FASEB J. Integrated DNA Technologies
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.07-8544com.
(The FASEB Journal. 2007;21:3949-3962.)
© 2007 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Supplemental Data
Right arrow All Versions of this Article:
fj.07-8544comv1
21/14/3949    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lerner-Marmarosh, N.
Right arrow Articles by Maines, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lerner-Marmarosh, N.
Right arrow Articles by Maines, M. D.

Regulation of TNF-{alpha}-activated PKC-{zeta} signaling by the human biliverdin reductase: identification of activating and inhibitory domains of the reductase

Nicole Lerner-Marmarosh1, Tihomir Miralem1, Peter E. M. Gibbs and Mahin D. Maines2

University of Rochester School of Medicine and Dentistry, Department of Biochemistry and Biophysics, Rochester, New York, USA

2Correspondence: University of Rochester School of Medicine and Dentistry, Department of Biochemistry and Biophysics, 601 Elmwood Avenue, Rochester, NY 14642, USA. E-mail: mahin_maines{at}urmc.rochester.edu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Human biliverdin reductase (hBVR) is a dual function enzyme: a catalyst for bilirubin formation and a S/T/Y kinase that shares activators with protein kinase C (PKC) -{zeta}, including cytokines, insulin, and reactive oxygen species (ROS). Presently, we show that hBVR increases PKC-{zeta} autophosphorylation, stimulation by TNF-{alpha}, as well as cytokine stimulation of NF-{kappa}B DNA binding and promoter activity. S149 in hBVR S/T kinase domain and S230 in YLS230F in hBVR’s docking site for the SH2 domain of signaling proteins are phosphorylation targets of PKC-{zeta}. Two hBVR-based peptides, KRNRYLS230F (#1) and KKRILHC281 (#2), but not their S->A or C->A derivatives, respectively, blocked PKC-{zeta} stimulation by TNF-{alpha} and its membrane translocation. The C-terminal-based peptide KYCCSRK296 (#3), enhanced PKC-{zeta} stimulation by TNF-{alpha}; for this, Lys296 was essential. In metabolically 32P-labeled HEK293 cells transfected with hBVR or PKC-{zeta}, TNF-{alpha} increased hBVR phosphorylation. TNF-{alpha} did not stimulate PKC-{zeta} in cells infected with small interfering RNA for hBVR or transfected with hBVR with a point mutation in the nucleotide-binding loop (G17), S149, or S230; this was similar to the response of "kinase-dead" PKC-{zeta}K281R. We suggest peptide #1 blocks PKC-{zeta}-docking site interaction, peptide #2 disrupts function of the PKC-{zeta} C1 domain, and peptide #3 alters ATP presentation to the kinase. The findings are of potential significance for development of modulators of PKC-{zeta} activity and cellular response to cytokines.—Lerner-Marmarosh, N., Miralem, T., Gibbs, P. E. M., Maines, M. D. Regulation of TNF-{alpha}-activated PKC-{zeta} signaling by the human biliverdin reductase: identification of activating and inhibitory domains of the reductase.


Key Words: heme oxygenase • protein kinase C-{zeta}


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
THE PROTEIN KINASE C (PKC) FAMILY of S/T kinases plays crucial roles in cellular functions, including differentiation, development, and tumor promotion. PKC-{zeta} is an atypical PKC (aPKC) that is activated by inflammatory cytokines, e.g., tumor necrosis factor (TNF-{alpha}; ref. 1 ), insulin, and free radicals. The present study offers new insight into the workings of the PKC-{zeta}-centered network of signaling and argues for the intriguing possibility that human biliverdin reductase (hBVR) is an adapter protein for linking PKC-{zeta} to the TNF-{alpha} signaling cascade and NF-{kappa}B activation. Previous studies have shown that hBVR, like PKC-{zeta}, functions in mitogen-activated protein kinase (MAPK) and activator protein-1 (AP-1)/activating transcription factor (ATF) signaling (2) . NF-{kappa}B and the AP-1/ATF family of DNA binding factors are involved in inflammation and stress signaling. Activation of PKC-{zeta} is essential for transduction of signals by the NF-{kappa}B pathway (3) . BVR is an evolutionarily conserved soluble polypeptide composed of 296 residues in human (4 , 5) . hBVR was recently identified as a dual specificity S/T/Y kinase that shares with PKC-{zeta} an overlapping list of activators (6 , 7) .

In addition to kinase activity, hBVR catalyzes, in a unique pH/cofactor-dependent activity profile, the reduction of biliverdin, the product of heme oxidation by heme oxygenase (HO) -1 and HO-2 activity, to bilirubin and is a determinant of acute transcriptional response of HO-1 to stress signals (2 , 8 , 9) . Oxidation products of HO activity, CO, and bile pigments are biologically active and function in the regulation of inflammatory responses, cell signaling, and gene regulation (10 11 12 13 14 15) . BVR also regulates HO-1 and PKC activities by eliminating biliverdin, the negative feedback regulator of HO activity and a potent inhibitor of PKA and PKC activities (16) . Bilirubin, on the other hand, is a free radical chain breaking antioxidant and anti-inflammatory compound (17) .

Certain structural features found in hBVR resemble those of the aPKC-{zeta}. The aPKCs are structurally distinguished by having a single Cys-rich zinc finger domain (C1 region), which is the site of interaction with the pleckstrin homology (PH) domain of interacting/anchoring molecules (18 19 20) . Notably, the secondary structure of hBVR, inferred from the crystal structure of the rat BVR, includes a six-stranded β-sheet, allowing extensive interaction of the C-terminal helix with its N-terminal kinase domain (21 , 22) . In secondary structure, this resembles a PH domain that is a prototype for protein:protein interaction module; the domain has a highly divergent primary structure, yet a highly conserved secondary structure (23) . The primary structure of the C-terminal helix is Cys/His-rich, with a preponderance of charged residues (4 , 24) .

In addition to sharing the same activators and certain structural features, the kinases cross paths in the cell-signaling cascade. hBVR and PKC-{zeta} are downstream effectors of insulin-stimulated insulin receptor kinase (IRK) -phosphatidylinositol 3-kinase (PI3K) signaling (7 , 25) and participate in negative feedback control of insulin action through the phosphorylation of insulin receptor substrate (IRS) -1 (26 , 27) . IRS proteins 1 and 2 and hBVR are substrates and competitors for tyrosine phosphorylation by IRK (7) . hBVR contains two tyrosine phosphorylation sites in Y198MKM and Y228LSF consensus motifs that are the target of the Src homology domain (SH2) of signaling adaptor proteins (7 , 28) . PKC-{zeta} is a negative feedback control mechanism of IRS-1 activity and is recruited to the tyrosine phosphorylated IRS-1 in a heterodimeric complex with a partner protein ZIP (29 , 30) .

Considering the similarities between IRS-1 and hBVR, with respect to being a substrate for IRK and both having a SH2 domain docking site, it would seem reasonable to suspect hBVR:PKC-{zeta} interaction. There is, however, a major difference between hBVR and PKC-{zeta} with respect to kinase activity; PKC-{zeta}, like other aPKCs, is directly activated by acidic phospholipids, but unlike the classical and novel groups of PKCs, it is not activated by divalent metal ions, such as Ca2+ (25 , 31 , 32) . The hBVR kinase activity, on the other hand, is not activated by lipid components, and, as with other protein tyrosine kinases (PTKs), the kinase of hBVR is exclusively Mn2+ dependent (7 , 33 , 34) . This difference has been exploited here and elsewhere to parse the activities of hBVR from S/T kinases. We have demonstrated elsewhere (35) that hBVR is able to bind to and activate the classical PKC isoform PKC-βII in vitro and in vivo. The interaction of the two proteins in the cell is dependent on an appropriate stimulus for PKC-βII, i.e., phorbol myristate acetate (PMA). hBVR did not bind to the PKC-{zeta} isoform that is not activated by PMA in these cells.

Although PKC-{zeta} is distributed in many cell types, the full spectrum of its physiological functions, regulation, and substrates has not been elucidated. This study has revealed a previously unknown function of hBVR and a mechanism for regulation of PKC-{zeta} activity. The study has shown that hBVR and its peptides can function as kinase effector molecules. The significance of the findings relates to the pivotal role of PKC-{zeta} in cellular functions and signal transduction and offers new prospects for modulating PKC-{zeta}-dependent cellular events.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Materials
Recombinant human PKC-{zeta} and myelin basic protein (MBP) were from Upstate Biotechnology (Charlottesville, VA, USA). The hBVR-derived peptides KKRILHC (aa 275–281) and KYCCSRK (aa 290–296), in both unmodified and N-myristoylated form, were from EZBiolab (Westfield, IN, USA). The C to A variant KKRILHA of KKRIKHC, the K to A variant KYCCSRA of KYCCRSK, and KRNRYLSF (aa 224–231) and KRNRYLAF were from SynPep (Dublin, CA, USA). The specific PKC-{zeta} peptide substrate SIYRRGSRRWRKL came from Biosource (Camarillo, CA, USA), while the myristoylated pseudosubstrate SIYRRGARRWRKL (PKC-{zeta} aa 113–125) was from EMD Biochemicals (San Diego, CA, USA). PKC-{zeta}-based peptides, essential for the activation of the kinase PKC{zeta}-281 (DQIYAMKVVKKE), PKC{zeta}-410 (GDTTSTFCGTPN), PKC{zeta}-560 (EPVQLTPDDEDA), and PKC{zeta}-585, (EFEGFEYINPLLL) were synthesized by Anaspec Inc. (San Jose, CA, USA). TNF-{alpha} was obtained from Calbiochem (La Jolla, CA, USA). L-{alpha}-Phosphatidyl-L-serine and adenosine 5'-triphosphate (ATP) were from Sigma (St. Louis, MO, USA). [{gamma}-32P]-ATP and [32P]-orthophosphate were purchased from Perkin-Elmer (Wellesley, MA, USA). Polyclonal anti-PKC-{zeta} antibody was from Abgent (San Diego, CA, USA), and rhodamine red-x-conjugated donkey anti-rabbit IgG antibody was from Jackson Immunoresearch Laboratories (West Grove, PA, USA). Anti-hBVR polyclonal antibodies were obtained as described previously (36) . The Co-PP came from Porphyrin Products Inc. (Logan, UT, USA).

Plasmids and mutants
Plasmids encoding the BVR mutants G17->A, S21->A, S44->A, S149->A, S230->A, S149,230->A, A and C281,292,293->A, A, A and the V11–14G17->A11–14, A17 mutant were generated by site directed mutagenesis of wt hBVR cDNA clone (4) . Mutants were made in both pGEX-4T2 and pcDNA3 expression vectors.

The plasmid pCO2-PKC-{zeta} (a generous gift from Dr. P. Parker, London Research Institute, London, UK) was used as starting material to subclone the open reading frame into both pcDNA3 and pGEX-4T2. A kinase-inactive form was made for each version by site-directed mutagenesis changing the essential lysine in the ATP binding site (K281) to arginine.

Measurement of PKC-{zeta} activity in vitro
PKC-{zeta} was assayed in vitro using 5 ng of purified enzyme in a 50 µl assay containing 20 mM MOPS pH 7.2, 15 mM MgCl2, and 0.2 mM EDTA. Depending on the experiment, 1.6 µM hBVR and/or 12.5 µM MBP were used as the substrate. The hBVR-derived peptides were used at a concentration of 10 µM. The reaction was started by the addition of 100 µM ATP labeled with 10 µCi [{gamma}-32P]-ATP. hBVR and its mutants were preincubated for 5 min at room temperature with PKC before MBP addition. The reaction lasted 15 min at 30°C. When hBVR was used as the substrate, the incubation period was 20 min, unless mentioned otherwise. The reaction was terminated on ice either by the addition of Laemmli buffer, followed by SDS-PAGE and transfer to PVDF membrane and autoradiography or by the addition of 1 volume of 10% phosphoric acid for the P81 phospho-cellulose binding assay as described by Maines et al. (35) .

PKC-βII activity in vitro
PKC-βII kinase activity was assayed in vitro as recommended by the manufacturer (Calbiochem) and as described previously (35) .

BVR kinase assay in vitro
The assay was performed as described previously (7) . hBVR, purified from E. coli (0.04 µM), was incubated with purified recombinant PKC-{zeta} (100 ng) as substrate in a 50 µl kinase assay containing 50 mM HEPES (pH 8.4), 30 mM MnCl2, and 0.2 mM DTT. The reaction was started with the addition of 10 µM ATP labeled with 10 µCi [{gamma}-32P]-ATP and was stopped after 60 min by the addition of Laemmli buffer. Samples were subjected to SDS-PAGE, transferred to membrane, and autoradiographed.

hBVR reductase activity assay
hBVR activity was measured at pH 6.7 in the presence of NADH as described before (2) .

Cell culture and transfection
HEK293A cells were grown in Dulbecco’s modified Eagle’s medium (Invitrogen, Carlsbad, CA, USA) containing 10% fetal bovine serum and 1% penicillin-G/streptomycin for 24 h until they reached 70% of confluency. Cells were subsequently transfected, depending on the experiment, with up to 5 µg of pcDNA3-hBVR or pcDNA3-PKC-{zeta} plasmid using Transfectin (Bio-Rad, Hercules, CA, USA) in 10 cm plates. In experiments using small interfering RNA (siRNA) for hBVR, viruses containing pSuper-siBVR or schBVR (control) were grown and packaged as described elsewhere (2 , 35) ; cells were infected with 4 plaque-forming units/cell. The introduction of BVR-derived peptides into cells was accomplished using a myristoylated form or by use of the Chariot protein delivery reagent (Active Motif, Carlsbad, CA, USA).

Metabolic labeling and immunoprecipitation
After 44 h of starvation of HEK293A cells, media were replaced with phosphate free medium containing 100 µCi/ml [32P]-H3PO4 for an additional 4 h. The radioactive medium was replaced with serum-free medium for an additional 1 h before treatment with TNF-{alpha} (20 ng/ml). At various times after the treatment, cells were collected and lysed in RIPA buffer (50 mM Tris-HCl, pH 7.4; 150 mM NaCl; 1 mM EGTA; 0.25% Na-deoxycholate; 1% Nonidet P-40; 1 mM NaF; 1 mM Na3VO4; 1 mM PMSF; and 1 µg/ml each aprotinin and leupeptin) and pepstatin and immunoprecipitated with polyclonal anti-hBVR or anti-PKC-{zeta} antibodies or with nonimmune IgG. Immunoprecipitates were separated by SDS-PAGE, and proteins were blotted to the PVDF membrane and autoradiographed.

GST-pull-down assay
The assay was performed as described previously (35) . Briefly, cells transfected with pcDNA3-PKC-βII or pcDNA3-PKC-{zeta} plasmids were starved, treated with PMA (100 nM) for 15 min, and lysed in lysis buffer (50 mM Tris/HCl, pH 7.4; 1% Triton-X-100; 150 mM NaCl; 100 mM EDTA; and 10% glycerol proteinase inhibitor mixture). The cell lysates were mixed with 10 µg of GST-hBVR or with glutathione-S-transferase (GST) alone for 1–2 h at 4°C. After four washes in lysis buffer, proteins from the beads were subjected to SDS-PAGE and immunoblotting.

PKC assay in situ
The Williams and Schrier (37) method was modified using PKC-{zeta}-specific substrate (SIYRRGSRRWRKL). Cells seeded into 48-well plates were transfected with either 0.3 µg/well of pcDNA3-hBVR, a mutant construct hBVRC281,292,293A, or with pcDNA3-PKC-{zeta}. Twenty-four hours later, cells were starved in 0.5% FBS medium for an additional 24 h. Cells were pretreated for 1 h with the myristoylated peptides KKRILHC (aa 275–281) and KYCCSRK (aa 290–296) or with KRNRYLSF (aa 224–231) or its mutant KRNRYLAF, which were introduced using Chariot transfection reagent. After treatment with TNF-{alpha} (20 ng/ml, 15 min), cells were washed with PBS and treated with 50 µl of kinase assay buffer, as described earlier. The reaction was stopped with the addition of 20 µl of ice-cold 25% (w/v) trichloroacetic acid on ice. Samples from the TCA-soluble fraction were transferred to P81 phospho-cellulose filters and were washed sequentially with 75 mM phosphoric acid and 2.75 mM NaPO4 buffer (pH 7.5), followed by liquid scintillation counting. Kinase activity was normalized to protein content.

Luciferase assay
Transfection of HEK293A cells in 24-well plates used, per well 0.3 pcDNA3-PKC-{zeta}, plasmid pNF-{kappa}B (0.4 µg), pCMV β-galactosidase (0.1 µg), and pcDNA3-hBVR (0.3 µg). Cells were pretreated with myristoylated PKC-{zeta} specific PS and inhibitory peptide (5 µM) and treated with TNF-{alpha} (20 ng/ml). After 6 h, treated cells were washed and assayed for luciferase activity using a commercial substrate (Promega, Madison WI, USA). β-Galactosidase activity was used to assess transfection efficiency, and the luciferase activity was normalized against β-galactosidase.

Electrophoretic mobility shift assay (EMSA)
Cells were transfected with empty vector or with pcDNA-hBVR. Twenty-four hours after DNA addition, the medium was replaced with one containing 0.5% serum for a further 36 h, after which some cells were treated with 20 ng/ml TNF-{alpha} for 30 min. The cells were then harvested and washed with PBS, and a crude nuclear preparation was homogenized in 10 mM HEPES pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT. The homogenate was adjusted to 20 mM HEPES pH 7.9, 25% glycerol, 0.4 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM PMSF, 10 mM KCl, and 0.5 mM DTT and incubated on ice for 30 min followed by 20 min centrifugation at 10,000 g at 4°C. Equal amounts of supernatant protein (usually 15 µg) were incubated with a 32P-labeled double-stranded oligonucleotide AGTTGAGGGGACTTTCCCAGGC containing the NF-{kappa}B binding site (Promega), with or without the addition of antibody to the p65 subunit of NF-{kappa}B (Santa Cruz Biotechnology, Santa Cruz, CA, USA). DNA-protein complexes were resolved by electrophoresis on a 4% nondenaturing polyacrylamide gel.

Confocal microscopy
HEK293A cells were grown in a chamber slide system (Nalgene Nunc International Corp., Naperville, IL, USA) and transfected with either pcDNA3-PKC-{zeta} or pEGFP-hBVR or both. To test the effect of the hBVR peptide KRNRYLSF (10 µM) or one of the myristoylated KKRILHC or KYCCSRK peptides, they were added to cells previously transfected with PKC-{zeta}. After a 24 h starvation period, cells were treated with TNF-{alpha} (20 ng/ml) for 15 min. Cells were fixed in formaldehyde, permeabilized with 1% Triton-X, and treated with rabbit anti-PKC-{zeta} antibody, followed by rhodamine-red-x-conjugated antibody to rabbit IgG. hBVR was visualized by GFP-Tag. A Leica TCS SP, model DMRE, confocal microscope was used to examine the treated cells.

Identification of hBVR phosphorylated residues in oxidative stress stimulated cells
HEK293A cells overexpressing flag-hBVR were treated with H2O2 (20 min, 40 µM) and lysed in modified RIPA buffer as described previously (6) . The lysates were immunoprecipitated with FLAG antibody conjugated to protein A beads. The beads were washed twice in lysis buffer, twice in 500 mM LiCl in Tris buffer (pH 7.5) containing 0.1% Triton-X-100 and then twice in Tris buffer. The material was subjected to SDS-PAGE and stained with Coomassie blue (Bio-Rad). The stained protein was excised, subjected to hydrolysis with trypsin, and analyzed with a matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrophotometer at either WEM Biochem (Toronto, Canada) or the University of Rochester.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
PKC-{zeta} and hBVR are both kinases involved in the regulation of glucose uptake (7) . Moreover, because both enzymes are activated by cytokines and oxidative stress (1) , we sought to examine whether these proteins might interact in vitro and more particularly within the cell.

hBVR activates PKC-{zeta} in vitro
As it was previously shown that hBVR can activate PKC-βII (35) , presently, whether this phenomenon extends to PKC-{zeta} was examined. The initial experiment examined phosphorylation of GST-purified hBVR by PKC-{zeta} (Fig. 1 a). Under PKC-{zeta} optimal assay conditions, phosphorylation of hBVR was markedly increased. Moreover, under those assay conditions, hBVR displayed minimum autophosphorylation, suggesting that incorporation of 32P into hBVR is predominantly due to PKC-{zeta} activity. Autophosphorylation of PKC-{zeta} significantly increased in the presence of hBVR when compared to the enzyme alone. To confirm that BVR phosphorylation is due solely to PKC-{zeta} activity, a PKC-{zeta}-specific inhibitor, PKC-{zeta} pseudosubstrate peptide (PS), was used as a negative control. As shown in the figure, in the presence of the PS (lane 2), the phosphorylation of both enzymes was markedly suppressed. To further address the specificity of the assay, a "kinase dead" (KD) hBVR construct was made by replacing the N-terminal Val11–14 and Gly17 with alanine residues. As previously shown (35) , mutations in this segment of the protein render hBVR incapable of binding ATP and phosphorylation activity. Similar results were obtained using the hBVR-KD mutant, i.e., Fig. 1a . PKC-{zeta} phosphorylated hBVR, while autophosphorylation of PKC-{zeta} was increased.


Figure 1
View larger version (18K):
[in this window]
[in a new window]

 
Figure 1. Effect of hBVR on PKC-{zeta} activity in vitro. a) PKC-{zeta} phosphorylates hBVR and hBVR enhances PKC-{zeta} autophosphorylation. PKC-{zeta} (5 ng) and hBVR (5 µg) were incubated with or without 10 µM of a myristoylated PKC-{zeta}-PS peptide (lanes 2 and 4), as described in Material and Methods. PKC-{zeta} alone and hBVR alone are in lanes 3 and 5, respectively. After 20 min reaction was terminated, and proteins were resolved by SDS-PAGE, transferred to PVDF membrane, and autoradiographed. Experiment was repeated twice. b) PKC-{zeta} phopshorylates kinase dead hBVR. PKC-{zeta} phopshorylation and activity were examined using "kinase dead" (KD) hBVRV11–14G17->A11–14, A17 as a substrate. PKC-{zeta} activity was assessed as in a. Note that hBVR-KD mutant does not have GST. Experiment was repeated twice. c) Co-PP suppresses autophosphorylation and phosphotransferase activity of PKC-{zeta}. PKC-{zeta} kinase activity with or without hBVR as a substrate was tested in the presence or absence of 5 µM Co-PP, as described in a. d) hBVR is a poor kinase for PKC-{zeta} phosphorylation. hBVR kinase activity was determined as described in Materials and Methods using PKC-{zeta} (100 ng) as the substrate under conditions in which PKC-{zeta} does not autophosphorylate. Kinase products were assessed, as in a. e) hBVR phosphorylates PKC-βII. hBVR kinase activity was analyzed as described by using an inactive, mutant protein of PKC-βIIK371R as a substrate. Data represent 3 independent experiments. f) hBVR enhances PKC-{zeta} phosphotransfer to a second substrate. PKC-{zeta} kinase activity was measured using 12.5 µM MBP as a substrate in presence of 1.6 µM hBVR, as described in text. g) hBVR stimulates PKC-{zeta} similarly to phosphatidyl serine. PKC-{zeta} activity, using 12.5 µM MBP, as a substrate, was measured in the presence or absence of hBVR (1.6 µM) and in the presence of increasing levels of phosphatidyl serine. Radioactivity incorporation was determined using the p81 filter assay. Activity is expressed as pmol/min/µg protein of incorporated [32P] into substrate and represents average ± SD of triplicate samples. h) S149 and S230 of hBVR are potential targets of PKC-{zeta}. Reaction mixtures of PKC-{zeta} (5 ng) and wthBVR (5 µg) or serine to alanine mutants were analyzed by electrophoresis and autoradiography, as in a. Selected lanes were analyzed by densitometry: integrated signals were normalized to wild-type signal set as 100% and are average ± SD of 3 experiments (*P≤0.01, vs. wt hBVR).

Next, the effect of Co-PP, an activator of hBVR (35 , 38) , on the augmentation of PKC-{zeta} kinase activity by hBVR was examined. Co-PP (Fig. 1c ) suppressed both PKC-{zeta} autophosphorylation and hBVR phosphorylation by PKC (5 and 30 min). Since Co-PP suppressed PKC-{zeta} autophosphorylation in the absence of hBVR, this observation suggests that Co-PP binds not only to hBVR as shown earlier but also to the PKC-{zeta}, thereby suppressing its kinase activity. The interaction of hBVR with the metalloporphyrin may induce conformational changes in the protein, which hinders its association with PKC-{zeta}. Since hBVR is a kinase, it was tested for its ability to phosphorylate PKC-{zeta}. Under assay conditions that favor hBVR kinase activity, in the presence of hBVR, PKC-{zeta} was not phosphorylated (Fig. 1d ). This is unlike the previous observation to PKC-βII (35) , which is presently confirmed (Fig. 1e ). Under these conditions, PKC-βII phosphorylation is increased. Similarly, peptides derived from the activation loop of the PKC-{zeta} autophosphorylation site were a poor substrate for hBVR (data not shown), suggesting that PKC-{zeta} is not a substrate for hBVR.

To determine whether the increased phosphorylation of PKC-{zeta} in the presence of hBVR would increase the activity of PKC-{zeta} toward other substrates, the effect of hBVR on PKC-{zeta}-dependent phosphorylation of MBP was tested. hBVR caused a severalfold increase in MBP phosphorylation by PKC-{zeta}, when compared with PKC alone (Fig. 1f ), while hBVR alone did not phosphorylate MBP, suggesting that the role of hBVR is to increase PKC-{zeta} activity. Because phosphatidyl serine is known to stimulate the activity of PKC-{zeta}, the effects of hBVR and the phospholipid on PKC-{zeta} activity were compared. The presence of hBVR increased basal as well as phosphatidyl serine-dependent activation of PKC-{zeta} (Fig. 1g ). The observation suggests that hBVR-mediated activation of PKC-{zeta} is independent and different from that of phophatidylserine.

The core consensus phosphorylation motifs for PKC substrates are RXXS, T/SXRX (39) ; one such motif is present in the hBVR molecule at R227YLS. Thus, S230 is predicted to be a phosphorylation target for PKC-{zeta}, which overlaps with a candidate SH2 binding signal in hBVR, YLSF. This possibility was examined using mass-spectrometric analysis of hBVR obtained from HEK293 cells over expressing Flag-hBVR with and without H2O2 treatment (0.04 mM, 20 min). Several peptides were identified in the H2O2-treated sample as containing phosphorylated amino acids, including AGSVRM, AFLNLIGFVS, ELLKGSL, and YLSFHFK. The molecular weight of the peptides indicated incorporation of 1 and 2 phosphate groups, as indicated. The italicized residues correspond to hBVR, S21, S44, S149, Y228, and S230, respectively; none of these peptides in the untreated sample contained phosphate groups. These residues are an addition to the previously identified hBVR phosphorylation site Y198 in the YMXM motif (7) . RAGS21VRMRDL sequence shows a close similarity to the PKC-{zeta}-specific substrate sequence R115RGSRRWRKL and resembles the PKC-{zeta} PS that maps to the regulatory region of the protein, while the S44R/KR domain is predicted to be a phosphorylation site of PKCs. Altogether, this suggests that those sites may be phosphorylated in vitro and may be relevant to hBVR signaling in cells.

To address the question of the PKC-{zeta} target site in hBVR, in vitro experiments were performed on a series of mutant hBVR proteins carrying serine to alanine replacements. Each serine residue is in a sequence context that partially matches the consensus PKC-{zeta} target. Mutations at S21 and S44 resulted in no apparent change in 32P incorporation (Fig. 1h ). On the other hand, the S149 mutant resulted in a modest reduction in incorporation of ~30%, while the S230 mutant incorporated 60% less radioactivity than did the wild type(P≤0.01, vs. wt hBVR). The double mutant, S149S230, incorporated the least 32P (P≤0.01, vs. wt hBVR), no more than 15% of the wild type, suggesting that these two residues are the primary targets for PKC-{zeta}.

TNF-{alpha} stimulated intracellular interaction of PKC-{zeta} and hBVR
To address the question of whether interaction of PKC-{zeta} and hBVR seen in vitro might also occur in the cell, HEK293A cells were cotransfected with plasmids containing PKC-{zeta} and hBVR and were examined for binding and phosphorylation in response to TNF-{alpha}. After TNF-{alpha} stimulation, cell lysates were immunoprecipitated with antibodies to PKC-{zeta}, revealing the presence of hBVR in the precipitate (Fig. 2 a), and by extension, interaction of the proteins in the cell. This interaction required activation by TNF-{alpha}, since hBVR was not observed in the immunoprecipitates from nontreated cells. Consistent with the previous observation (35) , unlike PKC-βII, PKC-{zeta} did not coprecipitate with hBVR in PMA-treated cells (Fig. 2b, c ). Because the activation of both proteins is dependent on phosphorylation (6 , 7 , 35 , 40) , we tested the phosphorylation status of hBVR and PKC-{zeta} upon treatment with TNF-{alpha}. Starved cells were metabolically loaded with 32P-orthophosphate and treated with TNF-{alpha}, and the cell extracts were immunoprecipitated with anti-PKC-{zeta} or anti-BVR antibodies. In each instance, a transient phosphorylation of the proteins occurred (Fig. 2d ), with phospho-PKC-{zeta} peaking at 5 min and returning to near basal level after 45 min. On the other hand, BVR phosphorylation, which also peaked at 5 min, was still somewhat above basal level after 45 min.


Figure 2
View larger version (14K):
[in this window]
[in a new window]

 
Figure 2. Interaction of PKC-{zeta} and hBVR in intact cells. a) Coimmunoprecipitation of PKC-{zeta} and hBVR from cells treated with TNF-{alpha}. HEK293A cells, cotransfected with pcDNA3-PKC-{zeta} and pcDNA3-hBVR, were starved and treated with TNF-{alpha} (20 ng/ml) for 15 min, while control cells were nontreated. Cell lysates were incubated with either anti-mouse IgG or anti-PKC-{zeta} antibodies, and bound proteins were resolved by SDS-PAGE and transferred to nitrocellulose, and the blot was probed with anti-hBVR antibodies. Blot was then stripped and reprobed with antibodies to PKC-{zeta}. Autoradiographs are representative of 3 independent experiments. b) PMA does not induce binding between hBVR and PKC-{zeta}. HEK293 cells overexpressing PKC-{zeta} were starved for 24 h and treated with 100 nM PMA for 15 min. Cell lysates were incubated with GST-hBVR, or with GST alone. Precipitates were analyzed as in a, first using anti-PKC-{zeta} and then anti-hBVR antibodies. Autoradiographs represent of 2 separate experiments. c) PMA induces binding between hBVR and PKC-βII. HEK293 cells overexpressing PKC-βII were treated and processed that same way as described in Fig. 2b . GST-hBVR precipitated proteins were blotted to nitrocellulose and membranes were sequentially probed with anti-PKC-βII and hBVR antibodies. Experiment was performed twice. d) TNF-{alpha} treatment simultaneously stimulates phosphorylation of PKC-{zeta} and hBVR. Cells transfected with PKC-{zeta} or hBVR were metabolically labeled for 4 h with [32P]-orthophosphate, and after starvation, treated with TNF-{alpha} (20 ng/ml). Cells were lysed at the indicated times, and cell extracts were immunoprecipitated with antibodies to PKC-{zeta}, hBVR or with IgG. Precipitates were resolved by SDS-PAGE, transferred to nitrocellulose, and autoradiographed. Membranes were then probed with either anti-PKC-{zeta} or -hBVR antibodies as indicated. Data represent 2 separate experiments.

Activity of PKC-{zeta} in cells is enhanced by hBVR and requires the hBVR ATP-binding site
To address the possibility that stimulation of kinase activity might occur in intact cells, HEK293A cells were transfected with either pcDNA3-PKC-{zeta} or the kinase-inactive pcDNA3-PKC-{zeta}K281R. Treatment with TNF-{alpha} led to the stimulation of PKC activity in cells expressing PKC-{zeta} (Fig. 3 a, b) but not in those expressing PKC-{zeta}K281R (Fig. 3a , empty bars). Cotransfection of the cells with pcDNA3-hBVR significantly (P≤0.01, vs. TNF-{alpha}) increased PKC activity in TNF-{alpha} treated cells, whereas this activation was not observed in the cells expressing the PKC-{zeta}K281R, validating the assay (Fig. 3a , empty bars). On the other hand, infecting the cells with a virus expressing siRNA hBVR reduces the PKC-{zeta} kinase activity to nearly that seen in cells expressing PKC-{zeta}K281R (P≤0.01, TNF-{alpha} vs. sihBVR and TNF-{alpha}). The inhibitory action of the virus was not observed using scrambled siRNA hBVR construct. Furthermore, although the stimulation with TNF-{alpha} led to an increase in PKC activity, the increase was substantially reduced in comparison to uninfected cells (Fig. 3a , lane 3 vs. lane 1). This implies that transfection did not abolish all of the basal level, because 84% of basal activity remained. To address the specificity of the assay, a myristoylated form of PKC-{zeta}-PS was added to cells 1 h before the treatment with TNF-{alpha}. As indicated in Fig. 3a , lane 4, PS presence brought TNF-{alpha}-dependent PKC-{zeta} activity to baseline (P≤0.01, vs. TNF-{alpha} only).


Figure 3
View larger version (8K):
[in this window]
[in a new window]

 
Figure 3. hBVR enhanced PKC-{zeta} activity occurs in intact cells. a) sihBVR, PS, or PKC {zeta}K281R mutant suppress PKC {zeta} activation by TNF-{alpha} in cells. Cells were transfected with either the PKC-{zeta} (black bars), dominant negative PKC-{zeta}K281R plasmid (empty bars), cotransfected with hBVR, or infected with pSuper-sihBVR or pSuper-schBVR (scrambled siRNA for hBVR, control), or treated with 5 µM PS for PKC-{zeta}, and starved. Cells were treated with TNF-{alpha} (15 min). PKC-{zeta} activity is expressed as pmol 32P incorporated/min/µg of cellular proteins into substrate and is mean ± SD of 3 experiments. b) Cells transfected with PKC-{zeta} plasmid were also cotransfected with wild-type pcDNA3-hBVR or with a mutant pcDNA3-hBVR-G17->A, -S149->A, or -S230->A, starved and treated with TNF-{alpha}. PKC-{zeta} activity was assayed in situ, and data are expressed as in Fig. 3a ({ddagger}P≤0.01, vs. TNF-{alpha}).

To determine which region(s) of the hBVR molecule might be of importance in this activation, hBVR molecules, which bore a point mutation in the ATP binding site (G17->A), and in each of the candidate PKC-{zeta} target sites (S149->A, S230->A), were tested in the in situ assay. None of these proteins stimulated the activity of the endogenous PKC above the basal level (Fig. 3b ). Moreover, these mutants completely inhibited TNF-{alpha} stimulation, indicating a negative effect on PKC-{zeta} signaling in the cell (P≤0.01, vs. TNF-{alpha} only). Since the kinase activity of wt hBVR is minimal under the conditions of the reaction and since the G17 mutant is kinase dead, it is apparent that the mechanism by which hBVR stimulates PKC-{zeta} in the cell includes hBVR as both a substrate for the enzyme and as a kinase-competent protein.

Activation and inhibition of PKC-{zeta} activity by hBVR-based peptides
The C-terminal 17 residues of hBVR, a cysteine rich domain, are similar to the C1 regulatory domain of PKC-{zeta}. Because of the possibility that this domain could be involved in regulating PKC-{zeta}, the effects of hBVR-derived peptides KKRILHC281 and KYCCSRK296, as well as a peptide KRNRYLS230F, derived from the PKC-{zeta} substrate domain of hBVR on PKC-{zeta} activity were examined.

Cells transfected to overexpress PKC-{zeta} were treated with KRNRYLS230F, KRNRYLA230F, KKRILHC281, KKRILHA281, KYCCSRK296, or KYCCSRA296 peptides. The KRNRYLS230F and KKRILHC281 peptides brought PKC-{zeta} activity nearly to the basal level in the in situ assay (Fig. 4 a; P≤0.01, vs. TNF-{alpha}), whereas the KYCCSRK296 peptide increased TNF-{alpha}-dependent induction of PKC-{zeta} activity almost to the level of wt hBVR (P≤0.001, vs. TNF-{alpha}, Fig. 4a ). The Ser230, Cys281, and Lys296 in their respective peptides seem to be important, since their replacement with alanine (A) reversed the effect of these peptides on PKC-{zeta} activity.


Figure 4
View larger version (16K):
[in this window]
[in a new window]

 
Figure 4. hBVR-based peptides enhance and inhibit PKC-{zeta} activity. a) Effect of hBVR-derived peptides on PKC-{zeta} activity in cell. Cells transfected with pcDNA3-PKC-{zeta}, or cotransfected with pcDNA3-hBVR, were treated with 10µM of the KRNRYLS230F, KRNRYLA230F, KKRILHA281, KYCCSRA296 (using Chariot reagent), or with myristoylated KKRILHC281 and KYCCSRK296. After starvation, cells were treated with 20 ng/ml TNF-{alpha} for 15 min, and PKC activity was assayed in situ as in Fig. 3 , using PKC-{zeta} peptide substrate in permeablized cells. Values are mean ± SD of 3 experiments ({ddagger}P≤0.01, vs. cells treated with TNF only). b) Examination of response of PKC-{zeta} to TNF-{alpha} in cell transfected with the C-terminal cysteine mutant hBVR. Cells were cotransfected with pcDNA3-PKC-{zeta}, and expression plasmid for wt hBVR, or hBVRC281,292,293A mutant. Control cells were transfected with pcDNA3-PKC-{zeta} alone. Cells were starved, treated with TNF-{alpha} (20 ng/ml), and processed for determination of PKC activity, as in a. Results are mean ± SD of 3 experiments. c) Effect of hBVR-based peptides on PKC-{zeta} activity in vitro. The hBVR-based peptides 10 µM each KRNRYLS230F, KKRILHC281, KKRILHA281, KYCCSRK296, or KYCCSRA296 were examined for effect on PKC-{zeta} kinase activity using MBP (12.5 µM) as substrate. Phosphorylation of MBP was assessed as described in Materials and Methods, using p81 filter assay procedure. Results are mean of triplicate samples ± SD. {ddagger}P < 0.001, vs. PKC activity without the peptides.

To further examine the C-terminal end of the hBVR molecule, a mutant construct in which three cysteine residues located near the C terminal of hBVR were replaced by alanine (C281,292,293A) was used. This cysteine hBVR mutant failed to activate PKC-{zeta} to the extent of the wild-type hBVR, regardless of treatment with TNF-{alpha} (Fig. 4b ).

The observations with hBVR peptides in the intact cells were further examined in in vitro experiments. The KRNRYLS230F peptide failed to activate PKC-{zeta} as BVR does (Fig. 4c , lane 3). Peptide KKRILHC281 bears some resemblance to a sequence located between the activation loop and autophosphorylation site of PKC-{zeta} and shares the physical characteristics of the highly basic PS region of PKC-{zeta} and -{iota}. This peptide caused a nearly complete inactivation of the kinase (Fig. 4c , lane 4; P≤0.001, vs. PKC-{zeta}). An otherwise identical peptide that contains alanine in place of cysteine (KKRILHA281) failed to inhibit the kinase. Conversely, a second cysteine containing peptide, KYCCSRK296, stimulated PKC-{zeta} in vitro (Fig. 4c , lane 6; P≤0.001, vs. PKC-{zeta}). However, a variant of this peptide, in which the C-terminal lysine is replaced by alanine, KYCCSRA296, had no significant effect.

Kinase activity of hBVR is also affected by hBVR-based peptides
As was seen for PKC-{zeta}, KKRILHC281 strongly suppressed the incorporation of 32P into hBVR, whereas the KYCCSRK296 peptide enhanced the autophosphorylation of the reductase in vitro (Fig. 5 ). However, unlike the observation for PKC-{zeta} in vitro, the KRNRYLS230F peptide suppressed autophosphorylation of hBVR (Fig. 5) .


Figure 5
View larger version (14K):
[in this window]
[in a new window]

 
Figure 5. Kinase activity of hBVR is subject to a similar pattern of control by hBVR-based peptides as PKC-{zeta}. hBVR autophosphorylation was assessed in the presence of hBVR-based peptides: KKRILHC281, KYCCSRK296, and KRNRYLS230F (each at 10 µM). After 1 h, the products were analyzed by electrophoresis, and autoradiography as in Fig. 1a . Intensity of bands was measured by densitometry. Experiment was repeated twice.

TNF-{alpha}-stimulated membrane localization of PKC-{zeta} is blocked by inhibitory hBVR-based peptides
In light of the effect of the peptides KRNRYLS230F, KKRILHC281, and KYCCSRK296 on PKC-{zeta} activity in cells, we examined whether the presence of these peptides affected the intracellular distribution of PKC-{zeta}. Cells transfected with PKC-{zeta} were starved, treated with TNF-{alpha} or with TNF-{alpha} plus the peptides, and then subjected to confocal microscopy (Fig. 6 a–e). The distribution of PKC-{zeta} was examined by red fluorescence of rhodamine red-x-conjugated secondary antibody (Fig. 6a-e ). The ratio of cytoplasmic and membraneous localization of PKC-{zeta} corresponding to the transfected peptide was obtained and is presented as a bar graph in Fig. 6f . In untreated cells, the PKC-{zeta} is uniformly distributed (in ~90% of cells) throughout the cytoplasm (Fig. 6a ); as expected after TNF-{alpha} treatment, the PKC rapidly translocated to the plasma membrane in nearly 60% of cells (b). In the presence of KRNRYLS230F or KKRILHC281 peptides subsequent to TNF-{alpha} treatment, PKC-{zeta} remained distributed throughout the cytoplasm (Fig. 6c, d ). The myr-KYCCSRK296 peptide did not hinder TNF-{alpha}-dependent PKC-{zeta} translocation (Fig. 6e ) in transfected cells, which accounted for ~70% of cells.


Figure 6
View larger version (32K):
[in this window]
[in a new window]

 
Figure 6. TNF-{alpha}-stimulated membrane localization of PKC-{zeta} is blocked by inhibitory hBVR-based peptides. HEK293A cells in chamber slides were transfected with pcDNA3-PKC-{zeta} (a–e). After overnight starvation, cells were treated with KRNRYLS230F peptide (c; 10 µM) using chariot transfection reagent or with myristoylated hBVR peptides KKRILHC281 (d) or KYCCSRK296 (e; 10 µM). Thereafter, cells were treated with TNF-{alpha} (15 min, b–e) or left untreated (a) and were subsequently subjected to confocal microscopy, as described in Materials and Methods. Location of PKC-{zeta} was visualized by using anti-PKC-{zeta} antibodies followed by secondary antibodies conjugated with rhodamine-red-x. Images are represent 3 independent experiments. f) Intracellular PKC-{zeta} distribution (% of cells). Confocal images of cells overexpressing PKC-{zeta} were scored for cytoplasmic or membraneous localization of PKC-{zeta} as in a–e. Results are percentage of total number of cells counted.

TNF-{alpha}-dependent induction of NF-{kappa}B is mediated by PKC-{zeta} and is enhanced by hBVR
Because activation of PKC-{zeta} is essential for signal transduction by the NF-{kappa}B signaling pathway, whether hBVR-mediated activation of PKC-{zeta} influenced signal activity of the transcription factor was examined. For this, NF-{kappa}B promoter elements linked to a luciferase reporter were used. A strong NF-{kappa}B induction was observed in TNF-{alpha}-treated cells (Fig. 7 a). As predicted, the magnitude of increase nearly doubled when hBVR was over-expressed in the cells (P≤0.01, vs. TNF-{alpha}) and was strongly suppressed when the inhibitory PKC-{zeta} PS was added to the cells (P≤0.01, vs. TNF-{alpha}), indicating a strong dependence of NF-{kappa}B induction on PKCs. hBVR mutants that suppressed TNF-{alpha}-dependent PKC-{zeta} activity (G17->A, S149->A, S230->A) were tested for their effect of NF-{kappa}B promoter reporter. As depicted in Fig. 7a , the three mutants were ineffective in enhancing TNF-{alpha}-mediated NF-{kappa}B promoter activity.


Figure 7
View larger version (21K):
[in this window]
[in a new window]

 
Figure 7. hBVR potentiates TNF-{alpha}-PKC-{zeta}-linked activation of NF-{kappa}B promoter. a) NF-{kappa}B promoter reporter assay. HEK293A cells were seeded into 24-well plates and cotransfected with PKC-{zeta}, NF-{kappa}B luciferase promoter reporter construct (pNF-{kappa}B-luc, 0.4 µg), and pCMV β-galactosidase vector (0.2 µg). To test effect of hBVR, some cells were cotransfected with pcDNA3-wt-hBVR or with hBVR mutants, hBVRG17, hBVRS149, or hBVRS230. Cells were starved in medium containing 0.5% FBS and then treated with 5 µM myristoylated PKC-{zeta} PS as indicated for 1 h followed by TNF-{alpha} treatment for 6 h. Cell lysates were assayed for luciferase and β-galactosidase activities. Luciferase activity, normalized for transfection efficiency against β-galactosidase activity, is mean ± SD of 3 experiments with triplicate samples (*P≤0.01, vs. TNF-{alpha} treatment only). b) Gel shifts with NF-{kappa}B. Cells were transfected with empty vector or with pcDNA-hBVR. After a period of serum starvation, medium was replaced with one containing 20 ng/ml TNF-{alpha}. After a further 30 min, cells were harvested and used to prepare nuclear extracts; 15 µg of lysate protein were incubated with a 32P-labeled oligonucleotide containing an NF-{kappa}B binding site (Materials and Methods), with or without the addition of antibody to NF-{kappa}B p65 subunit. Complexes were resolved by electrophoresis on a 4% nondenaturing polyacrylamide gel. Arrow indicates supershifted band representing DNA-protein-antibody complex after addition of anti-NF-{kappa}B p65 subunit antibody. Experiment was performed at least 4 times.

To further examine the role of BVR in activation of NF-{kappa}B during TNF-{alpha} treatment, nuclear extracts from cells treated with TNF-{alpha}, and/or transfected with hBVR, were used to measure protein binding to the NF-{kappa}B recognition sequence. As shown in Fig. 7b , extracts from cells overexpressing hBVR and treated with TNF-{alpha} showed enhanced binding to the oligonucleotide when compared to those from control cells treated with TNF-{alpha}. The specificity of the binding is indicated by a supershift with an antibody to the p65 subunit of NF-{kappa}B, and the intensity of the supershifted signal is also enhanced in cells overexpressing hBVR. It was of interest to examine whether TNF-{alpha} also activates hBVR; hBVR kinase and reductase activities are linked (6 , 35) . As shown in Fig. 8 a, treatment of the cell with TNF-{alpha} caused a transient increase in the catalytic activity of hBVR, peaking at 30 min and returning to the basal level thereafter. Moreover, as with PKC-{zeta}, hBVR cellular localization was altered by TNF-{alpha} treatment (Fig. 8b-e ). In ~80% of untreated cells, green fluorescent-tagged hBVR, the protein was found dispersed throughout the cytoplasm (Fig. 8b ); upon TNF-{alpha} treatment, in ~45% of cells, hBVR was predominantly localized to the nucleus, and associated with the cell membrane (Fig. 8c ). hBVR membrane localization was confirmed in cells cotransfected with PKC-{zeta} and treated with TNF-{alpha} (Fig. 8d ). In those cells, the yellow fluorescence of the merged image of the red fluorescence associated with the PKC-{zeta} membrane located (Fig. 8c ) and green fluorescence of GFP-hBVR substantiates the hBVR membrane localization (Fig. 8d ). Figure 8f depicts the numerical percentage distribution of hBVR in the cytoplasm, nucleus, and cell membrane ±TNF-{alpha} treatment. As shown in the absence of TNF-{alpha}, hBVR is predominantly found in the cytoplasm. Upon the addition of the cytokine, a high percentage of the protein is found in the nucleus and associated with the cell membrane.


Figure 8
View larger version (21K):
[in this window]
[in a new window]

 
Figure 8. TNF-{alpha} induces reductase activity of hBVR and its translocation to nucleus. a) TNF-{alpha} activation of hBVR. Cells were seeded into 6-well plates and starved in medium containing 0.5% FBS. After 24 h, cells were treated with TNF-{alpha} (20 ng/ml) for indicated times, harvested, and BVR reductase activity in cell lysates was determined as described. Results are average ± SD of quadruple measurements. b–e) Translocation of hBVR in response to treatment of cells with TNF-{alpha}. Cells seeded into chamber slides were transfected with pEGFP-hBVR alone (b) or cotransfected with PKC-{zeta} (ce), starved, and treated with TNF-{alpha} for 15 min. hBVR localization was detected by the green fluorescence of GFP using confocal microscopy. PKC-{zeta} (d) was visualized by red fluorescence of rhodamine-red-x-conjugated secondary antibody, while protein colocalization was determined by yellow fluorescence of merged images (e). Images represent 3 independent experiments. f) TNF-{alpha}-dependent hBVR distribution in cell. Confocal images of cells overexpressing hBVR and PKC-{zeta} were scored for cytoplasmic (empty bars), for nuclear (filled bar), and for membraneous (dotted bar) localization of hBVR. Results are a percentage of total number of counted cells.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The present findings point out the existence of a regulatory relationship between PKC-{zeta} and hBVR that is initiated in response to TNF-{alpha} and potentially extends to other extracellular stimuli and activators of the two kinases. The aPKCs, including PKC-{zeta} and PKC-{lambda}/{iota}, are essential components of cell growth, differentiation, and survival (41) . PKC-{zeta} acts downstream of PI3K (42) , and together with the other aPKC isoform {lambda}/{iota}, is required for maximal insulin-stimulated protein synthesis and glucose uptake (43) . As noted earlier, hBVR, as is PI3K, is downstream of IRK (7) . The findings of this study, together with previous findings, suggest the occurrence of an "activation loop" between hBVR and PKC-{zeta} that links the PKC to MAPK and insulin receptor (IR)/insulin-like growth factor-1 (IGF-1). The aPKCs are known to be rather undiscriminating in their selection of phosphorylation targets (3) . The present investigation has revealed that hBVR is among the target proteins identified for this kinase. In this study, we have shown that the presence of hBVR augments the activation of the PKC-{zeta} kinase by TNF-{alpha} and that the interaction between the two proteins is dependent on prior activation of PKC-{zeta}. The present findings that PKC-{zeta}:hBVR interaction occurred subsequent to TNF-{alpha} stimulation, but not in response to PMA, whereas as noted before, interaction of hBVR with PKC-βII, but not with PKC-{zeta}, is promoted by PMA stimulation, which suggests stimulation-specificity-dependent interaction of hBVR with PKC enzymes (35) . Furthermore, although hBVR phosphorylated PKC-βII, it did not phosphorylate PKC-{zeta} (35) , whereas both types of PKC enzymes phosphorylated hBVR.

We reason that the augmentation of PKC-{zeta} activity in the presence of hBVR is not the result of hBVR phosphorylating the PKC, because under assay conditions that do not support hBVR kinase activity, stimulation of the PKC kinase activity is observed. In this respect, there is a distinct difference between hBVR interaction with the classical subfamily of PKCs and with the aPKC-{zeta}. hBVR is a kinase for PKC-βII phosphorylation and appears to target the threonine residue in the activation loop of the PKC, resulting in an increased autophosporylation of the PKC-βII (35) .

The mechanism responsible for the activation of PKC-{zeta} remains largely unknown. Also, the full complement of the PKC-{zeta} interactive/binding proteins and how they serve to link this kinase with the network of signaling cascades and the intracellular trafficking of the PKC are not well understood. Protein:protein interaction, however, is considered an important determinant of cellular localization of the activated PKC-{zeta} (44) . The interaction of PKC-{zeta} with only one scaffold/adaptor protein p62, also known as zeta interacting protein (ZIP), has been reported and is considered essential for intracellular targeting of the kinase and the activation of kinases in the signal transduction pathways that primarily control cell growth (45) . Based on the present finding of hBVR:PKC-{zeta} interaction, colocalization of the two proteins in the plasma membrane, and the structural features of hBVR, it is reasonable to consider that hBVR is an adaptor protein for PKC-{zeta} and potentially an adapter protein linking PKC-{zeta} to cytokine and PTK receptors. Finding that Co-PP, an established activator of hBVR kinase and reductase activities (35 , 38) , attenuates the magnitude of hBVR-mediated activation of PKC-{zeta} by TNF-{alpha} is consistent with the likelihood that the secondary conformation of hBVR is important in its modulation of PKC activity and by extension protein:protein interaction. Alternatively, Co-PP could inhibit most robust autophosphorylation of PKC-{zeta} and indirectly phosphorylation of hBVR. To date, only a few PKC-{zeta} adaptor proteins have been uncovered, and their potential as targets for anti-inflammatory and anticancer therapy has been suggested (46) .

TNF-{alpha}-mediated reactive oxygen species (ROS) -generated regulation of signaling pathways that activate AP-1 and NF-{kappa}B transcriptional activity is well documented (47) . In turn, the likely mechanisms controlling cell growth and differentiation by TNF-{alpha} involve PKC-{zeta} (41 , 47) . Inflammatory cytokines are among the activators of PKC-{zeta} and PKC-mediated generation of ROS, the second messenger for transcriptional activation of AP-1/ATF-related oxidative stress response genes and NF-{kappa}B activation (48) . PKC-{zeta} is required for NF-{kappa}B interaction; in fact, activation of the NF-{kappa}B family of transcriptional factors is a key component of inflammatory and immune response of the cell and results from the phosphorylation and subsequent proteosomal degradation of the I{kappa}B{alpha} inhibitor kinase (49 , 50) . After release from I{kappa}B{alpha}, NF-{kappa}B directly interacts with PKC-{zeta} (51) . Based on the findings of this study, we suggest two possible mechanisms by which hBVR promotes NF-{kappa}B activation of the two mechanisms, separate, yet linked; one involves TNF-{alpha} activation of hBVR and a subsequent activation of PKC-{zeta}, and the other involves the potentiation of NF-{kappa}B reporter activity in response to TNF-{alpha}. The possibility that the kinase activity of hBVR may play a more direct role in the activation of NF-{kappa}B in the context of I{kappa}B activity cannot be ruled out.

Because of the central role of PKC-{zeta} in inflammatory response and cell growth, the intriguing finding that short fragments of hBVR, devoid of kinase activity, can enhance or block PKC-{zeta} phosphotransferase activity is a potentially noteworthy discovery. Clearly, all of the hBVR-based peptides tested in the present study directly interact with PKC-{zeta}. KRNRYLS230F and KKRILHC281 inhibited PKC-{zeta} activation by TNF-{alpha}, whereas the replacement of the serine (S230) or cysteine (C281) residue with alanine prevented the inhibitory PKC-{zeta} response in the cell. In the case of the 7 residue activating peptide, the key residues for the activation were traced to the last lysine residue in the peptide. This observation is interpreted to suggest the involvement of the lysine residue in the stabilization of ATP:PKC. Notably, in all protein kinases, an invariant lysine residue directly interacts with ATP and, through a salt bridge with an invariant glutamate located in subdomain III, stabilizes its interaction with ATP. Moreover, the invariant lysine is responsible for the correct folding of the ATP-binding pocket (52) . This reasoning is supported by the finding that when the lysine-containing peptide is present, an increase in phosphotransferase activity of PKC-{zeta} is observed in vitro in the absence of another protein (Fig. 1a, b ). This finding extends to PKC-βII (35) . The finding that the transfer of phosphate to PKC-{zeta} substrate is facilitated in the cell treated with the peptide is further supportive of the suggestion (Fig. 4a ). Certainly, the possibility that interactions in the cell may promote recruitment of other activators cannot be dismissed. This reasoning is further supported by the finding that point mutations introduced into the ATP interactive motifs of hBVR, i.e., G17, and at S149 in the S/T kinase consensus sequence, block hBVR augmentation of PKC-{zeta} activation by TNF-{alpha}.

S230 is not in the kinase domain of hBVR; however, the enhancement by hBVR of TNF-{alpha}-dependent activation of PKC-{zeta} in the cell clearly has a requirement for this serine residue (Fig. 3b ). Based on the finding that in the cell but not in vitro, the S230 containing eight residue peptides was an effective inhibitor of PKC-{zeta} activation by TNF-{alpha}, we suggest the function of the residue in hBVR is in the activation by IRK. The phosphorylated tyrosine residues in the Y228LSF and Y198MKM motifs are selective binding and assembly sites for regulatory proteins with a Src homology domain and, as such, produce an optimum site for the assembly of multiprotein complexes (28 , 53 , 54) . The Y198 and Y228 residues in hBVR are phosphorylation targets of IRK (7) . It follows that the activation of the aPKC-{zeta} and -{lambda}/{iota} by growth factors regulating cell proliferation is dependent on the activation of the Src signaling pathway (44 , 55) .

The profound inhibitory effect of the peptide (KKRILHC281) on PKC-{zeta} activity is at odds with the activation observed with the intact protein. The observed loss of its function, after substituting the cysteine residue with alanine, points to the essential function of the cysteine. An explanation for this disparity is found by analyzing the predicted crystal structure of BVR. The solved crystal structure of rat BVR (21 , 22) indicates that for the intact protein this cysteine residue is not surface-accessible and therefore cannot interact with any other molecule. On the other hand, in an isolated peptide it would be accessible and consequently be capable of forming a disulfide bond with a cysteine residue in the regulatory C1 domain of PKC-{zeta}. The neutral pH of the kinase assay system and in the cell would not suppress formation of the disulfides in the cell. In the cell, however, the peptide may also interact with other components, a possibility that cannot be dismissed.

We propose that the carboxyl-terminal 17 residues of the 296 amino acid hBVR polypeptide prominently figure in hBVR modulation of PKC-{zeta} activity. Within this segment, there are three cysteines and an invariant histidine, His280Cys281,291,292, with reactive sulfhydryl groups (4 , 5 , 8) . In the conventional and nonconventional types of PKCs, two cysteine-rich regions, C1 and C2, are present in the regulatory domain, while for the aPKCs, the Ca-dependent, phospholipid binding C2 domain is absent and hence insensitive to Ca2+ and diacylglycerol (56 , 57) . Within the cysteine-rich regions of PKC-{zeta}, as well as within and proximal to the cysteine-rich region of hBVR, there are four Asn and Gln residues with reactive carbonyl groups. Activators of PKCs, all of which stimulate translocation of the kinases, hydrogen-bond the kinase to the sulfhydryl and the carbonyl groups of the kinase (58) . We interpreted the noted requisite for PKC-{zeta} activation together with the neutralization of the hBVR stimulatory effect by the substitution of cysteine residues with alanine (C->A mutation). This replaces a hydrogen atom for a sulfhydryl side chain, suggesting the involvement of the reactive groups in the C terminus of hBVR in interaction with PKC-{zeta}, potentially through disulfide bond formation involving cysteine residues of the two proteins. Because the C281 residue is buried within the molecule in the intact protein, it is unlikely that mutation at this site is as critical as to those of the more available C292 or C293.

The stimulatory peptide KYCCSRK296, as revealed by the crystal structure, is for the most part surface-accessible in the intact protein and may be involved in the enhancement of PKC-{zeta} activity by the intact hBVR. This conclusion must be tempered with the observation that amino acids equivalent to human residues 295 and 296 are disordered in the crystal structure, although that in itself suggests they are in contact with solvent.

We propose a central role for hBVR in control of cellular response to inflammatory and proliferative stimuli. Our finding that small hBVR-based peptides can dramatically decrease the magnitude of activation of PKC-{zeta} by tumor necrosis factor is highly relevant in attempts to define therapeutic targets in transformed tissue.


   ACKNOWLEDGMENTS
 
This study was supported by National Institutes of Health grants ES-04066 and ES-012187. We thank Jenny Shen and Brigette Brown-Kipphut for technical assistance.


   FOOTNOTES
 
1 These authors contributed equally to this work.

Received for publication March 15, 2007. Accepted for publication June 7, 2007.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Wyatt, T. A., Ito, H., Veys, T. J., Spurzem, J. R. (1997) Stimulation of protein kinase C activity by tumor necrosis factor-alpha in bovine bronchial epithelial cells. Am. J. Physiol. 273,L1007-L1012[Medline]
  2. Miralem, T., Hu, Z., Torno, M. D., Lelli, K. M., Maines, M. D. (2005) Small interference RNA-mediated gene silencing of human biliverdin reductase, but not that of heme oxygenase-1, attenuates arsenite-mediated induction of the oxygenase and increases apoptosis in 293A kidney cells. J. Biol. Chem. 280,17084-17092[Abstract/Free Full Text]
  3. Moscat, J., Rennert, P., Diaz-Meco, M. T. (2006) PKCzeta at the crossroad of NF-kappaB and Jak1/Stat6 signaling pathways. Cell Death Differ 13,702-711[CrossRef][Medline]
  4. Maines, M. D., Polevoda, B. V., Huang, T. J., McCoubrey, W. K., Jr (1996) Human biliverdin IXalpha reductase is a zinc-metalloprotein. Characterization of purified and Escherichia coli expressed enzymes. Eur. J. Biochem. 235,372-381[Medline]
  5. Maines, M. D. (2005) New insights into biliverdin reductase functions: linking heme metabolism to cell signaling. Physiology (Bethesda) 20,382-389[CrossRef][Medline]
  6. Salim, M., Brown-Kipphut, B. A., Maines, M. D. (2001) Human biliverdin reductase is autophosphorylated, and phosphorylation is required for bilirubin formation. J. Biol. Chem. 276,10929-10934[Abstract/Free Full Text]
  7. Lerner-Marmarosh, N., Shen, J., Torno, M. D., Kravets, A., Hu, Z., Maines, M. D. (2005) Human biliverdin reductase: a member of the insulin receptor substrate family with serine/threonine/tyrosine kinase activity. Proc. Natl. Acad. Sci. U. S. A. 102,7109-7114[Abstract/Free Full Text]
  8. Kutty, R. K., Maines, M. D. (1981) Purification and characterization of biliverdin reductase from rat liver. J. Biol. Chem. 256,3956-3962[Abstract/Free Full Text]
  9. Kravets, A., Hu, Z., Miralem, T., Torno, M. D., Maines, M. D. (2004) Biliverdin reductase: A novel regulator for Induction of activating transcription factor-2 and heme oxygenase-1. J. Biol. Chem. 279,19916-19923[Abstract/Free Full Text]
  10. Wagener, F. A., Volk, H. D., Willis, D., Abraham, N. G., Soares, M. P., Adema, G. J., Figdor, C. G. (2003) Different faces of the heme-heme oxygenase system in inflammation. Pharmacol. Rev. 55,551-571[Abstract/Free Full Text]
  11. Dulak, J., Loboda, A., Zagorska, A., Jozkowicz, A. (2004) Complex role of heme oxygenase-1 in angiogenesis. Antioxid. Redox. Signal. 6,858-866[Medline]
  12. Mancuso, C. (2004) Heme oxygenase and its products in the nervous system. Antioxid. Redox. Signal. 6,878-887[Medline]
  13. Choi, A. M., Dolinay, T. (2005) "Therapeutic" carbon monoxide may be a reality soon. Am. J. Respir. Crit. Care. Med. 171,1318-1319[Free Full Text]
  14. Immenschuh, S., Schroder, H. (2006) Heme oxygenase-1 and cardiovascular disease. Histol. Histopathol. 21,679-685[Medline]
  15. Sheftel, A. D., Kim, S. F., Ponka, P. (2007) Non-heme induction of heme oxygenase-1 does not alter cellular iron metabolism. J. Biol. Chem. 282,10480-10486[Abstract/Free Full Text]
  16. Hansen, T. W., Mathiesen, S. B., Walaas, S. I. (1996) Bilirubin has widespread inhibitory effects on protein phosphorylation. Pediatr. Res. 39,1072-1077[Medline]
  17. Stocker, R., Yamamoto, Y., McDonagh, A. F., Glazer, A. N., Ames, B. N. (1987) Bilirubin is an antioxidant of possible physiological importance. Science 235,1043-1046[Abstract/Free Full Text]
  18. Nishizuka, Y. (1995) Protein kinase C and lipid signaling for sustained cellular responses. FASEB J. 9,484-496[Abstract]
  19. Yao, L., Suzuki, H., Ozawa, K., Deng, J., Lehel, C., Fukamachi, H., Anderson, W. B., Kawakami, Y., Kawakami, T. (1997) Interactions between protein kinase C and pleckstrin homology domains. Inhibition by phosphatidylinositol 4,5-bisphosphate and phorbol 12-myristate 13-acetate. J. Biol. Chem. 272,13033-13039[Abstract/Free Full Text]
  20. Mochly-Rosen, D., Gordon, A. S. (1998) Anchoring proteins for protein kinase C: a means for isozyme selectivity. FASEB J. 12,35-42[Abstract/Free Full Text]
  21. Kikuchi, A., Park, S. Y., Miyatake, H., Sun, D., Sato, M., Yoshida, T., Shiro, Y. (2001) Crystal structure of rat biliverdin reductase. Nat. Struct. Biol. 8,221-225[CrossRef][Medline]
  22. Whitby, F. G., Phillips, J. D., Hill, C. P., McCoubrey, W., Maines, M. D. (2002) Crystal structure of a biliverdin IXalpha reductase enzyme-cofactor complex. J. Mol. Biol. 319,1199-1210[CrossRef][Medline]
  23. Blomberg, N., Baraldi, E., Nilges, M., Saraste, M. (1999) The PH superfold: a structural scaffold for multiple functions. Trends. Biochem. Sci. 24,441-445[CrossRef][Medline]
  24. Fakhrai, H., Maines, M. D. (1992) Expression and characterization of a cDNA for rat kidney biliverdin reductase. Evidence suggesting the liver and kidney enzymes are the same transcript product. J. Biol. Chem. 267,4023-4029[Abstract/Free Full Text]
  25. Nakanishi, H., Brewer, K. A., Exton, J. H. (1993) Activation of the zeta isozyme of protein kinase C by phosphatidylinositol 3,4,5-trisphosphate. J. Biol. Chem. 268,13-16[Abstract/Free Full Text]
  26. Liu, Y. F., Paz, K., Herschkovitz, A., Alt, A., Tennenbaum, T., Sampson, S. R., Ohba, M., Kuroki, T., LeRoith, D., Zick, Y. (2001) Insulin stimulates PKCzeta-mediated phosphorylation of insulin receptor substrate-1 (IRS-1). A self-attenuated mechanism to negatively regulate the function of IRS proteins. J. Biol. Chem. 276,14459-14465[Abstract/Free Full Text]
  27. Farese, R. V., Sajan, M. P., Standaert, M. L. (2005) Insulin-sensitive protein kinases (atypical protein kinase C and protein kinase B/Akt): actions and defects in obesity and type II diabetes. Exp. Biol. Med. (Maywood) 230,593-605[Abstract/Free Full Text]
  28. Myers, M. G., Jr, Zhang, Y., Aldaz, G. A., Grammer, T., Glasheen, E. M., Yenush, L., Wang, L. M., Sun, X. J., Blenis, J., Pierce, J. H., White, M. F. (1996) YMXM motifs and signaling by an insulin receptor substrate 1 molecule without tyrosine phosphorylation sites. Mol. Cell Biol. 16,4147-4155[Abstract/Free Full Text]
  29. Puls, A., Schmidt, S., Grawe, F., Stabel, S. (1997) Interaction of protein kinase C zeta with ZIP, a novel protein kinase C-binding protein. Proc. Natl. Acad. Sci. U. S. A. 94,6191-6196[Abstract/Free Full Text]
  30. Cariou, B., Perdereau, D., Cailliau, K., Browaeys-Poly, E., Bereziat, V., Vasseur-Cognet, M., Girard, J., Burnol, A. F. (2002) The adapter protein ZIP binds Grb14 and regulates its inhibitory action on insulin signaling by recruiting protein kinase Czeta. Mol. Cell Biol. 22,6959-6970[Abstract/Free Full Text]
  31. Newton, A. C. (2001) Protein kinase C: structural and spatial regulation by phosphorylation, cofactors, and macromolecular interactions. Chem. Rev. 101,2353-2364[CrossRef][Medline]
  32. Hirai, T., Chida, K. (2003) Protein kinase Czeta (PKCzeta): activation mechanisms and cellular functions. J. Biochem. (Tokyo) 133,1-7[Abstract/Free Full Text]
  33. Hanks, S. K., Quinn, A. M., Hunter, T. (1988) The protein kinase family: conserved features and deduced phylogeny of the catalytic domains. Science 241,42-52[Abstract/Free Full Text]
  34. Hanks, S. K., Hunter, T. (1995) Protein kinases. The eukaryotic protein kinase superfamily: kinase (catalytic) domain structure and classification. FASEB J. 9,576-596[Abstract]
  35. Maines, M. D., Miralem, T., Lerner-Marmarosh, N., Shen, J., Gibbs, P. E. (2007) Human biliverdin reductase: A previously unknown activator of protein kinase C beta II. J. Biol. Chem. 282,8110-8122[Abstract/Free Full Text]
  36. Maines, M. D., Trakshel, G. M. (1993) Purification and characterization of human biliverdin reductase. Arch. Biochem. Biophys. 300,320-326[CrossRef][Medline]
  37. Williams, B., Schrier, R. W. (1993) Glucose-induced protein kinase C activity regulates arachidonic acid release and eicosanoid production by cultured glomerular mesangial cells. J. Clin. Invest. 92,2889-2896[Medline]
  38. Bell, J. E., Maines, M. D. (1988) Kinetic properties and regulation of biliverdin reductase. Arch. Biochem. Biophys. 263,1-9[CrossRef][Medline]
  39. Toker, A. (1998) Signaling through protein kinase C. Front. Biosci. 3,D1134-D1147[Medline]
  40. Balendran, A., Hare, G. R., Kieloch, A., Williams, M. R., Alessi, D. R. (2000) Further evidence that 3-phosphoinositide-dependent protein kinase-1 (PDK1) is required for the stability and phosphorylation of protein kinase C (PKC) isoforms. FEBS Lett. 484,217-223[CrossRef][Medline]
  41. Berra, E., Diaz-Meco, M. T., Dominguez, I., Municio, M. M., Sanz, L., Lozano, J., Chapkin, R. S., Moscat, J. (1993) Protein kinase C zeta isoform is critical for mitogenic signal transduction. Cell 74,555-563[CrossRef][Medline]
  42. Le Good, J. A., Ziegler, W. H., Parekh, D. B., Alessi, D. R., Cohen, P., Parker, P. J. (1998) Protein kinase C isotypes controlled by phosphoinositide 3-kinase through the protein kinase PDK1. Science 281,2042-2045[Abstract/Free Full Text]
  43. Kim, Y. B., Kotani, K., Ciaraldi, T. P., Henry, R. R., Kahn, B. B. (2003) Insulin-stimulated protein kinase C lambda/zeta activity is reduced in skeletal muscle of humans with obesity and type 2 diabetes: reversal with weight reduction. Diabetes 52,1935-1942[Abstract/Free Full Text]
  44. Wooten, M. W., Vandenplas, M. L., Seibenhener, M. L., Geetha, T., Diaz-Meco, M. T. (2001) Nerve growth factor stimulates multisite tyrosine phophorylation and activation of the atypical protein kinase C’s via src kinase pathway. Mol. Cell. Biol. 21,8414-8427[Abstract/Free Full Text]
  45. Moscat, J., Diaz-Meco, M. T. (2000) The atypical protein kinase Cs. Functional specificity mediated by specific protein adapters. EMBO Rep. 1,399-403[CrossRef][Medline]
  46. Moscat, J., Diaz-Meco, M. T. (2002) The atypical PKC scaffold protein P62 is a novel target for anti-inflammatory and anti-cancer therapies. Adv. Enzyme. Regul. 42,173-179[CrossRef][Medline]
  47. Kamiya, A., Gonzalez, F. J. (2004) TNF-alpha regulates mouse fetal hepatic maturation induced by oncostatin M and extracellular matrices. Hepatology 40,527-536[CrossRef][Medline]
  48. Szczesna-Skorupa, E., Chen, C. D., Liu, H., Kemper, B. (2004) Gene expression changes associated with the endoplasmic reticulum stress response induced by microsomal cytochrome p450 overproduction. J. Biol. Chem. 279,13953-13961[Abstract/Free Full Text]
  49. Rahman, A., Anwar, K. N., Malik, A. B. (2000) Protein kinase C-zeta mediates TNF-alpha-induced ICAM-1 gene transcription in endothelial cells. Am. J. Physiol. Cell Physiol. 279,C906-C914[Abstract/Free Full Text]
  50. Sanz, L., Sanchez, P., Lallena, M. J., Diaz-Meco, M. T., Moscat, J. (1999) The interaction of p62 with RIP links the atypical PKCs to NF-kappaB activation. EMBO J. 18,3044-3053[CrossRef][Medline]
  51. Duran, A., Diaz-Meco, M. T., Moscat, J. (2003) Essential role of RelA Ser311 phosphorylation by zetaPKC in NF-kappaB transcriptional activation. EMBO J. 22,3910-3918[CrossRef][Medline]
  52. Spitaler, M., Villunger, A., Grunicke, H., Uberall, F. (2000) Unique structural and functional properties of the ATP-binding domain of atypical protein kinase C-iota. J. Biol. Chem. 275,33289-33296[Abstract/Free Full Text]
  53. Hunter, T., Cooper, J. A. (1985) Protein-tyrosine kinases. Annu. Rev. Biochem. 54,897-930[Medline]
  54. Pawson, T., Nash, P. (2003) Assembly of cell regulatory systems through protein interaction domains. Science 300,445-452[Abstract/Free Full Text]
  55. Sun, R., Gao, P., Chen, L., Ma, D., Wang, J., Oppenheim, J. J., Zhang, N. (2005) Protein kinase C zeta is required for epidermal growth factor-induced chemotaxis of human breast cancer cells. Cancer Res. 65,1433-1441[Abstract/Free Full Text]
  56. Ohno, S., Nishizuka, Y. (2002) Protein kinase C isotypes and their specific functions: prologue. J. Biochem. (Tokyo) 132,509-511[Free Full Text]
  57. Korichneva, I., Hoyos, B., Chua, R., Levi, E., Hammerling, U. (2002) Zinc release from protein kinase C as the common event during activation by lipid second messenger or reactive oxygen. J. Biol. Chem. 277,44327-44331[Abstract/Free Full Text]
  58. Gschwendt, M., Kittstein, W., Marks, F. (1991) Protein kinase C activation by phorbol esters: do cysteine-rich regions and pseudosubstrate motifs play a role?. Trends Biochem. Sci. 16,167-169[CrossRef][Medline]



This article has been cited by other articles:


Home page
Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. C. Young, M. V. Storm, J. S. Speed, S. Kelsen, C. V. Tiller, T. Vera, H. A. Drummond, and D. E. Stec
Inhibition of biliverdin reductase increases ANG II-dependent superoxide levels in cultured renal tubular epithelial cells
Am J Physiol Regulatory Integrative Comp Physiol, November 1, 2009; 297(5): R1546 - R1553.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
N. Lerner-Marmarosh, T. Miralem, P. E. M. Gibbs, and M. D. Maines
Human biliverdin reductase is an ERK activator; hBVR is an ERK nuclear transporter and is required for MAPK signaling
PNAS, May 13, 2008; 105(19): 6870 - 6875.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF) Free
Right arrow Supplemental Data
Right arrow All Versions of this Article:
fj.07-8544comv1
21/14/3949    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lerner-Marmarosh, N.
Right arrow Articles by Maines, M. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lerner-Marmarosh, N.
Right arrow Articles by Maines, M. D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS