let-7c and let-7e (arrow). RNA was isolated from EC cells 12 days after stimulation with retinoic acid (P, lane 1); primary neurons (N, lane 2); primary astrocytes (A, lane 3); and for comparison E15 total brain RNA (E15, lane 4). As a control, the filter was hybridized with a probe against U6 RNA (bottom panel). F) Expression of primary let-7 miRNAs transcripts in embryonic neurons (lanes 1, 3) and astrocytes (lanes 2, 4). PolydT primed cDNAs were amplified with primers specific for let-7a-1/let-7f-1 (pri-let-7a) or mir-99/let-7e/mir-125a (pri-let-7e) (lanes 1 and 2). Control reactions with mock cDNA are shown in lanes 3, 4. cDNA integrity was monitored using primers specific for ß-actin.

In contrast to the mature miRNAs, hybridization signals representing ~ 70 nt cytoplasmic precursor forms were clearly detected in undifferentiated as well as differentiated cell samples for let-7a, let-7c, and let-7e (Fig. 2A ). To verify probe specificity, all results obtained with DNA probes were confirmed using LNA probes (see Materials and Methods). In multiple experiments, precursor bands detected with the individual probes could be distinguished on the basis of mobility. This is most apparent in a similar experiment performed with EC cells (Fig. 2B ). In EC cells, precursor molecules of distinct mobility were also readily detected in undifferentiated as well as differentiated EC cell samples, and accumulation of mature let-7 forms was dependent on cell differentiation (Fig. 2B ).

We next assayed for primary transcripts, again comparing undifferentiated and differentiated EC cells. We performed semiquantitative RT-polymerase chain reaction (RT-PCR) using primer pairs specific for the let-7a-1 and let-7f-1 pair from chromosome 13 (pri-let-7a) and a three miRNA cluster from chromosome 17 containing mir-99b, let-7e, and mir-125a (pri-let-7e). Control amplifications were performed using mock cDNAs prepared in parallel from each RNA sample. Amplification of the {alpha}6-integrin mRNA served as a control for differentiation and cDNA integrity (Fig. 2C ). A representative amplification from three independent experiments is shown in Fig. 2C .

Both the pri-let-7a and the pri-let-7e transcripts were detected in amplifications of cDNA from undifferentiated cells, consistent with constitutive expression of the hairpin precursor observed in Northern blots. Levels of primary transcripts in cDNA from differentiated cells were increased. Similar results were obtained for ES cell differentiation (data not shown). The degree of transcriptional activation was quantified by real-time PCR using the GAPDH mRNA as standard. Levels of pri-let-7e were 4- and 7-fold higher and levels of pri-let-7a 6- and 10-fold higher after differentiation in ES and EC cells, respectively. This relatively modest degree of transcriptional activation is unlikely to fully account for the strong induction of let-7 family members during differentiation.

To independently verify transcriptional activity in undifferentiated cells, we next assayed for RNA-polymerase II association with let-7 genes using the RNA-pol-ChIP technique (32) . In this assay, chromatin was cross-linked to associated proteins and then fractionated. The resulting complexes were immunoprecipitated with an RNA-polymerase II-specific antibody; after elution coprecipitated DNA was amplified with primers corresponding to the pri-let-7a and pri-let-7e transcripts. As shown in Fig. 2D , the efficiency of product amplification was similar in immunoprecipitates from undifferentiated and differentiated cells, confirming RNA-polymerase II association with the two let-7 transcription units in undifferentiated cells. As a control, transcriptional down-regulation of the stem cell marker Oct4 after differentiation was verified in samples processed in parallel.

To test the relevance of these results for brain development, we determined primary transcript levels in RNA samples from embryonic brain. Primary transcripts were detected in cDNA from each of five time points sampled, but not in mock cDNA (Supplemental Fig. 1C). Both primary transcripts tested were modestly increased at E16 and P0 compared with E13, and levels declined somewhat perinatally. Like ES and EC cells, these results indicate that both let-7 loci tested are transcriptionally activated during the major phase of embryonic neurogenesis; however, the relative magnitude of miRNA accumulation compared with transcriptional up-regulation suggests a significant contribution from post-transcriptional mechanisms.

Differential regulation of let-7 expression in neural lineages
We previously described distinct profiles of miRNA expression in embryonic neurons and astrocytes. Comparing let-7 expression between the two lineages, mature forms of let-7isforms accumulated to markedly higher levels in neurons (Fig. 2E ). There was a clear disparity between accumulation of the precursor and mature forms, as precursor forms were detected in both cell types at similar levels (Fig. 2E , data shown for let-7c and let-7e). To address the question of regulation, we also compared levels of the primary transcripts pri-let-7a and pri-let-7e. Despite the differential expression of the mature miRNAs, primary transcript levels were similar (Fig. 2F ). This result was confirmed by quantitative real-time PCR (data not shown). Although this experiment provides only a snapshot of let-7 expression in the two lineages, which may change during development, it is consistent with the ISH results presented in Fig. 1E .

We used a functional assay to confirm the Northern blot analysis of let-7 expression in differentiating EC cells and in primary cultures. We assayed let-7 activity using a sensor construct containing let-7 binding sites derived from the C. elegans lin-41 mRNA linked to eGFP. As expected, expression of the sensor construct was powerfully suppressed in EC-derived neurons but not in undifferentiated EC cells (Supplemental Fig. 2A, B). Differentiation had no effect on antisense or point mutant control constructs. Similarly, let-7-mediated suppression was substantially greater after transfection of the sensor into primary neurons than in astrocytes, reflecting differential let-7 expression in the two lineages (Supplemental Fig. 2C). Representative flow cytometry plots for these experiments are provided in Supplemental Fig. 3.

Developmental regulation of miRNA processing activity
The observation that precursor forms are present in undifferentiated ES and EC cells in the absence of mature let-7 prompted us to examine the efficiency of precursor processing as a function of cellular differentiation. To determine whether let-7 processing is developmentally regulated, we examined processing activity in vitro (Fig. 3 ). Incubation of an internally labeled pre-let-7a RNA designed to contain a 2 nt overhang with cytoplasmic extracts from differentiated EC cells led to the release of a 22 nt RNA that comigrated with the digestion product produced by recombinant Dicer (Fig. 3A ), and with a synthetic 22 ntRNA oligoribonucleotide run in parallel (not shown). let-7 processing activity was very low in extracts from undifferentiated EC cells (lane 2) and was strongly increased 12 days after induction of neural differentiation by RA treatment (lane 4).


Figure 3
View larger version (76K):
[in this window]
[in a new window]

 
Figure 3. Developmental regulation of miRNA processing activity. A) Pre-let-7a RNA was incubated in a processing reaction either in the absence of added protein (control, lane 1), with extracts from undifferentiated EC cells (lane 2), RA-stimulated EC cells cultured for 8 days (lane 3) or 12 days (lane 4), or digested with recombinant Dicer protein (lane 5). Reaction products were analyzed by denaturing gel electrophoresis. The position of ~ 22 nt let-7a is indicated by an arrow. B) Pre-mir-128 RNA was used in the processing assay as described for panel A. Digestion products obtained after incubation with recombinant Dicer (lane 1), extracts from undifferentiated EC cells (lane 2), RA-stimulated EC cells cultured for 8 days (lane 3) or 12 days (lane 4), and without added protein (control, lane 5). The position of ~ 22 nt mir-128 is indicated by an arrow.

To determine whether the increase in processing activity was specific for pre-let-7a, we repeated the experiment with the neuron-specific mir-128 precursor as substrate (Fig. 3B ). mir-128 processing activity also showed a clear correlation with the differentiation state of the cells. Incubation of pre-mir-128 with extracts from day 8 or 12 cells (lanes 3 and 4), but not undifferentiated cell extracts (lane 2), led to release of a 22 nt RNA that comigrated with the digestion product produced by recombinant Dicer (lane 1).

Analysis of pre-miRNA binding complexes
We reasoned that differential processing activity might be reflected in differences in pre-let-7 binding activity, and next examined precursor binding activity in an EMSA. We first tested differentiated and undifferentiated EC cell extracts using pre-let-7a as substrate (Fig. 4 A). We observed one binding activity common to all extracts (designated complex A). Apart from complex A, neural differentiation after stimulation with RA was accompanied by a shift in the pattern of RNA binding. Undifferentiated extracts contained high levels of a high mobility complex designated complex C. Formation of complex C decreased during the course of neural differentiation and was supplanted by an additional complex with slower mobility, designated B (Fig. 4A , lanes 1–4). For comparison, extracts prepared from cells induced under conditions favoring differentiation to cardiomyocyte-like cells were also tested. In contrast to neural cells, these cells displayed a more modest shift from complex C to B over the course of the experiment (Fig. 4A , lanes 5, 6).


Figure 4
View larger version (77K):
[in this window]
[in a new window]

 
Figure 4. Analysis of miRNA precursor binding complexes. A) Labeled pre-let-7a RNA was incubated either without extract (lane 1) or with extract from undifferentiated EC cells (lane 2), or EC cells stimulated with RA and harvested after 8 (lane 3) or 12 days (lane 4). For comparison, EC-derived cardiomyocytes were tested after 8 (lane 5) and 12 (lane 6) days of differentiation. Binding complexes referred to in the text are labeled to the right: complex C is down-regulated during neural differentiation, complex B is induced. Complex A is constitutive. B) Extracts from RA-stimulated cells as described in panel A were incubated with labeled pre-let-7e RNA as indicated above each lane. Binding patterns closely resemble pre-let-7a; specific complexes are labeled as in panel A. C) The sensitivity of binding to synthetic 2'OM-ORN. Free pre-let-7a probe was incubated either with synthetic let-7a 2'OM-ORN (lane 2) or with an 2'OM-ORN complementary to let-7a (lane 3). Duplex formation leads to a slower migrating band in lane 3. Undifferentiated EC cell extracts (lanes 47) or extracts from day 12 (lanes 812) were incubated with labeled pre-let-7a RNA without 2'OM-ORN (lanes 4, 9), with a let-7a sense 2'OM-ORN (lanes 5, 10), with a let-7a antisense 2'OM-ORN (lanes 6, 12), or with control anti-mir-128b 2'OM-ORN, (lanes 7 and 11). Migration of free pre-let-7a probe is shown in lanes 1, 8. Note disruption of complex C by sense let-7 in lanes 5, 10, and inhibition of complex B by antisense let-7 in lanes 6, 12. D) Differentiated EC cells extracts from day 12 (lanes 25; 1113) or day 8 (lanes 79) were preincubated either without antibody (lanes 2, 7, 11); with anti-Ago1 polyclonal antibody (pAb) (A, lane 3); anti-Gemin3 mAb (G, lane 4); or with antihistone3 H3 pAb (H, lane 5), anti-FMRP mAb 7G1–1 (F, lanes 8, 12), or anti-Rip1 mAb (R, lanes 9, 13) prior to addition of labeled pre-let-7e. Migration of free pre-let-7e probe is shown in lanes 1, 6, 10. Anti-Ago1 and anti-FMRP specifically reduced formation of complex B. E) Binding complexes formed after incubation of labeled pre-let-7a with extracts from undifferentiated (lane 2) or day 8 (lane 3) EC cells or primary embryonic neurons (N, lanes 46). Migration of free probe is shown in lane 1. Neuronal extracts were preincubated with anti-FMRP antibody (F, lane 5) or control anti-Rip1 mAb (R, lane 6). Two prominent complexes, labeled A and B to the right, with similar mobility to complex A and B from neuronal EC cells are seen using neuronal extracts. Neuronal complex B is sensitive to anti-FMRP antibody (lane 5) but not to control antibody (lane 6).

We next examined binding to the related pre-let-7e precursor and observed a similar pattern of binding to pre-let-7a (Fig. 4B , lanes 1–4). Complex C was the predominant activity in undifferentiated cells. Differentiation was accompanied by a strong reduction in complex C and a parallel increase in complex B. In competition experiments, all three complexes were inhibited by addition of a 10-fold excess of unlabeled pre-let-7e RNA, but not by an unrelated RNA fragment transcribed from the eGFP gene (data not shown). To further characterize the binding activities and their specificity, we determined the sensitivity of binding to sense and antisense 2'O-methyl-modified oligoribonucleotides (2'OM-ORN). We first tested the interactions of each competitor with the let-7 precursor in the absence of protein extract (Fig. 4C , lanes 1–3). Addition of the let-7a 2'OM-ORN had no effect on the migration of the labeled precursor (lane 2). In contrast, addition of the anti-let-7a 2'OM-ORN led to formation of a band with reduced mobility, indicating that the antisense molecule could invade the stem and compete with the let-7a* sequence for let-7a (lane 3).

The sense and antisense 2'OM-ORN had differential effects on the RNA binding complexes B and C. Addition of the let-7 surrogate eliminated complex C formation without reducing complex B (lanes 5 and 10). The interference was sequence specific, as anti-let7 did not affect complex C and a control 2'OM-ORN complementary to mir-128 displayed only partial inhibition (lanes 6 and 7). This result suggests that complex C makes specific contacts to the let-7 sequence in the context of the precursor RNA.

The pattern of inhibition observed for complex B was the inverse of complex C. Neither the let-7 surrogate (lanes 5 and 10) nor anti-mir-128 (lanes 7 and 11) significantly interfered with complex B formation. However, addition of anti-let-7 strongly reduced complex B formation (Fig. 4C , lane 12). This suggests that complex B requires an intact hairpin, since the anti-let-7 2'OM-ORN disrupts the hairpin structure (Fig. 4C , lane 3). The results are also consistent with a functional role for complex B in processing, as antisense but not sense 2'OM-ORN strongly inhibit miRNA function in vivo (33 , 34) .

To directly link the precursor RNA binding activity to the miRNA biogenesis pathway, we challenged neural complexes with antibodies to several known miRNP components (Fig. 4D ). Addition of protein A purified anti-Argonaute1 antibody, a core miRNA protein (Ago1, lane 3), reproducibly reduced formation of complex B. As a control, binding was unaffected by addition of either an unrelated antibody preparation (protein A purified anti-H3) or an antibody specific for the RNA helicase Gemin3 (Fig. 4D , lanes 4, 5). Furthermore, a mAb specific for the miRNA-associated fragile X mental retardation protein (FMRP, lane 8) reproducibly reduced formation of complex B. Results are shown for day 8 and day 12 EC extracts (Fig. 4D , lanes 8, 12). Control reactions contained isotype-matched antisera that did not affect binding (lanes 9 and 13).

We next compared pre-let-7 binding activity in EC-derived neurons to primary cortical neurons (Fig. 4E ). In primary neurons we observed two RNA binding activities with mobility indistinguishable from complexes A and B. As expected, the embryonic complex C was not present. Preincubation with anti-FMRP antibody strongly and specifically inhibited formation of the neuronal complex B compared with control (Fig. 4E , lanes 5, 6), consistent with the presence of FMRP in a neuron-enriched pre-let-7 binding complex.

Localization of miRNA processing proteins in stem cells and neurons
With the exception of germ cells, which possess a distinct complement of miRNP proteins, the miRNA pathway is generally thought to be ubiquitous. However, the possibility of developmental regulation has not been directly addressed. In Supplemental Fig. 4A, we confirmed that mRNA levels for most of the known components of the miRNP (Dicer, Ago1, Gemin3, Gemin4, Mov10, TNRC6B, and TRBP2) were relatively constant in the cell models used in our study. An interesting exception was FMRP, which is known to be preferentially (though not exclusively) expressed in neurons. We found that the FMRP mRNA was up-regulated during neural differentiation of both ES and EC cells (Supplemental Fig. 4B). In differentiated EC cells, FMRP immunoreactivity was elevated in cells expressing neuronal markers and protein levels were clearly elevated in primary neurons compared with astrocytes (Supplemental Fig. 4C, D). Finally, higher levels of the FMRP-associated complex B were observed by EMSA in extracts from embryonic neurons compared with astrocytes (Supplemental Fig. 4E).

We next examined localization of FMRP in comparison to the miRNA components Ago1, Ago2, and the P/GW body marker GW182. In agreement with several reports (10 11 12 , 14) , we observed colocalization of Ago1 and Ago2 with GW182 to discrete, brightly staining cytoplasmic foci in HEK293 cells. The results for transfected Ago1 are presented in Fig. 5 A. Similar results were obtained after staining for endogenous Ago1 (Supplemental Fig. 5). Given the known association of FMRP with the miRNP, we performed cotransfections with either Ago1 or Ago2. Both Argonautes displayed partial overlap with FMRP in distribution and colocalization to cytoplasmic foci; results are shown for Ago1 (Fig. 5B ).


Figure 5
View larger version (23K):
[in this window]
[in a new window]

 
Figure 5. Cellular localization of miRNA processing proteins. A) HEK293 cells were transfected with Ago1 and visualized with rabbit anti-Ago1 serum. The Ago1 protein localized to P/GW bodies as determined by costaining for the marker protein GW182. Nuclei were visualized with Hoechst 33342. B) FMRP and Ago1 were cotransfected in HEK293 cells and visualized with anti-FMRP mAb 1C3 and rabbit anti-Ago1 serum, respectively. Colocalization to cytoplasmic foci is apparent in the overlay to the right. C) Flag-tagged Ago1 and FMRP proteins were expressed in EC and ES cells, as indicated above each plate. Cells were stained with anti-Flag M2 mAb. Ago1, Ago2 (not shown), and FMRP each displayed diffuse cytoplasmic staining. D) EC cells were cotransfected with expression vectors for Flag-tagged Ago1 and c-myc-tagged MOV10. Ago1 was visualized with anti-Flag mAb M2 (green), MOV10 with rabbit anti-myc (red). Representative foci marked by arrows. E) EC cells were cotransfected with expression vectors for Flag-tagged Ago1 and c-myc tagged TNRC6B, as described in panel D. Note dependence of Ago1 localization on TNRC6B expression comparing the two cells shown. F) EC cells were cotransfected with expression vectors for Flag-tagged FMRP and c-myc-tagged TNRC6B, and stained as described in panel D. Partial relocalization of FMRP to TNRC6B-tagged foci was observed; examples are marked by arrows.

We subsequently investigated subcellular localization of Ago1, Ago2, and FMRP in ES and EC cells. In contrast to HEK293 cells, we observed diffuse cytoplasmic staining for each of the three proteins without discernible concentration at defined subcellular structures. Results were confirmed using polyclonal sera specific for Ago1 or Ago2, the FMRP-specific mAb 1C3, as well as epitope tag-specific anti-Flag (Ago1, Ago2, FMRP) and anti-hemagglutinin (Ago1, Ago2) antibodies (data not shown). Representative plates for Ago1 in ES and EC cells, and FMRP in EC cells, using the anti-Flag antibody, are presented in Fig. 5C . To determine whether ES and EC cells possess P/GW bodies, we tested ectopically expressed MOV10 and TNRC6B, two P/GW body proteins that physically associate with Argonautes (12) . Both localized to cytoplasmic foci in EC and HEK293 cells (data not shown). In cotransfection experiments, MOV10 and TNRC6B were able to relocalize either Ago1 or Ago2 to P/GW bodies in ES and EC cells. Representative results for Ago1 are shown in Fig. 5D, E and suggest that the signals governing localization of Argonaute in stem cells may be overridden or saturated by ectopic expression of MOV10 or TNRC6B. In the same assay, the integral P/GW body protein TNRC6B was able to attract FMRP to cytoplasmic foci (Fig. 5F ). The effect was specific, as MOV10 had no obvious effect on FMRP distribution in either stem cell line (data not shown).

These results suggest that regulatory interactions may control miRNP organization during differentiation. Given the evidence implicating FMRP and MOV10 in miRNA-mediated neuronal translation (35 , 36) , we repeated the transfection experiments in cultured hippocampal neurons. Staining was observed either in bright foci in the neuronal cell bodies (Ago1, Ago2, TNRC6B) or in a punctate distribution in the dendritic arbors (Ago1, Ago2, FMRP, MOV10). Colocalization of Ago1 and MOV10 and of FMRP and MOV10 to dendritic foci is shown in Supplemental Fig. 6A, B. To better visualize the MOV10 localization in relation to dendritic structures, such as branch points and spines, MOV10 and eGFP were cotransfected (Supplemental Fig. 6C). The two proteins did not colocalize, and MOV10 staining can be seen to frequently underlie dendritic spines. A different pattern was obtained with TNRC6B, which was found primarily in bright foci in the soma and proximal dendrites (Supplemental Fig. 6D). It will be interesting to functionally characterize the discreet compartments occupied by miRNA pathway components in neurons.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Although not restricted to the nervous system, let-7 family members are highly represented in libraries of brain miRNAs (22) . In zebrafish, the let-7 family is characterized by prominent expression in nervous tissue (24) . Mansfield et al. used a sensor strategy to describe let-7 expression in mouse development, but did not focus on the CNS (37) . Using ISH, we found that the distribution of three let-7 family members at E9.5 closely resembled that of the paradigm brain-specific miRNA mir-124 and brain-enriched mir-125 and mir-128. It is interesting to note the lack of either dorsal/ventral or anterior/posterior polarity in the CNS expression pattern at E9.5 or E13.5. This is consistent with genetic studies of let-7 function that point to a role in the temporal as opposed to spatial coordination of gene expression (17 , 38) . The timing of let-7 expression triggers terminal cell differentiation in the C. elegans heterochronic gene networks (39) , and it is thought that miRNA may be involved in regulating either the timing, outcome, or maintenance of cell fate decisions (reviewed in refs. 2 , 16 ). It will be interesting to learn whether let-7 plays a similar role in the timing of cell fate decisions in the mammalian CNS.

In ES cells and embryonic neural progenitors, the transition from the pluripotent, self-renewing state to cell-fate restriction is accompanied by a profound shift in the miRNA populations present in the cell. Little is known about the regulatory signals directing this shift. Several studies have begun to address transcriptional control mechanisms underlying specificity in miRNA expression (40 41 42 43) . We present evidence for both transcriptional and post-transcriptional control mechanisms in the induction of let-7 family members during neural differentiation.

We were particularly intrigued by the temporal disparity in the appearance of primary transcripts and cytoplasmic precursors compared with the mature 22 nt form during stem cell differentiation. To account for the lack of mature let-7 in undifferentiated cells, we assayed precursor processing activity and found that it increased in parallel with neural differentiation. The deficiency in let-7 processing in undifferentiated cells might reflect either a lack of an essential component of the processing machinery or suppression of the pathway early in differentiation. However, both ES and EC cells possess an intact RNAi pathway, and accumulate a unique class of stem cell-specific miRNA (30) . Consistent with this, we detected mRNA for all known components of the precursor processing pathway using RT-PCR in undifferentiated stem cells. We therefore favor a model in which let-7 precursor RNAs fail to engage the processing machinery. This model is consistent with the distinct precursor binding complexes present in undifferentiated and differentiated cells and with the evidence for differing subcellular organization of pathway components in self-renewing pluripotent cells.

In the precursor RNA binding assay, a prominent complex (complex B) was shared by stem cell-derived and embryonic neurons. Antibodies against the core processing complex protein Ago1, as well as the miRNP-associated factor FMRP, specifically interfered with complex formation. Besides their essential function in the miRNP effector complex, Argonaute proteins participate in a core ternary complex with Dicer and TRBP in precursor processing (5 6 7 , 44) . Furthermore, immobilized anti-let-7 2'OM-ORN has been used to precipitate Ago1 and Ago2 from let-7-primed RISC complexes (33) . Unlike Argonautes, FMRP is not required for precursor processing in vitro (5 , 45 46 47) , but it may help to link the miRNP and translational control machinery. Several groups have shown that Drosophila and mouse FMRP proteins associate with miRNAs, polyribosomes, and RISC activity (reviewed in refs. 3 , 35 ). The neuron-enriched complex we identified in the RNA binding assay was present at reduced levels in undifferentiated stem cells, which contained instead an alternative complex that was specifically inhibited by a let-7 analog. Further characterization of these binding activities should afford new insights into the regulation of let-7 during stem cell differentiation.

Current models for miRNA processing involve initial precursor binding by a miRNA loading complex and subsequent transfer or rearrangement to an activated effector complex (5 , 6) (reviewed in refs. 48 , 49 ). Localization of the effector complex to cytoplasmic P/GW bodies is thought to be essential for mRNA silencing (9 , 11 , 13) , but it has not yet been established that P/GW bodies are the sites of precursor processing. In undifferentiated ES or EC cells, neither endogenous nor ectopically expressed Argonaute or FMRP were organized in definable cytoplasmic foci. We believe this observation is related to the inefficient processing of let-7 in these cells. It is possible that additional factors, perhaps related to the stem cell-specific pre-let-7 binding complex we have described, act as escorts regulating compartmentalization of the processing machinery. Ectopic MOV10 or TNRC6B presumably override these signals and tether Argonautes and FMRP to P/GW bodies by direct protein-protein interactions.

Our results also strengthen the evidence linking FMRP and the miRNA pathway. We identified FMRP as part of a neuronal pre-let-7 binding complex and found that a portion of ectopically expressed FMRP colocalizes with argonaute proteins to cytoplasmic foci in the HEK293 model. We also found extensive colocalization of Ago1 and Ago2, MOV10, and FMRP in cultured neurons (see Supplemental Fig. 6). These results are consistent with the well-established role for FMRP in the regulation of synaptic translation (reviewed in refs. 35 , 50 ), recruitment of FMRP to stress granules (51) , and identification of FMRP as a miRNP/RISC-associated protein (reviewed in ref. 35 ).

P/GW bodies, as sites of mRNA metabolism, are dynamic structures that are modified in the cellular response to stress and undergo remodelling during the cell cycle (52) . Alteration of cell cycle control is also a hallmark of stem cell differentiation (reviewed in ref. 53 ). Since many miRNAs, including let-7, are thought to target regulators of the cell cycle and proliferation and to promote terminal differentiation, a mechanism to delay miRNA accumulation early in development may be necessary. This scenario is also consistent with the phenotype of mutations in the miRNA biogenesis pathway, which tend to affect development after completion of axis and pattern formation (54 55 56) . Our results reveal novel aspects of early developmental regulation of the miRNA pathway during embryonic stem cell differentiation and neurogenesis.


   ACKNOWLEDGMENTS
 
The authors would like to thank members of the laboratories of Horst Spielmann and Robert Nitsch for support and cooperation. We gratefully acknowledge input and advice from Carmen Birchmeier, Alistair Garratt, and Stefan Britsch. Nicola Brandt provided the hippocampal cell cultures used in this study. Excellent technical work was provided by Anja Gräefe and Brita Scholte. We also thank Roland Büsen and Birgitta Slawik for assistance with stem cell culture and Daniel Richter for help with animal experiments. Frank Slack kindly provided pEYC1 used to amplify C. elegans lin-41 sequences. The FMRP expression plasmid was a gift from Yue Feng; MOV10, TNRC6B, Ago1 and Ago2 were kindly made available by Günter Meister and Thomas Tuschl. L.S. and A.R. are fellows of the Humboldt University Graduate Schools, Grant 238: Damage cascades in Neurological Disorders, and Grant 1123: Learning and Memory, respectively, awarded to R.N. Additional support was provided by SFB grant 665 to F.G.W., S.S., and R.N.


   FOOTNOTES
 
1 These authors contributed equally to this work.

Received for publication March 22, 2006. Accepted for publication September 22, 2006.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Bartel, D. P. (2004) MicroRNAs. Genomics, biogenesis, mechanism, and function. Cell 116,281-297[CrossRef][Medline]
  2. Ambros, V. (2004) The functions of animal microRNAs. Nature 431,350-355[CrossRef][Medline]
  3. He, L., Hannon, G. J. (2004) MicroRNAs: small RNAs with a big role in gene regulation. Nat. Rev. Genet. 5,522-531[CrossRef][Medline]
  4. Han, J., Lee, Y., Yeom, K. H., Kim, Y. K., Jin, H., Kim, V. N. (2004) The Drosha-DGCR8 complex in primary microRNA processing. Genes Dev. 18,3016-3027[Abstract/Free Full Text]
  5. Chendrimada, T. P., Gregory, R. I., Kumaraswamy, E., Norman, J., Cooch, N., Nishikura, K., Shiekhattar, R. (2005) TRBP recruits the Dicer complex to Ago2 for microRNA processing and gene silencing. Nature 436,740-744[CrossRef][Medline]
  6. Gregory, R. I., Chendrimada, T. P., Cooch, N., Shiekhattar, R. (2005) Human RISC couples microRNA biogenesis and posttranscriptional gene silencing. Cell 123,631-640[CrossRef][Medline]
  7. Haase, A. D., Jaskiewicz, L., Zhang, H., Laine, S., Sack, R., Gatignol, A., Filipowicz, W. (2005) TRBP, a regulator of cellular PKR and HIV-1 virus expression, interacts with Dicer and functions in RNA silencing. EMBO Rep. 6,961-967[Medline]
  8. Filipowicz, W., Jaskiewicz, L., Kolb, F. A., Pillai, R. S. (2005) Post-transcriptional gene silencing by siRNAs and miRNAs. Curr. Opin. Struct. Biol. 15,331-341[CrossRef][Medline]
  9. Pillai, R. S., Bhattacharyya, S. N., Artus, C. G., Zoller, T., Cougot, N., Basyuk, E., Bertrand, E., Filipowicz, W. (2005) Inhibition of translational initiation by Let-7 microRNA in human cells. Science 309,1573-1576[Abstract/Free Full Text]
  10. Liu, J., Valencia-Sanchez, M. A., Hannon, G. J., Parker, R. (2005) MicroRNA-dependent localization of targeted mRNAs to mammalian P-bodies. Nat. Cell Biol. 7,719-723[CrossRef][Medline]
  11. Liu, J., Rivas, F. V., Wohlschlegel, J., Yates, J. R., III, Parker, R., Hannon, G. J. (2005) A role for the P-body component GW182 in microRNA function. Nat. Cell Biol. 7,1161-1166[CrossRef][Medline]
  12. Meister, G., Landthaler, M., Peters, L., Chen, P. Y., Urlaub, H., Luhrmann, R., Tuschl, T. (2005) Identification of novel argonaute-associated proteins. Curr. Biol. 15,2149-2155[CrossRef][Medline]
  13. Ding, L., Spencer, A., Morita, K., Han, M. (2005) The developmental timing regulator AIN-1 interacts with miRISCs and may target the argonaute protein ALG-1 to cytoplasmic P bodies in C. elegans. Mol. Cell 19,437-447[CrossRef][Medline]
  14. Sen, G. L., Blau, H. M. (2005) Argonaute 2/RISC resides in sites of mammalian mRNA decay known as cytoplasmic bodies. Nat. Cell Biol. 7,633-636[CrossRef][Medline]
  15. Kotaja, N., Bhattacharyya, S. N., Jaskiewicz, L., Kimmins, S., Parvinen, M., Filipowicz, W., Sassone-Corsi, P. (2006) The chromatoid body of male germ cells: Similarity with processing bodies and presence of Dicer and microRNA pathway components. Proc. Natl. Acad. Sci. U. S. A. 103,2647-2652[Abstract/Free Full Text]
  16. Pasquinelli, A. E., Ruvkun, G. (2002) Control of developmental timing by micrornas and their targets. Annu. Rev. Cell Dev. Biol. 18,495-513[CrossRef][Medline]
  17. Abbott, A. L., Alvarez-Saavedra, E., Miska, E. A., Lau, N. C., Bartel, D. P., Horvitz, H. R., Ambros, V. (2005) The let-7 microRNA family members mir-48, mir-84, and mir-241 function together to regulate developmental timing in Caenorhabditis elegans. Dev. Cell 9,403-414[CrossRef][Medline]
  18. Johnson, S. M., Grosshans, H., Shingara, J., Byrom, M., Jarvis, R., Cheng, A., Labourier, E., Reinert, K. L., Brown, D., Slack, F. J. (2005) RAS is regulated by the let-7 microRNA family. Cell 120,635-647[CrossRef][Medline]
  19. Abrahante, J. E., Daul, A. L., Li, M., Volk, M. L., Tennessen, J. M., Miller, E. A., Rougvie, A. E. (2003) The Caenorhabditis elegans hunchback-like gene lin-57/hbl-1 controls developmental time and is regulated by microRNAs. Dev. Cell 4,625-637[CrossRef][Medline]
  20. Lin, S. Y., Johnson, S. M., Abraham, M., Vella, M. C., Pasquinelli, A., Gamberi, C., Gottlieb, E., Slack, F. J. (2003) The C elegans hunchback homolog, hbl-1, controls temporal patterning and is a probable microRNA target. Dev. Cell 4,639-650[CrossRef][Medline]
  21. Kloosterman, W. P., Wienholds, E., Ketting, R. F., Plasterk, R. H. (2004) Substrate requirements for let-7 function in the developing zebrafish embryo. Nucleic Acids Res. 32,6284-6291[Abstract/Free Full Text]
  22. Lagos-Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, W., Tuschl, T. (2002) Identification of tissue-specific microRNAs from mouse. Curr. Biol. 12,735-739[CrossRef][Medline]
  23. Miska, E. A., Alvarez-Saavedra, E., Townsend, M., Yoshii, A., Sestan, N., Rakic, P., Constantine-Paton, M., Horvitz, H. R. (2004) Microarray analysis of microRNA expression in the developing mammalian brain. Genome Biol. 5,R68[CrossRef][Medline]
  24. Wienholds, E., Kloosterman, W. P., Miska, E., Alvarez-Saavedra, E., Berezikov, E., de Bruijn, E., Horvitz, H. R., Kauppinen, S., Plasterk, R. H. (2005) MicroRNA expression in zebrafish embryonic development. Science 309,310-311[Abstract/Free Full Text]
  25. Kloosterman, W. P., Wienholds, E., de Bruijn, E., Kauppinen, S., Plasterk, R. H. (2006) In situ detection of miRNAs in animal embryos using LNA-modified oligonucleotide probes. Nat. Methods 3,27-29[CrossRef][Medline]
  26. Kosik, K. S., Krichevsky, A. M. (2005) The elegance of the microRNAs: a neuronal perspective. Neuron 47,779-782[CrossRef][Medline]
  27. Klein, M. E., Impey, S., Goodman, R. H. (2005) Role reversal: the regulation of neuronal gene expression by microRNAs. Curr. Opin. Neurobiol. 15,507-513[CrossRef][Medline]
  28. Cao, X., Yeo, G., Muotri, A. R., Kuwabara, T., Gage, F. H. (2006) Noncoding RNAs in the mammalian central nervous system. Annu. Rev. Neurosci. 29,77-103(review)[CrossRef][Medline]
  29. Smirnova, L., Grafe, A., Seiler, A., Schumacher, S., Nitsch, R., Wulczyn, F. G. (2005) Regulation of miRNA expression during neural cell specification. Eur. J. Neurosci. 21,1469-1477[Medline]
  30. Houbaviy, H. B., Murray, M. F., Sharp, P. A. (2003) Embryonic stem cell-specific microRNAs. Dev. Cell 5,351-358[CrossRef][Medline]
  31. Sempere, L. F., Freemantle, S., Pitha-Rowe, I., Moss, E., Dmitrovsky, E., Ambros, V. (2004) Expression profiling of mammalian microRNAs uncovers a subset of brain-expressed microRNAs with possible roles in murine and human neuronal differentiation. Genome Biol. 5,R13[CrossRef][Medline]
  32. Sandoval, J., Rodriguez, J. L., Tur, G., Serviddio, G., Pereda, J., Boukaba, A., Sastre, J., Torres, L., Franco, L., Lopez-Rodas, G. (2004) RNAPol-ChIP: a novel application of chromatin immunoprecipitation to the analysis of real-time gene transcription. Nucleic Acids Res. 32,e88[Abstract/Free Full Text]
  33. Hutvagner, G., Simard, M. J., Mello, C. C., Zamore, P. D. (2004) Sequence-specific inhibition of small RNA function. PLoS Biol. 2,E98[CrossRef][Medline]
  34. Leaman, D., Chen, P. Y., Fak, J., Yalcin, A., Pearce, M., Unnerstall, U., Marks, D. S., Sander, C., Tuschl, T., Gaul, U. (2005) Antisense-mediated depletion reveals essential and specific functions of microRNAs in Drosophila development. Cell 121,1097-1108[CrossRef][Medline]
  35. Jin, P., Alisch, R. S., Warren, S. T. (2004) RNA and microRNAs in fragile X mental retardation. Nat. Cell Biol. 6,1048-1053[CrossRef][Medline]
  36. Ashraf, S. I., McLoon, A. L., Sclarsic, S. M., Kunes, S. (2006) Synaptic protein synthesis associated with memory is regulated by the RISC pathway in Drosophila. Cell 124,191-205[CrossRef][Medline]
  37. Mansfield, J. H., Harfe, B. D., Nissen, R., Obenauer, J., Srineel, J., Chaudhuri, A., Farzan-Kashani, R., Zuker, M., Pasquinelli, A. E., Ruvkun, G., et al (2004) MicroRNA-responsive ‘sensor’ transgenes uncover Hox-like and other developmentally regulated patterns of vertebrate microRNA expression. Nat. Genet. 36,1079-1083[CrossRef][Medline]
  38. Li, M., Jones-Rhoades, M. W., Lau, N. C., Bartel, D. P., Rougvie, A. E. (2005) Regulatory mutations of mir-48, a C. elegans let-7 family microRNA, cause developmental timing defects. Dev. Cell 9,415-422[CrossRef][Medline]
  39. Reinhart, B. J., Slack, F. J., Basson, M., Pasquinelli, A. E., Bettinger, J. C., Rougvie, A. E., Horvitz, H. R., Ruvkun, G. (2000) The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature 403,901-906[CrossRef][Medline]
  40. Sempere, L. F., Sokol, N. S., Dubrovsky, E. B., Berger, E. M., Ambros, V. (2003) Temporal regulation of microRNA expression in Drosophila melanogaster mediated by hormonal signals and broad-complex gene activity. Dev. Biol. 259,9-18[CrossRef][Medline]
  41. Johnston, R. J., Jr, Hobert, O. (2005) A novel C. elegans zinc finger transcription factor, lsy-2, required for the cell type-specific expression of the lsy-6 microRNA. Development 132,5451-5460[Abstract/Free Full Text]
  42. Sokol, N. S., Ambros, V. (2005) Mesodermally expressed Drosophila microRNA-1 is regulated by Twist and is required in muscles during larval growth. Genes Dev. 19,2343-2354[Abstract/Free Full Text]
  43. Biemar, F., Zinzen, R., Ronshaugen, M., Sementchenko, V., Manak, J. R., Levine, M. S. (2005) Spatial regulation of microRNA gene expression in the Drosophila embryo. Proc. Natl. Acad. Sci. U. S. A. 102,15907-15911[Abstract/Free Full Text]
  44. Saito, K., Ishizuka, A., Siomi, H., Siomi, M. C. (2005) Processing of pre-microRNAs by the Dicer-1-Loquacious complex in Drosophila cells. PLoS Biol. 3,e235[CrossRef][Medline]
  45. Provost, P., Dishart, D., Doucet, J., Frendewey, D., Samuelsson, B., Radmark, O. (2002) Ribonuclease activity and RNA binding of recombinant human Dicer. EMBO J. 21,5864-5874[CrossRef][Medline]
  46. Jiang, F., Ye, X., Liu, X., Fincher, L., McKearin, D., Liu, Q. (2005) Dicer-1 and R3D1-L catalyze microRNA maturation in Drosophila. Genes Dev. 19,1674-1679[Abstract/Free Full Text]
  47. Maniataki, E., Mourelatos, Z. (2005) A human, ATP-independent, RISC assembly machine fueled by pre-miRNA. Genes Dev. 19,2979-2990[Abstract/Free Full Text]
  48. Hammond, S. M. (2005) Dicing and slicing: the core machinery of the RNA interference pathway. FEBS Lett. 579,5822-5829[CrossRef][Medline]
  49. Filipowicz, W. (2005) RNAi: the nuts and bolts of the RISC machine. Cell 122,17-20[CrossRef][Medline]
  50. Kaytor, M. D., Orr, H. T. (2001) RNA targets of the fragile X protein. Cell 107,555-557[CrossRef][Medline]
  51. Mazroui, R., Huot, M. E., Tremblay, S., Filion, C., Labelle, Y., Khandjian, E. W. (2002) Trapping of messenger RNA by Fragile X Mental Retardation protein into cytoplasmic granules induces translation repression. Hum. Mol. Genet. 11,3007-3017[Abstract/Free Full Text]
  52. Yang, Z., Jakymiw, A., Wood, M. R., Eystathioy, T., Rubin, R. L., Fritzler, M. J., Chan, E. K. (2004) GW182 is critical for the stability of GW bodies expressed during the cell cycle and cell proliferation. J. Cell Sci. 117,5567-5578[Abstract/Free Full Text]
  53. Burdon, T., Smith, A., Savatier, P. (2002) Signalling, cell cycle and pluripotency in embryonic stem cells. Trends Cell Biol. 12,432-438[CrossRef][Medline]
  54. Kataoka, Y., Takeichi, M., Uemura, T. (2001) Developmental roles and molecular characterization of a Drosophila homologue of Arabidopsis Argonaute1, the founder of a novel gene superfamily. Genes Cells 6,313-325[Abstract]
  55. Giraldez, A. J., Cinalli, R. M., Glasner, M. E., Enright, A. J., Thomson, M. J., Baskerville, S., Hammond, S. M., Bartel, D. P., Schier, A. F. (2005) MicroRNAs regulate brain morphogenesis in zebrafish. Science 308,833-838[Abstract/Free Full Text]
  56. Harfe, B. D., McManus, M. T., Mansfield, J. H., Hornstein, E., Tabin, C. J. (2005) The RNaseIII enzyme Dicer is required for morphogenesis but not patterning of the vertebrate limb. Proc. Natl. Acad. Sci. U. S. A. 102,10898-10903[Abstract/Free Full Text]
  57. Erdtmann-Vourliotis, M., Mayer, P., Riechert, U., Handel, M., Kriebitzsch, J., Hollt, V. (1999) Rational design of oligonucleotide probes to avoid optimization steps in in situ hybridization. Brain Res. Brain Res. Protoc. 4,82-91[CrossRef][Medline]
  58. Lee, R. C., Ambros, V. (2001) An extensive class of small RNAs in Caenorhabditis elegans. Science 294,862-864[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Genes Dev.Home page
T. Katoh, Y. Sakaguchi, K. Miyauchi, T. Suzuki, S.-i. Kashiwabara, T. Baba, and T. Suzuki
Selective stabilization of mammalian microRNAs by 3' adenylation mediated by the cytoplasmic poly(A) polymerase GLD-2
Genes & Dev., February 15, 2009; 23(4): 433 - 438.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. N. Davis, A. C. Hilyard, P. H. Nguyen, G. Lagna, and A. Hata
Induction of MicroRNA-221 by Platelet-derived Growth Factor Signaling Is Critical for Modulation of Vascular Smooth Muscle Phenotype
J. Biol. Chem., February 6, 2009; 284(6): 3728 - 3738.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
N. J. Martinez, M. C. Ow, J. S. Reece-Hoyes, M. I. Barrasa, V. R. Ambros, and A. J.M. Walhout
Genome-scale spatiotemporal analysis of Caenorhabditis elegans microRNA promoter activity
Genome Res., December 1, 2008; 18(12): 2005 - 2015.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Z. Oskowitz, J. Lu, P. Penfornis, J. Ylostalo, J. McBride, E. K. Flemington, D. J. Prockop, and R. Pochampally
Human multipotent stromal cells from bone marrow and microRNA: Regulation of differentiation and leukemia inhibitory factor expression
PNAS, November 25, 2008; 105(47): 18372 - 18377.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. C. Ow, N. J. Martinez, P. H. Olsen, H. S. Silverman, M. I. Barrasa, B. Conradt, A. J.M. Walhout, and V. Ambros
The FLYWCH transcription factors FLH-1, FLH-2, and FLH-3 repress embryonic expression of microRNA genes in C. elegans
Genes & Dev., September 15, 2008; 22(18): 2520 - 2534.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
M. A. Newman, J. M. Thomson, and S. M. Hammond
Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing
RNA, August 1, 2008; 14(8): 1539 - 1549.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
N. S. Sokol, P. Xu, Y.-N. Jan, and V. Ambros
Drosophila let-7 microRNA is required for remodeling of the neuromusculature during metamorphosis
Genes & Dev., June 15, 2008; 22(12): 1591 - 1596.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
L. Chen and G. Q. Daley
Molecular basis of pluripotency
Hum. Mol. Genet., April 15, 2008; 17(R1): R23 - R27.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
S. R. Viswanathan, G. Q. Daley, and R. I. Gregory
Selective Blockade of MicroRNA Processing by Lin28
Science, April 4, 2008; 320(5872): 97 - 100.
[Abstract] [Full Text] [PDF]


Home page
StrokeHome page
K. Jeyaseelan, K. Y. Lim, and A. Armugam
MicroRNA Expression in the Blood and Brain of Rats Subjected to Transient Focal Ischemia by Middle Cerebral Artery Occlusion
Stroke, March 1, 2008; 39(3): 959 - 966.
[Abstract] [Full Text] [PDF]


Home page
Stem CellsHome page
U. Lakshmipathy and R. P. Hart
Concise Review: MicroRNA Expression in Multipotent Mesenchymal Stromal Cells
Stem Cells, February 1, 2008; 26(2): 356 - 363.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
fj.06-6130comv1
21/2/415    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wulczyn, F. G.
Right arrow Articles by Nitsch, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wulczyn, F. G.
Right arrow Articles by Nitsch, R.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS