|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-activated PKC-
signaling by the human biliverdin reductase: identification of activating and inhibitory domains of the reductaseUniversity of Rochester School of Medicine and Dentistry, Department of Biochemistry and Biophysics, Rochester, New York, USA
2Correspondence: University of Rochester School of Medicine and Dentistry, Department of Biochemistry and Biophysics, 601 Elmwood Avenue, Rochester, NY 14642, USA. E-mail: mahin_maines{at}urmc.rochester.edu
| ABSTRACT |
|---|
|
|
|---|
, including cytokines, insulin, and reactive oxygen species (ROS). Presently, we show that hBVR increases PKC-
autophosphorylation, stimulation by TNF-
, as well as cytokine stimulation of NF-
B DNA binding and promoter activity. S149 in hBVR S/T kinase domain and S230 in YLS230F in hBVRs docking site for the SH2 domain of signaling proteins are phosphorylation targets of PKC-
. Two hBVR-based peptides, KRNRYLS230F (#1) and KKRILHC281 (#2), but not their S
A or C
A derivatives, respectively, blocked PKC-
stimulation by TNF-
and its membrane translocation. The C-terminal-based peptide KYCCSRK296 (#3), enhanced PKC-
stimulation by TNF-
; for this, Lys296 was essential. In metabolically 32P-labeled HEK293 cells transfected with hBVR or PKC-
, TNF-
increased hBVR phosphorylation. TNF-
did not stimulate PKC-
in cells infected with small interfering RNA for hBVR or transfected with hBVR with a point mutation in the nucleotide-binding loop (G17), S149, or S230; this was similar to the response of "kinase-dead" PKC-
K281R. We suggest peptide #1 blocks PKC-
-docking site interaction, peptide #2 disrupts function of the PKC-
C1 domain, and peptide #3 alters ATP presentation to the kinase. The findings are of potential significance for development of modulators of PKC-
activity and cellular response to cytokines.—Lerner-Marmarosh, N., Miralem, T., Gibbs, P. E. M., Maines, M. D. Regulation of TNF-
-activated PKC-
signaling by the human biliverdin reductase: identification of activating and inhibitory domains of the reductase.
Key Words: heme oxygenase protein kinase C-
| INTRODUCTION |
|---|
|
|
|---|
is an atypical PKC (aPKC) that is activated by inflammatory cytokines, e.g., tumor necrosis factor (TNF-
; ref. 1
-centered network of signaling and argues for the intriguing possibility that human biliverdin reductase (hBVR) is an adapter protein for linking PKC-
to the TNF-
signaling cascade and NF-
B activation. Previous studies have shown that hBVR, like PKC-
, functions in mitogen-activated protein kinase (MAPK) and activator protein-1 (AP-1)/activating transcription factor (ATF) signaling (2)
B and the AP-1/ATF family of DNA binding factors are involved in inflammation and stress signaling. Activation of PKC-
is essential for transduction of signals by the NF-
B pathway (3)
an overlapping list of activators (6
In addition to kinase activity, hBVR catalyzes, in a unique pH/cofactor-dependent activity profile, the reduction of biliverdin, the product of heme oxidation by heme oxygenase (HO) -1 and HO-2 activity, to bilirubin and is a determinant of acute transcriptional response of HO-1 to stress signals (2
, 8
, 9)
. Oxidation products of HO activity, CO, and bile pigments are biologically active and function in the regulation of inflammatory responses, cell signaling, and gene regulation (10
11
12
13
14
15)
. BVR also regulates HO-1 and PKC activities by eliminating biliverdin, the negative feedback regulator of HO activity and a potent inhibitor of PKA and PKC activities (16)
. Bilirubin, on the other hand, is a free radical chain breaking antioxidant and anti-inflammatory compound (17)
.
Certain structural features found in hBVR resemble those of the aPKC-
. The aPKCs are structurally distinguished by having a single Cys-rich zinc finger domain (C1 region), which is the site of interaction with the pleckstrin homology (PH) domain of interacting/anchoring molecules (18
19
20)
. Notably, the secondary structure of hBVR, inferred from the crystal structure of the rat BVR, includes a six-stranded β-sheet, allowing extensive interaction of the C-terminal helix with its N-terminal kinase domain (21
, 22)
. In secondary structure, this resembles a PH domain that is a prototype for protein:protein interaction module; the domain has a highly divergent primary structure, yet a highly conserved secondary structure (23)
. The primary structure of the C-terminal helix is Cys/His-rich, with a preponderance of charged residues (4
, 24)
.
In addition to sharing the same activators and certain structural features, the kinases cross paths in the cell-signaling cascade. hBVR and PKC-
are downstream effectors of insulin-stimulated insulin receptor kinase (IRK) -phosphatidylinositol 3-kinase (PI3K) signaling (7
, 25)
and participate in negative feedback control of insulin action through the phosphorylation of insulin receptor substrate (IRS) -1 (26
, 27)
. IRS proteins 1 and 2 and hBVR are substrates and competitors for tyrosine phosphorylation by IRK (7)
. hBVR contains two tyrosine phosphorylation sites in Y198MKM and Y228LSF consensus motifs that are the target of the Src homology domain (SH2) of signaling adaptor proteins (7
, 28)
. PKC-
is a negative feedback control mechanism of IRS-1 activity and is recruited to the tyrosine phosphorylated IRS-1 in a heterodimeric complex with a partner protein ZIP (29
, 30)
.
Considering the similarities between IRS-1 and hBVR, with respect to being a substrate for IRK and both having a SH2 domain docking site, it would seem reasonable to suspect hBVR:PKC-
interaction. There is, however, a major difference between hBVR and PKC-
with respect to kinase activity; PKC-
, like other aPKCs, is directly activated by acidic phospholipids, but unlike the classical and novel groups of PKCs, it is not activated by divalent metal ions, such as Ca2+ (25
, 31
, 32)
. The hBVR kinase activity, on the other hand, is not activated by lipid components, and, as with other protein tyrosine kinases (PTKs), the kinase of hBVR is exclusively Mn2+ dependent (7
, 33
, 34)
. This difference has been exploited here and elsewhere to parse the activities of hBVR from S/T kinases. We have demonstrated elsewhere (35)
that hBVR is able to bind to and activate the classical PKC isoform PKC-βII in vitro and in vivo. The interaction of the two proteins in the cell is dependent on an appropriate stimulus for PKC-βII, i.e., phorbol myristate acetate (PMA). hBVR did not bind to the PKC-
isoform that is not activated by PMA in these cells.
Although PKC-
is distributed in many cell types, the full spectrum of its physiological functions, regulation, and substrates has not been elucidated. This study has revealed a previously unknown function of hBVR and a mechanism for regulation of PKC-
activity. The study has shown that hBVR and its peptides can function as kinase effector molecules. The significance of the findings relates to the pivotal role of PKC-
in cellular functions and signal transduction and offers new prospects for modulating PKC-
-dependent cellular events.
| MATERIALS AND METHODS |
|---|
|
|
|---|
and myelin basic protein (MBP) were from Upstate Biotechnology (Charlottesville, VA, USA). The hBVR-derived peptides KKRILHC (aa 275–281) and KYCCSRK (aa 290–296), in both unmodified and N-myristoylated form, were from EZBiolab (Westfield, IN, USA). The C to A variant KKRILHA of KKRIKHC, the K to A variant KYCCSRA of KYCCRSK, and KRNRYLSF (aa 224–231) and KRNRYLAF were from SynPep (Dublin, CA, USA). The specific PKC-
peptide substrate SIYRRGSRRWRKL came from Biosource (Camarillo, CA, USA), while the myristoylated pseudosubstrate SIYRRGARRWRKL (PKC-
aa 113–125) was from EMD Biochemicals (San Diego, CA, USA). PKC-
-based peptides, essential for the activation of the kinase PKC
-281 (DQIYAMKVVKKE), PKC
-410 (GDTTSTFCGTPN), PKC
-560 (EPVQLTPDDEDA), and PKC
-585, (EFEGFEYINPLLL) were synthesized by Anaspec Inc. (San Jose, CA, USA). TNF-
was obtained from Calbiochem (La Jolla, CA, USA). L-
-Phosphatidyl-L-serine and adenosine 5'-triphosphate (ATP) were from Sigma (St. Louis, MO, USA). [
-32P]-ATP and [32P]-orthophosphate were purchased from Perkin-Elmer (Wellesley, MA, USA). Polyclonal anti-PKC-
antibody was from Abgent (San Diego, CA, USA), and rhodamine red-x-conjugated donkey anti-rabbit IgG antibody was from Jackson Immunoresearch Laboratories (West Grove, PA, USA). Anti-hBVR polyclonal antibodies were obtained as described previously (36)
Plasmids and mutants
Plasmids encoding the BVR mutants G17
A, S21
A, S44
A, S149
A, S230
A, S149,230
A, A and C281,292,293
A, A, A and the V11–14G17
A11–14, A17 mutant were generated by site directed mutagenesis of wt hBVR cDNA clone (4)
. Mutants were made in both pGEX-4T2 and pcDNA3 expression vectors.
The plasmid pCO2-PKC-
(a generous gift from Dr. P. Parker, London Research Institute, London, UK) was used as starting material to subclone the open reading frame into both pcDNA3 and pGEX-4T2. A kinase-inactive form was made for each version by site-directed mutagenesis changing the essential lysine in the ATP binding site (K281) to arginine.
Measurement of PKC-
activity in vitro
PKC-
was assayed in vitro using 5 ng of purified enzyme in a 50 µl assay containing 20 mM MOPS pH 7.2, 15 mM MgCl2, and 0.2 mM EDTA. Depending on the experiment, 1.6 µM hBVR and/or 12.5 µM MBP were used as the substrate. The hBVR-derived peptides were used at a concentration of 10 µM. The reaction was started by the addition of 100 µM ATP labeled with 10 µCi [
-32P]-ATP. hBVR and its mutants were preincubated for 5 min at room temperature with PKC before MBP addition. The reaction lasted 15 min at 30°C. When hBVR was used as the substrate, the incubation period was 20 min, unless mentioned otherwise. The reaction was terminated on ice either by the addition of Laemmli buffer, followed by SDS-PAGE and transfer to PVDF membrane and autoradiography or by the addition of 1 volume of 10% phosphoric acid for the P81 phospho-cellulose binding assay as described by Maines et al. (35)
.
PKC-βII activity in vitro
PKC-βII kinase activity was assayed in vitro as recommended by the manufacturer (Calbiochem) and as described previously (35)
.
BVR kinase assay in vitro
The assay was performed as described previously (7)
. hBVR, purified from E. coli (0.04 µM), was incubated with purified recombinant PKC-
(100 ng) as substrate in a 50 µl kinase assay containing 50 mM HEPES (pH 8.4), 30 mM MnCl2, and 0.2 mM DTT. The reaction was started with the addition of 10 µM ATP labeled with 10 µCi [
-32P]-ATP and was stopped after 60 min by the addition of Laemmli buffer. Samples were subjected to SDS-PAGE, transferred to membrane, and autoradiographed.
hBVR reductase activity assay
hBVR activity was measured at pH 6.7 in the presence of NADH as described before (2)
.
Cell culture and transfection
HEK293A cells were grown in Dulbeccos modified Eagles medium (Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum and 1% penicillin-G/streptomycin for 24 h until they reached 70% of confluency. Cells were subsequently transfected, depending on the experiment, with up to 5 µg of pcDNA3-hBVR or pcDNA3-PKC-
plasmid using Transfectin (Bio-Rad, Hercules, CA, USA) in 10 cm plates. In experiments using small interfering RNA (siRNA) for hBVR, viruses containing pSuper-siBVR or schBVR (control) were grown and packaged as described elsewhere (2
, 35)
; cells were infected with 4 plaque-forming units/cell. The introduction of BVR-derived peptides into cells was accomplished using a myristoylated form or by use of the Chariot protein delivery reagent (Active Motif, Carlsbad, CA, USA).
Metabolic labeling and immunoprecipitation
After 44 h of starvation of HEK293A cells, media were replaced with phosphate free medium containing 100 µCi/ml [32P]-H3PO4 for an additional 4 h. The radioactive medium was replaced with serum-free medium for an additional 1 h before treatment with TNF-
(20 ng/ml). At various times after the treatment, cells were collected and lysed in RIPA buffer (50 mM Tris-HCl, pH 7.4; 150 mM NaCl; 1 mM EGTA; 0.25% Na-deoxycholate; 1% Nonidet P-40; 1 mM NaF; 1 mM Na3VO4; 1 mM PMSF; and 1 µg/ml each aprotinin and leupeptin) and pepstatin and immunoprecipitated with polyclonal anti-hBVR or anti-PKC-
antibodies or with nonimmune IgG. Immunoprecipitates were separated by SDS-PAGE, and proteins were blotted to the PVDF membrane and autoradiographed.
GST-pull-down assay
The assay was performed as described previously (35)
. Briefly, cells transfected with pcDNA3-PKC-βII or pcDNA3-PKC-
plasmids were starved, treated with PMA (100 nM) for 15 min, and lysed in lysis buffer (50 mM Tris/HCl, pH 7.4; 1% Triton-X-100; 150 mM NaCl; 100 mM EDTA; and 10% glycerol proteinase inhibitor mixture). The cell lysates were mixed with 10 µg of GST-hBVR or with glutathione-S-transferase (GST) alone for 1–2 h at 4°C. After four washes in lysis buffer, proteins from the beads were subjected to SDS-PAGE and immunoblotting.
PKC assay in situ
The Williams and Schrier (37)
method was modified using PKC-
-specific substrate (SIYRRGSRRWRKL). Cells seeded into 48-well plates were transfected with either 0.3 µg/well of pcDNA3-hBVR, a mutant construct hBVRC281,292,293A, or with pcDNA3-PKC-
. Twenty-four hours later, cells were starved in 0.5% FBS medium for an additional 24 h. Cells were pretreated for 1 h with the myristoylated peptides KKRILHC (aa 275–281) and KYCCSRK (aa 290–296) or with KRNRYLSF (aa 224–231) or its mutant KRNRYLAF, which were introduced using Chariot transfection reagent. After treatment with TNF-
(20 ng/ml, 15 min), cells were washed with PBS and treated with 50 µl of kinase assay buffer, as described earlier. The reaction was stopped with the addition of 20 µl of ice-cold 25% (w/v) trichloroacetic acid on ice. Samples from the TCA-soluble fraction were transferred to P81 phospho-cellulose filters and were washed sequentially with 75 mM phosphoric acid and 2.75 mM NaPO4 buffer (pH 7.5), followed by liquid scintillation counting. Kinase activity was normalized to protein content.
Luciferase assay
Transfection of HEK293A cells in 24-well plates used, per well 0.3 pcDNA3-PKC-
, plasmid pNF-
B (0.4 µg), pCMV β-galactosidase (0.1 µg), and pcDNA3-hBVR (0.3 µg). Cells were pretreated with myristoylated PKC-
specific PS and inhibitory peptide (5 µM) and treated with TNF-
(20 ng/ml). After 6 h, treated cells were washed and assayed for luciferase activity using a commercial substrate (Promega, Madison WI, USA). β-Galactosidase activity was used to assess transfection efficiency, and the luciferase activity was normalized against β-galactosidase.
Electrophoretic mobility shift assay (EMSA)
Cells were transfected with empty vector or with pcDNA-hBVR. Twenty-four hours after DNA addition, the medium was replaced with one containing 0.5% serum for a further 36 h, after which some cells were treated with 20 ng/ml TNF-
for 30 min. The cells were then harvested and washed with PBS, and a crude nuclear preparation was homogenized in 10 mM HEPES pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT. The homogenate was adjusted to 20 mM HEPES pH 7.9, 25% glycerol, 0.4 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM PMSF, 10 mM KCl, and 0.5 mM DTT and incubated on ice for 30 min followed by 20 min centrifugation at 10,000 g at 4°C. Equal amounts of supernatant protein (usually 15 µg) were incubated with a 32P-labeled double-stranded oligonucleotide AGTTGAGGGGACTTTCCCAGGC containing the NF-
B binding site (Promega), with or without the addition of antibody to the p65 subunit of NF-
B (Santa Cruz Biotechnology, Santa Cruz, CA, USA). DNA-protein complexes were resolved by electrophoresis on a 4% nondenaturing polyacrylamide gel.
Confocal microscopy
HEK293A cells were grown in a chamber slide system (Nalgene Nunc International Corp., Naperville, IL, USA) and transfected with either pcDNA3-PKC-
or pEGFP-hBVR or both. To test the effect of the hBVR peptide KRNRYLSF (10 µM) or one of the myristoylated KKRILHC or KYCCSRK peptides, they were added to cells previously transfected with PKC-
. After a 24 h starvation period, cells were treated with TNF-
(20 ng/ml) for 15 min. Cells were fixed in formaldehyde, permeabilized with 1% Triton-X, and treated with rabbit anti-PKC-
antibody, followed by rhodamine-red-x-conjugated antibody to rabbit IgG. hBVR was visualized by GFP-Tag. A Leica TCS SP, model DMRE, confocal microscope was used to examine the treated cells.
Identification of hBVR phosphorylated residues in oxidative stress stimulated cells
HEK293A cells overexpressing flag-hBVR were treated with H2O2 (20 min, 40 µM) and lysed in modified RIPA buffer as described previously (6)
. The lysates were immunoprecipitated with FLAG antibody conjugated to protein A beads. The beads were washed twice in lysis buffer, twice in 500 mM LiCl in Tris buffer (pH 7.5) containing 0.1% Triton-X-100 and then twice in Tris buffer. The material was subjected to SDS-PAGE and stained with Coomassie blue (Bio-Rad). The stained protein was excised, subjected to hydrolysis with trypsin, and analyzed with a matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrophotometer at either WEM Biochem (Toronto, Canada) or the University of Rochester.
| RESULTS |
|---|
|
|
|---|
and hBVR are both kinases involved in the regulation of glucose uptake (7)
hBVR activates PKC-
in vitro
As it was previously shown that hBVR can activate PKC-βII (35)
, presently, whether this phenomenon extends to PKC-
was examined. The initial experiment examined phosphorylation of GST-purified hBVR by PKC-
(Fig. 1
a). Under PKC-
optimal assay conditions, phosphorylation of hBVR was markedly increased. Moreover, under those assay conditions, hBVR displayed minimum autophosphorylation, suggesting that incorporation of 32P into hBVR is predominantly due to PKC-
activity. Autophosphorylation of PKC-
significantly increased in the presence of hBVR when compared to the enzyme alone. To confirm that BVR phosphorylation is due solely to PKC-
activity, a PKC-
-specific inhibitor, PKC-
pseudosubstrate peptide (PS), was used as a negative control. As shown in the figure, in the presence of the PS (lane 2), the phosphorylation of both enzymes was markedly suppressed. To further address the specificity of the assay, a "kinase dead" (KD) hBVR construct was made by replacing the N-terminal Val11–14 and Gly17 with alanine residues. As previously shown (35)
, mutations in this segment of the protein render hBVR incapable of binding ATP and phosphorylation activity. Similar results were obtained using the hBVR-KD mutant, i.e., Fig. 1a
. PKC-
phosphorylated hBVR, while autophosphorylation of PKC-
was increased.
|
Next, the effect of Co-PP, an activator of hBVR (35
, 38)
, on the augmentation of PKC-
kinase activity by hBVR was examined. Co-PP (Fig. 1c
) suppressed both PKC-
autophosphorylation and hBVR phosphorylation by PKC (5 and 30 min). Since Co-PP suppressed PKC-
autophosphorylation in the absence of hBVR, this observation suggests that Co-PP binds not only to hBVR as shown earlier but also to the PKC-
, thereby suppressing its kinase activity. The interaction of hBVR with the metalloporphyrin may induce conformational changes in the protein, which hinders its association with PKC-
. Since hBVR is a kinase, it was tested for its ability to phosphorylate PKC-
. Under assay conditions that favor hBVR kinase activity, in the presence of hBVR, PKC-
was not phosphorylated (Fig. 1d
). This is unlike the previous observation to PKC-βII (35)
, which is presently confirmed (Fig. 1e
). Under these conditions, PKC-βII phosphorylation is increased. Similarly, peptides derived from the activation loop of the PKC-
autophosphorylation site were a poor substrate for hBVR (data not shown), suggesting that PKC-
is not a substrate for hBVR.
To determine whether the increased phosphorylation of PKC-
in the presence of hBVR would increase the activity of PKC-
toward other substrates, the effect of hBVR on PKC-
-dependent phosphorylation of MBP was tested. hBVR caused a severalfold increase in MBP phosphorylation by PKC-
, when compared with PKC alone (Fig. 1f
), while hBVR alone did not phosphorylate MBP, suggesting that the role of hBVR is to increase PKC-
activity. Because phosphatidyl serine is known to stimulate the activity of PKC-
, the effects of hBVR and the phospholipid on PKC-
activity were compared. The presence of hBVR increased basal as well as phosphatidyl serine-dependent activation of PKC-
(Fig. 1g
). The observation suggests that hBVR-mediated activation of PKC-
is independent and different from that of phophatidylserine.
The core consensus phosphorylation motifs for PKC substrates are RXXS, T/SXRX (39)
; one such motif is present in the hBVR molecule at R227YLS. Thus, S230 is predicted to be a phosphorylation target for PKC-
, which overlaps with a candidate SH2 binding signal in hBVR, YLSF. This possibility was examined using mass-spectrometric analysis of hBVR obtained from HEK293 cells over expressing Flag-hBVR with and without H2O2 treatment (0.04 mM, 20 min). Several peptides were identified in the H2O2-treated sample as containing phosphorylated amino acids, including AGSVRM, AFLNLIGFVS, ELLKGSL, and YLSFHFK. The molecular weight of the peptides indicated incorporation of 1 and 2 phosphate groups, as indicated. The italicized residues correspond to hBVR, S21, S44, S149, Y228, and S230, respectively; none of these peptides in the untreated sample contained phosphate groups. These residues are an addition to the previously identified hBVR phosphorylation site Y198 in the YMXM motif (7)
. RAGS21VRMRDL sequence shows a close similarity to the PKC-
-specific substrate sequence R115RGSRRWRKL and resembles the PKC-
PS that maps to the regulatory region of the protein, while the S44R/KR domain is predicted to be a phosphorylation site of PKCs. Altogether, this suggests that those sites may be phosphorylated in vitro and may be relevant to hBVR signaling in cells.
To address the question of the PKC-
target site in hBVR, in vitro experiments were performed on a series of mutant hBVR proteins carrying serine to alanine replacements. Each serine residue is in a sequence context that partially matches the consensus PKC-
target. Mutations at S21 and S44 resulted in no apparent change in 32P incorporation (Fig. 1h
). On the other hand, the S149 mutant resulted in a modest reduction in incorporation of
30%, while the S230 mutant incorporated 60% less radioactivity than did the wild type(P
0.01, vs. wt hBVR). The double mutant, S149S230, incorporated the least 32P (P
0.01, vs. wt hBVR), no more than 15% of the wild type, suggesting that these two residues are the primary targets for PKC-
.
TNF-
stimulated intracellular interaction of PKC-
and hBVR
To address the question of whether interaction of PKC-
and hBVR seen in vitro might also occur in the cell, HEK293A cells were cotransfected with plasmids containing PKC-
and hBVR and were examined for binding and phosphorylation in response to TNF-
. After TNF-
stimulation, cell lysates were immunoprecipitated with antibodies to PKC-
, revealing the presence of hBVR in the precipitate (Fig. 2
a), and by extension, interaction of the proteins in the cell. This interaction required activation by TNF-
, since hBVR was not observed in the immunoprecipitates from nontreated cells. Consistent with the previous observation (35)
, unlike PKC-βII, PKC-
did not coprecipitate with hBVR in PMA-treated cells (Fig. 2b, c
). Because the activation of both proteins is dependent on phosphorylation (6
, 7
, 35
, 40)
, we tested the phosphorylation status of hBVR and PKC-
upon treatment with TNF-
. Starved cells were metabolically loaded with 32P-orthophosphate and treated with TNF-
, and the cell extracts were immunoprecipitated with anti-PKC-
or anti-BVR antibodies. In each instance, a transient phosphorylation of the proteins occurred (Fig. 2d
), with phospho-PKC-
peaking at 5 min and returning to near basal level after 45 min. On the other hand, BVR phosphorylation, which also peaked at 5 min, was still somewhat above basal level after 45 min.
|
Activity of PKC-
in cells is enhanced by hBVR and requires the hBVR ATP-binding site
To address the possibility that stimulation of kinase activity might occur in intact cells, HEK293A cells were transfected with either pcDNA3-PKC-
or the kinase-inactive pcDNA3-PKC-
K281R. Treatment with TNF-
led to the stimulation of PKC activity in cells expressing PKC-
(Fig. 3
a, b) but not in those expressing PKC-
K281R (Fig. 3a
, empty bars). Cotransfection of the cells with pcDNA3-hBVR significantly (P
0.01, vs. TNF-
) increased PKC activity in TNF-
treated cells, whereas this activation was not observed in the cells expressing the PKC-
K281R, validating the assay (Fig. 3a
, empty bars). On the other hand, infecting the cells with a virus expressing siRNA hBVR reduces the PKC-
kinase activity to nearly that seen in cells expressing PKC-
K281R (P
0.01, TNF-
vs. sihBVR and TNF-
). The inhibitory action of the virus was not observed using scrambled siRNA hBVR construct. Furthermore, although the stimulation with TNF-
led to an increase in PKC activity, the increase was substantially reduced in comparison to uninfected cells (Fig. 3a
, lane 3 vs. lane 1). This implies that transfection did not abolish all of the basal level, because 84% of basal activity remained. To address the specificity of the assay, a myristoylated form of PKC-
-PS was added to cells 1 h before the treatment with TNF-
. As indicated in Fig. 3a
, lane 4, PS presence brought TNF-
-dependent PKC-
activity to baseline (P
0.01, vs. TNF-
only).
|
To determine which region(s) of the hBVR molecule might be of importance in this activation, hBVR molecules, which bore a point mutation in the ATP binding site (G17
A), and in each of the candidate PKC-
target sites (S149
A, S230
A), were tested in the in situ assay. None of these proteins stimulated the activity of the endogenous PKC above the basal level (Fig. 3b
). Moreover, these mutants completely inhibited TNF-
stimulation, indicating a negative effect on PKC-
signaling in the cell (P
0.01, vs. TNF-
only). Since the kinase activity of wt hBVR is minimal under the conditions of the reaction and since the G17 mutant is kinase dead, it is apparent that the mechanism by which hBVR stimulates PKC-
in the cell includes hBVR as both a substrate for the enzyme and as a kinase-competent protein.
Activation and inhibition of PKC-
activity by hBVR-based peptides
The C-terminal 17 residues of hBVR, a cysteine rich domain, are similar to the C1 regulatory domain of PKC-
. Because of the possibility that this domain could be involved in regulating PKC-
, the effects of hBVR-derived peptides KKRILHC281 and KYCCSRK296, as well as a peptide KRNRYLS230F, derived from the PKC-
substrate domain of hBVR on PKC-
activity were examined.
Cells transfected to overexpress PKC-
were treated with KRNRYLS230F, KRNRYLA230F, KKRILHC281, KKRILHA281, KYCCSRK296, or KYCCSRA296 peptides. The KRNRYLS230F and KKRILHC281 peptides brought PKC-
activity nearly to the basal level in the in situ assay (Fig. 4
a; P
0.01, vs. TNF-
), whereas the KYCCSRK296 peptide increased TNF-
-dependent induction of PKC-
activity almost to the level of wt hBVR (P
0.001, vs. TNF-
, Fig. 4a
). The Ser230, Cys281, and Lys296 in their respective peptides seem to be important, since their replacement with alanine (A) reversed the effect of these peptides on PKC-
activity.
|
To further examine the C-terminal end of the hBVR molecule, a mutant construct in which three cysteine residues located near the C terminal of hBVR were replaced by alanine (C281,292,293A) was used. This cysteine hBVR mutant failed to activate PKC-
to the extent of the wild-type hBVR, regardless of treatment with TNF-
(Fig. 4b
).
The observations with hBVR peptides in the intact cells were further examined in in vitro experiments. The KRNRYLS230F peptide failed to activate PKC-
as BVR does (Fig. 4c
, lane 3). Peptide KKRILHC281 bears some resemblance to a sequence located between the activation loop and autophosphorylation site of PKC-
and shares the physical characteristics of the highly basic PS region of PKC-
and -
. This peptide caused a nearly complete inactivation of the kinase (Fig. 4c
, lane 4; P
0.001, vs. PKC-
). An otherwise identical peptide that contains alanine in place of cysteine (KKRILHA281) failed to inhibit the kinase. Conversely, a second cysteine containing peptide, KYCCSRK296, stimulated PKC-
in vitro (Fig. 4c
, lane 6; P
0.001, vs. PKC-
). However, a variant of this peptide, in which the C-terminal lysine is replaced by alanine, KYCCSRA296, had no significant effect.
Kinase activity of hBVR is also affected by hBVR-based peptides
As was seen for PKC-
, KKRILHC281 strongly suppressed the incorporation of 32P into hBVR, whereas the KYCCSRK296 peptide enhanced the autophosphorylation of the reductase in vitro (Fig. 5
). However, unlike the observation for PKC-
in vitro, the KRNRYLS230F peptide suppressed autophosphorylation of hBVR (Fig. 5)
.
|
TNF-
-stimulated membrane localization of PKC-
is blocked by inhibitory hBVR-based peptides
In light of the effect of the peptides KRNRYLS230F, KKRILHC281, and KYCCSRK296 on PKC-
activity in cells, we examined whether the presence of these peptides affected the intracellular distribution of PKC-
. Cells transfected with PKC-
were starved, treated with TNF-
or with TNF-
plus the peptides, and then subjected to confocal microscopy (Fig. 6
a–e). The distribution of PKC-
was examined by red fluorescence of rhodamine red-x-conjugated secondary antibody (Fig. 6a-e
). The ratio of cytoplasmic and membraneous localization of PKC-
corresponding to the transfected peptide was obtained and is presented as a bar graph in Fig. 6f
. In untreated cells, the PKC-
is uniformly distributed (in
90% of cells) throughout the cytoplasm (Fig. 6a
); as expected after TNF-
treatment, the PKC rapidly translocated to the plasma membrane in nearly 60% of cells (b). In the presence of KRNRYLS230F or KKRILHC281 peptides subsequent to TNF-
treatment, PKC-
remained distributed throughout the cytoplasm (Fig. 6c, d
). The myr-KYCCSRK296 peptide did not hinder TNF-
-dependent PKC-
translocation (Fig. 6e
) in transfected cells, which accounted for
70% of cells.
|
TNF-
-dependent induction of NF-
B is mediated by PKC-
and is enhanced by hBVR
Because activation of PKC-
is essential for signal transduction by the NF-
B signaling pathway, whether hBVR-mediated activation of PKC-
influenced signal activity of the transcription factor was examined. For this, NF-
B promoter elements linked to a luciferase reporter were used. A strong NF-
B induction was observed in TNF-
-treated cells (Fig. 7
a). As predicted, the magnitude of increase nearly doubled when hBVR was over-expressed in the cells (P
0.01, vs. TNF-
) and was strongly suppressed when the inhibitory PKC-
PS was added to the cells (P
0.01, vs. TNF-
), indicating a strong dependence of NF-
B induction on PKCs. hBVR mutants that suppressed TNF-
-dependent PKC-
activity (G17
A, S149
A, S230
A) were tested for their effect of NF-
B promoter reporter. As depicted in Fig. 7a
, the three mutants were ineffective in enhancing TNF-
-mediated NF-
B promoter activity.
|
To further examine the role of BVR in activation of NF-
B during TNF-
treatment, nuclear extracts from cells treated with TNF-
, and/or transfected with hBVR, were used to measure protein binding to the NF-
B recognition sequence. As shown in Fig. 7b
, extracts from cells overexpressing hBVR and treated with TNF-
showed enhanced binding to the oligonucleotide when compared to those from control cells treated with TNF-
. The specificity of the binding is indicated by a supershift with an antibody to the p65 subunit of NF-
B, and the intensity of the supershifted signal is also enhanced in cells overexpressing hBVR. It was of interest to examine whether TNF-
also activates hBVR; hBVR kinase and reductase activities are linked (6
, 35)
. As shown in Fig. 8
a, treatment of the cell with TNF-
caused a transient increase in the catalytic activity of hBVR, peaking at 30 min and returning to the basal level thereafter. Moreover, as with PKC-
, hBVR cellular localization was altered by TNF-
treatment (Fig. 8b-e
). In
80% of untreated cells, green fluorescent-tagged hBVR, the protein was found dispersed throughout the cytoplasm (Fig. 8b
); upon TNF-
treatment, in
45% of cells, hBVR was predominantly localized to the nucleus, and associated with the cell membrane (Fig. 8c
). hBVR membrane localization was confirmed in cells cotransfected with PKC-
and treated with TNF-
(Fig. 8d
). In those cells, the yellow fluorescence of the merged image of the red fluorescence associated with the PKC-
membrane located (Fig. 8c
) and green fluorescence of GFP-hBVR substantiates the hBVR membrane localization (Fig. 8d
). Figure 8f
depicts the numerical percentage distribution of hBVR in the cytoplasm, nucleus, and cell membrane ±TNF-
treatment. As shown in the absence of TNF-
, hBVR is predominantly found in the cytoplasm. Upon the addition of the cytokine, a high percentage of the protein is found in the nucleus and associated with the cell membrane.
|
| DISCUSSION |
|---|
|
|
|---|
and hBVR that is initiated in response to TNF-
and potentially extends to other extracellular stimuli and activators of the two kinases. The aPKCs, including PKC-
and PKC-
/
, are essential components of cell growth, differentiation, and survival (41)
acts downstream of PI3K (42)
/
, is required for maximal insulin-stimulated protein synthesis and glucose uptake (43)
that links the PKC to MAPK and insulin receptor (IR)/insulin-like growth factor-1 (IGF-1). The aPKCs are known to be rather undiscriminating in their selection of phosphorylation targets (3)
kinase by TNF-
and that the interaction between the two proteins is dependent on prior activation of PKC-
. The present findings that PKC-
:hBVR interaction occurred subsequent to TNF-
stimulation, but not in response to PMA, whereas as noted before, interaction of hBVR with PKC-βII, but not with PKC-
, is promoted by PMA stimulation, which suggests stimulation-specificity-dependent interaction of hBVR with PKC enzymes (35)
(35)
We reason that the augmentation of PKC-
activity in the presence of hBVR is not the result of hBVR phosphorylating the PKC, because under assay conditions that do not support hBVR kinase activity, stimulation of the PKC kinase activity is observed. In this respect, there is a distinct difference between hBVR interaction with the classical subfamily of PKCs and with the aPKC-
. hBVR is a kinase for PKC-βII phosphorylation and appears to target the threonine residue in the activation loop of the PKC, resulting in an increased autophosporylation of the PKC-βII (35)
.
The mechanism responsible for the activation of PKC-
remains largely unknown. Also, the full complement of the PKC-
interactive/binding proteins and how they serve to link this kinase with the network of signaling cascades and the intracellular trafficking of the PKC are not well understood. Protein:protein interaction, however, is considered an important determinant of cellular localization of the activated PKC-
(44)
. The interaction of PKC-
with only one scaffold/adaptor protein p62, also known as zeta interacting protein (ZIP), has been reported and is considered essential for intracellular targeting of the kinase and the activation of kinases in the signal transduction pathways that primarily control cell growth (45)
. Based on the present finding of hBVR:PKC-
interaction, colocalization of the two proteins in the plasma membrane, and the structural features of hBVR, it is reasonable to consider that hBVR is an adaptor protein for PKC-
and potentially an adapter protein linking PKC-
to cytokine and PTK receptors. Finding that Co-PP, an established activator of hBVR kinase and reductase activities (35
, 38)
, attenuates the magnitude of hBVR-mediated activation of PKC-
by TNF-
is consistent with the likelihood that the secondary conformation of hBVR is important in its modulation of PKC activity and by extension protein:protein interaction. Alternatively, Co-PP could inhibit most robust autophosphorylation of PKC-
and indirectly phosphorylation of hBVR. To date, only a few PKC-
adaptor proteins have been uncovered, and their potential as targets for anti-inflammatory and anticancer therapy has been suggested (46)
.
TNF-
-mediated reactive oxygen species (ROS) -generated regulation of signaling pathways that activate AP-1 and NF-
B transcriptional activity is well documented (47)
. In turn, the likely mechanisms controlling cell growth and differentiation by TNF-
involve PKC-
(41
, 47)
. Inflammatory cytokines are among the activators of PKC-
and PKC-mediated generation of ROS, the second messenger for transcriptional activation of AP-1/ATF-related oxidative stress response genes and NF-
B activation (48)
. PKC-
is required for NF-
B interaction; in fact, activation of the NF-
B family of transcriptional factors is a key component of inflammatory and immune response of the cell and results from the phosphorylation and subsequent proteosomal degradation of the I
B
inhibitor kinase (49
, 50)
. After release from I
B
, NF-
B directly interacts with PKC-
(51)
. Based on the findings of this study, we suggest two possible mechanisms by which hBVR promotes NF-
B activation of the two mechanisms, separate, yet linked; one involves TNF-
activation of hBVR and a subsequent activation of PKC-
, and the other involves the potentiation of NF-
B reporter activity in response to TNF-
. The possibility that the kinase activity of hBVR may play a more direct role in the activation of NF-
B in the context of I
B activity cannot be ruled out.
Because of the central role of PKC-
in inflammatory response and cell growth, the intriguing finding that short fragments of hBVR, devoid of kinase activity, can enhance or block PKC-
phosphotransferase activity is a potentially noteworthy discovery. Clearly, all of the hBVR-based peptides tested in the present study directly interact with PKC-
. KRNRYLS230F and KKRILHC281 inhibited PKC-
activation by TNF-
, whereas the replacement of the serine (S230) or cysteine (C281) residue with alanine prevented the inhibitory PKC-
response in the cell. In the case of the 7 residue activating peptide, the key residues for the activation were traced to the last lysine residue in the peptide. This observation is interpreted to suggest the involvement of the lysine residue in the stabilization of ATP:PKC. Notably, in all protein kinases, an invariant lysine residue directly interacts with ATP and, through a salt bridge with an invariant glutamate located in subdomain III, stabilizes its interaction with ATP. Moreover, the invariant lysine is responsible for the correct folding of the ATP-binding pocket (52)
. This reasoning is supported by the finding that when the lysine-containing peptide is present, an increase in phosphotransferase activity of PKC-
is observed in vitro in the absence of another protein (Fig. 1a, b
). This finding extends to PKC-βII (35)
. The finding that the transfer of phosphate to PKC-
substrate is facilitated in the cell treated with the peptide is further supportive of the suggestion (Fig. 4a
). Certainly, the possibility that interactions in the cell may promote recruitment of other activators cannot be dismissed. This reasoning is further supported by the finding that point mutations introduced into the ATP interactive motifs of hBVR, i.e., G17, and at S149 in the S/T kinase consensus sequence, block hBVR augmentation of PKC-
activation by TNF-
.
S230 is not in the kinase domain of hBVR; however, the enhancement by hBVR of TNF-
-dependent activation of PKC-
in the cell clearly has a requirement for this serine residue (Fig. 3b
). Based on the finding that in the cell but not in vitro, the S230 containing eight residue peptides was an effective inhibitor of PKC-
activation by TNF-
, we suggest the function of the residue in hBVR is in the activation by IRK. The phosphorylated tyrosine residues in the Y228LSF and Y198MKM motifs are selective binding and assembly sites for regulatory proteins with a Src homology domain and, as such, produce an optimum site for the assembly of multiprotein complexes (28
, 53
, 54)
. The Y198 and Y228 residues in hBVR are phosphorylation targets of IRK (7)
. It follows that the activation of the aPKC-
and -
/
by growth factors regulating cell proliferation is dependent on the activation of the Src signaling pathway (44
, 55)
.
The profound inhibitory effect of the peptide (KKRILHC281) on PKC-
activity is at odds with the activation observed with the intact protein. The observed loss of its function, after substituting the cysteine residue with alanine, points to the essential function of the cysteine. An explanation for this disparity is found by analyzing the predicted crystal structure of BVR. The solved crystal structure of rat BVR (21
, 22)
indicates that for the intact protein this cysteine residue is not surface-accessible and therefore cannot interact with any other molecule. On the other hand, in an isolated peptide it would be accessible and consequently be capable of forming a disulfide bond with a cysteine residue in the regulatory C1 domain of PKC-
. The neutral pH of the kinase assay system and in the cell would not suppress formation of the disulfides in the cell. In the cell, however, the peptide may also interact with other components, a possibility that cannot be dismissed.
We propose that the carboxyl-terminal 17 residues of the 296 amino acid hBVR polypeptide prominently figure in hBVR modulation of PKC-
activity. Within this segment, there are three cysteines and an invariant histidine, His280Cys281,291,292, with reactive sulfhydryl groups (4
, 5
, 8)
. In the conventional and nonconventional types of PKCs, two cysteine-rich regions, C1 and C2, are present in the regulatory domain, while for the aPKCs, the Ca-dependent, phospholipid binding C2 domain is absent and hence insensitive to Ca2+ and diacylglycerol (56
, 57)
. Within the cysteine-rich regions of PKC-
, as well as within and proximal to the cysteine-rich region of hBVR, there are four Asn and Gln residues with reactive carbonyl groups. Activators of PKCs, all of which stimulate translocation of the kinases, hydrogen-bond the kinase to the sulfhydryl and the carbonyl groups of the kinase (58)
. We interpreted the noted requisite for PKC-
activation together with the neutralization of the hBVR stimulatory effect by the substitution of cysteine residues with alanine (C
A mutation). This replaces a hydrogen atom for a sulfhydryl side chain, suggesting the involvement of the reactive groups in the C terminus of hBVR in interaction with PKC-
, potentially through disulfide bond formation involving cysteine residues of the two proteins. Because the C281 residue is buried within the molecule in the intact protein, it is unlikely that mutation at this site is as critical as to those of the more available C292 or C293.
The stimulatory peptide KYCCSRK296, as revealed by the crystal structure, is for the most part surface-accessible in the intact protein and may be involved in the enhancement of PKC-
activity by the intact hBVR. This conclusion must be tempered with the observation that amino acids equivalent to human residues 295 and 296 are disordered in the crystal structure, although that in itself suggests they are in contact with solvent.
We propose a central role for hBVR in control of cellular response to inflammatory and proliferative stimuli. Our finding that small hBVR-based peptides can dramatically decrease the magnitude of activation of PKC-
by tumor necrosis factor is highly relevant in attempts to define therapeutic targets in transformed tissue.
| ACKNOWLEDGMENTS |
|---|
| FOOTNOTES |
|---|
Received for publication March 15, 2007. Accepted for publication June 7, 2007.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
S. C. Young, M. V. Storm, J. S. Speed, S. Kelsen, C. V. Tiller, T. Vera, H. A. Drummond, and D. E. Stec Inhibition of biliverdin reductase increases ANG II-dependent superoxide levels in cultured renal tubular epithelial cells Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2009; 297(5): R1546 - R1553. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Lerner-Marmarosh, T. Miralem, P. E. M. Gibbs, and M. D. Maines Human biliverdin reductase is an ERK activator; hBVR is an ERK nuclear transporter and is required for MAPK signaling PNAS, May 13, 2008; 105(19): 6870 - 6875. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |