FASEB J. Avanti Polar Lipids
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.07-8159com.
(The FASEB Journal. 2007;21:3606-3617.)
© 2007 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.07-8159comv1
21/13/3606    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, W.
Right arrow Articles by Wan, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, W.
Right arrow Articles by Wan, Y.

The dual effects of Cdh1/APC in myogenesis

Wenqi Li, George Wu and Yong Wan1

Department of Cell Biology and Physiology, University of Pittsburgh School of Medicine and University of Pittsburgh Cancer Institute, Pittsburgh, Pennsylvania, USA

1Correspondence: University of Pittsburgh Cancer Institute, Hillman Cancer Center, Ste. 2.6C, 5117 Centre Ave., Pittsburgh, Pennsylvania 15213 USA. E-mail: yow4{at}pitt.edu


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Ubiquitin-dependent proteolysis plays an important role in regulating fundamental biological functions, including cell division and cellular differentiation. Previous studies implicate the ubiquitin-proteasome system (UPS) in myogenic differentiation through regulating cell cycle progression and modulating myogenic factors such as MyoD and Myf5. Certain ubiquitin protein ligases, including the SCF complex and APC, have been suggested to govern terminal muscle differentiation. However, the underlying mechanism of regulation of both the cell cycle and myogenic factors by the UPS during this process remains unclear. We have dissected the role of the UPS in myogenic differentiation using an in vitro muscle differentiation system based on C2C12 cells. We demonstrate that Cdh1-APC regulates two critical proteins, Skp2 and Myf5, for proteolysis during muscle differentiation. The targeting of Skp2 by Cdh1-APC for destruction results in elevation of p21 and p27, which are crucial for coordinating cellular division and differentiation. Degradation of Myf5 by Cdh1-APC facilitates myogenic fusion. Knockdown of Cdh1 by siRNA significantly attenuates muscle differentiation. Taken together, Cdh1-APC is an important ubiquitin E3 ligase that modulates muscle differentiation through coordinating cell cycle progression and initiating the myogenic differentiation program.—Li, W., Wu, G., Wan, Y. The dual effects of Cdh1/APC in myogenesis.


Key Words: Skp2 • Myf5 • ubiquitylation and muscle differentiation


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
MYOGENIC DIFFERENTIATION IS A COMPLEX of multiple cellular events that involves withdrawal of myoblasts from the cell cycle, expression of muscle-specific genes, myogenic fusion, and myofiber formation (1 2 3) .The regulatory role of the ubiquitin-proteasome system (UPS) has been implicated in many critical cellular processes, including cell division, development, signal transduction, and genomic integrity, as well as muscle differentiation (4 5 6 7 8 9 10 11) . In particular, the UPS has been suggested to play a critical role in coordinating the exit of myoblast proliferation and subsequent differentiation and activation of the differentiation program via proteolysis of myogenic factors such as MyoD and Myf5 (12 13 14) . The protein half-life of several critical cell cycle regulators, including Rb, p21, and E2F, which are required for the initiation of myogenic differentiation, is tightly regulated by the UPS (15 16 17) . MyoD and Myf5, two major bHLH proteins, are usually down-regulated by UPS after completion of cell fate determination or before the onset of myogenic differentiation (12 13 14) . Critical E3 ligases, such as SCF, have been suggested to govern MyoD protein degradation, while anaphase-promoting complex (APC) has been suggested to control Myf5 proteolysis during the lineage of muscle differentiation (12 , 13) . Although ubiquitin-dependent degradation of MyoD and Myf5 is biochemically linked to myogenesis, the exact mechanism by which the E3 ligase regulates the differentiation process is unclear. Moreover, the regulatory role of the UPS in governing the transition from cell division to differentiation awaits further investigation.

Our recent studies that systematically measure the protein profile during myogenic differentiation show that several proteins are significantly altered in a drastic manner suggesting proteolytic regulation (unpublished data). The most interesting proteins from this analysis that exhibit a dramatic reduction in levels during differentiation are Skp2 and Myf5. Skp2, a F-box protein, is the substrate-specific subunit of the SCF (Skp1-Cul1-F-box protein) ubiquitin ligase complex that has been demonstrated to govern the G1/S cell cycle transition (18 , 19) . The biochemical function of Skp2 is to ubiquitylate p27 for degradation; thus, regulating ubiquitin-dependent alteration of p27 is crucial for cell cycle arrest and differentiation (20 , 21) . In association with SCF complex, Skp2 additionally targets p21 for proteolysis, thereby regulating G1/S progression (22 , 23) . During the cell cycle, Skp2 protein levels are regulated by APC in association with its substrate-specific factor, Cdh1 (18 , 19) . Recent studies by us and others highly suggest a potential function of Cdh1 in cellular differentiation, especially in muscle development that is supported by the specific expression pattern of Cdh1 in somite and skeleton muscle (24 25 26) . However, the targets of Cdh1 that govern myogenesis remain unknown. Given the notion that Myf5 is down-regulated by APC, the central question that must be addressed is whether Cdh1 is the substrate recognition factor orchestrating APC in regulating Myf5 during myogenic differentiation. Therefore, we dissected the function of Cdh1/APC in myogenesis.

To address the role of Cdh1/APC in muscle differentiation, we engineered a Cdh1 depleted myoblast cell line. The comparison of the protein profiles of control and Cdh1 mutant cells during myogenic differentiation coupled with subsequent biochemical analysis, has led to the identification of two Cdh1 substrates required for myogenesis. Our work demonstrates that Cdh1, in association with APC, is a critical component that governs myogenic differentiation through its interaction with substrates Skp2 and Myf5. Furthermore, targeting Skp2 for degradation is important for withdrawal of myoblasts from the cell cycle, while proteolysis of Myf5 contributes to myogenic fusion.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Plasmids and constructs
Skp2 was engineered by PCR using the following primers: 5'AAAATCGATATGCACAGGAAGCACCTCCAG3' 5'TTGGCGCGCCTAGACAACTGGGCTTTTGCAG3' and then cloned into pCS2-HA, a mammalian expression vector.

Skp2{Delta}db (D-box deleted Skp2) was generated by deleting amino acids 1–11 using a PCR-based approach. The primers used for constructing this mutant are as follows:

5' AAAAATCGATATGCTGAGTAGCAACGTTGCCACC 3'

5' TTGGCGCGCCTAGACAACTGGGCTTTTGCAGTGTC3'.

pREX-IRES-GFP and pREX-IRES-CD2 are gifts from Dr. Xuedong Liu (University of Colorado, Boulder). pREX-HA-Skp2-IRES-CD2 and pREX-HA-Skp2{Delta}db-IRES-CD2 were generated by PCR using the following primers:

5'AAAAGTCGACCCACAGGAAGCACCTCCAGGAG3'

5'TTGCGGCCGC TCATAGACAACTGGGCTTTTG3'

Myf5 was engineered by PCR using the following primers:

5'AAAAATCGATACCATGGACATGACGGACGGCTGCCAG3'

5'TTGGCGCGCC TAATACGTGATAGATAAGTCTGGAGCT3' and then cloned into pCS2-HA, a mammalian expression vector.

Myf5{Delta}db (D-box deleted Myf5) was generated using the following primers:

5'CTCGCGCATGGTGGCGGCCTTGCG3'

5'AAGGCCGCCACCATGCGCGAGAAGAAGGTCAACCAAGCTTTCGAG3'

pREX-HA-Myf5-IRES-GFP and pREX-HA-Myf5{Delta}db-IRES-GFP were generated by PCR using the following primers:

5'CTCAGGAATGCCATCCGCTACATTGA3'

5'CAATCCAAGCTGGACACGGAGCTTTT3'

Antibodies
Western blot analysis was performed using the following antibodies: anti-Cul1 (Santa Cruz Biotechnology, Santa Cruz, CA, USA), anti-Myf5 (Santa Cruz), anti-PIK (Santa Cruz), anti-Cdc25A (Santa Cruz), anti-APC2 (Abcam), anti-Cdh1 (Abcam, Cambridge, MA, USA), anti-Cyclin B (Chemicon, Temecula, CA, USA; Sigma, St. Louis, MO, USA), anti-Cdc2 (Abcam), anti-Wee1 (Abcam), anti-Cdc25C (Santa Cruz), anti-Cdc20 (Abcam), anti-Cdc27 (Stratagene, La Jolla, CA, USA), anti-Mad1 (Novus, Littleton, CO, USA), anti-Mad2 (Santa Cruz), anti-Tubulin (Calbiochem, San Diego, CA, USA), antip27 (R&D, Minneapolis, MN, USA), antip21 (R&D), antip15 (Abcam), antip16 (Abcam), anti-Rb (Abcam), antip53 (Calbiochem), anti-Brca1 (Abcam), anti-Bard1 (Abcam), anti-Brca2 (Abcam), anti-alpha-B Crystallin (Novus), anti-Lipoxygenase 15 (Cayman, Ann Arbor, MI, USA), anti-SnoN (Santa Cruz), anti-Skp2 (Zymed, Burlingame, CA, USA), anti-Casein Kinase II (Abcam), and anti-Casein Kinase I (Abcam), antiphospho-Histone H3 (Upstate Biotechnology, Lake Placid, NY, USA), anti-MHC monoclonal antibody MF20 (Developmental Studies Hybridoma Bank, IA). Semiquantification of Western blotting data was performed by using a densitometer (Molecular Dynamics, Sunnyvale, CA, USA).

Construction of Cdh1-siRNA stable expressing cell lines
Three constructs have been engineered: (1) pSUPER-Cdh1-N (amino acid 266–286), (2) pSUPER-Cdh1-C (amino acid 566–586), and (3) pSuper-Scramble (firefly luciferase siRNA) (18) . siRNA-Cdh1 retrovirus was packaged by transfecting siRNA-Cdh1 constructs into Phoenix cells using Lipofectamine 2000 (Invitrogen). C2C12 cells were infected with the virus, and positive clones were selected in the presence of puromycin (4 µM) containing medium.

Coimmunoprecipitation assay
Myc-Cdh1/HA-Myf5 and Myc-Cdh1/HA-Skp2 were cotransfected using Lipofectamine 2000 (Invitrogen) into C2C12 cells. Twenty-four hours after transfection, the C2C12 cells were induced and cells were collected at certain time points. HA-Skp2 or HA-Myf5 complex was pulled down using an anti-HA antibody coupled to protein A/G beads (Roche, Indianapolis, IN, USA). Interaction between Skp2 and Cdh1 or Myf5 and Cdh1 was judged by protein immunoblotting with anti-HA and anti-Myc antibodies.

In vivo ubiquitylation assay
HA-tagged wild-type Skp2 and D-box mutated Skp2 with Myc-tagged ubiquitin or HA-tagged wild-type Myf5 and D-box mutated Myf5 with Myc-tagged ubiquitin were cotransfected using Lipofectamine 2000 (Invitrogen) into control cells or Cdh1-depleted C2C12 cells. Twenty-four hours after transfection, the C2C12 cells were induced and cells were collected at certain time points. HA-Skp2 or HA-Myf5 complex was pulled down using an anti-HA antibody coupled to protein A/G beads. Polyubiquitylated Skp2 and Myf5 were then detected using an anti-Myc antibody.

In vitro protein degradation assay
35S-labeled HA tagged human Skp2/Skp2{Delta}db and Myf5/Myf5{Delta}db proteins were synthesized using the TNT expression system (Promega, Madison, WI, USA). Approximately 10 ng of IVT-Skp2/Skp2{Delta}db and Myf5/Myf5{Delta}db were added to 20 µl extracts prepared from C2C12 cells supplemented with the degradation cocktail (1.25 mg/ml ubiquitin, 1x energy regeneration, 0.1 mg/ml cycloheximide). Cell extracts for the Skp2 degradation assay were prepared from C2C12 cells harvested at 24 h after induction, while cell extracts for the Myf5 degradation assay were collected at 48 h after induction. Aliquots were removed at different times and resolved by SDS-PAGE and autoradiography (27) .

Immunofluorescence
Cells were grown in induction medium of 2% horse serum. Following induction and PBS wash, cells were fixed immediately in 4% paraformaldehyde for 10 min. After fixation and PBS wash, cells were permeabilized with 1% Triton X-100 in PBS for 30 min at room temperature. Cells were then incubated overnight at 4°C with primary antibodies diluted in blocking buffer. After PBS wash, the cells were incubated with secondary antibodies coupled with Texas Red (Jackson ImmunResearch Laboratories, Inc., West Grove, PA, USA), or Cy2 (Jackson ImmunoResearch Laboratories, Inc.) for 1 or 2 h. The cells were stained with DAPI (1:1000 dilution of 1 mg/ml stock) and were analyzed by microscopy.

BrdU incorporation assay
BrdU (5-bromo-2'-deoxy-uridine) incorporation assay was performed according to the manufacturer’s protocol (Roche Molecular Biochemicals, Indianapolis, IN, USA) followed by analysis of the mean fluorescence intensity per (28) .


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Alteration of protein profiles during myogenic differentiation of C2C12 cells
Myogenesis requires a series of cellular processes, including the initial commitment to myogenesis that requires the expression of early myogenic factors, the withdrawal of the myoblast from the cell cycle, the activation of the transcriptional program expressing subsequent myogenic specific factors and ultimately, terminal differentiation to yield a multinucleated myofiber (29 , 30) . Several critical signaling pathways, including FGF2, TGF-beta, Shh, Wnts, Bmp, Notch, and IGF, have been demonstrated to be involved in myogenic differentiation (1 , 29) . The significant roles of several proteins, including cell cycle positive regulators, cell cycle inhibitors, and several crucial myogenic factors, have also been identified in the process of muscle differentiation (2 , 31) . More recent functional genomic and proteomic studies have implicated the importance of the UPS in muscle differentiation (32 33 34) . However, the regulatory circuitry of the UPS that modulates myogenic differentiation is not well understood. To thoroughly assess the critical role of the UPS in governing muscle differentiation, we have conducted an analysis of the protein expression profile during myoblast to myofiber differentiation using C2C12 cells.

C2C12 cells are myoblasts that can differentiate into multinucleated myofibers when grown in induction medium (2% horse serum) (Fig. 1 A) (35) . To monitor the profiles of certain cell cycle regulators, signaling molecules, and transcriptional regulators, which are potentially involved in muscle differentiation, we have measured the abundance of candidate proteins before and after 48 h of induction by immunoblotting. As shown in Fig. 1B-D , the levels of several proteins exhibit dramatic alterations during myogenic differentiation. Among the proteins tested that promote cell cycle progression, the protein levels of Cdc25A, Cdc25C, and Cdh1 are increased after induction, while the protein levels of cyclin B, Cdc2, Wee1, and Skp2 are reduced (Fig. 1B ). In contrast, immunoblots for proteins that inhibit cell cycle progression, including p21, p27, p15, p16, and Rb, are increased following induction (Fig. 1C ). The immunoblots for proteins implicated as signaling molecules or components involved in transcriptional regulation that are altered, included Myf5 and SnoN, which show decreased expression, and alpha B-crystallin, which show increased expression (Fig. 1D ). The altered expression of these profiled proteins provides a valuable clue to dissect the underlying mechanism of muscle differentiation, especially in terms of its regulation by proteolysis.


Figure 1
View larger version (38K):
[in this window]
[in a new window]

 
Figure 1. Analysis of the protein expression profile during myotube formation in a cell culture system. A) Cell culture system for myogenic differentiation. C2C12 myoblast cells were induced with 2% horse serum for 48 h. C2C12 cells exhibited elongation of cellular length and multinucleation. DAPI-staining for nuclei is seen as blue and tubulin-staining showing cellular contour is seen as green. B) Alteration in the protein expression of positive cell cycle regulators before and after induction of C2C12 cells is shown in the graph. C) Graph showing the relative alternation of protein expression of negative cell cycle regulators before and after induction of C2C12 cells. D) Graph displaying the analysis of the protein expression of signaling molecules, transcriptional regulators, and other related proteins before and after induction of C2C12 cells.

Cdh1/APC is involved in myogenic differentiation of C2C12 cells
Among the above examined proteins, Skp2 and Myf5 show dramatic alteration in response to myogenic induction (Fig. 1B, D ). Previous studies have shown that Skp2 is a critical protein that antagonizes cell cycle arrest via degradation of p21, as well as p27 (21 22 23) . Skp2 is required for ubiquitin-mediated degradation of the CDK inhibitors p21 and p27 (21 22 23) . Turnover of Skp2 is controlled by Cdh1/APC (18 , 19) . Besides Skp2, Myf5, a critical myogenic factor, is also tightly regulated by the UPS, especially through the APC pathway, although it should be noted that the activator that associates with APC was unknown until this study (13) . These data, therefore, support a potential role of Cdh1/APC in the control of myogenesis. To assess the significance of Cdh1/APC in myogenic differentiation, we examined the function of Cdh1/APC in muscle differentiation.

To demonstrate that Cdh1/APC is a critical E3 ligase in the regulation of muscle differentiation, we stably depleted Cdh1 by siRNA knockdown in C2C12 cells (Fig. 2 A) (36) . As shown in Fig. 2B-E , depletion of Cdh1 significantly retarded cellular elongation and myogenic fusion resulting in the abrogation of myofiber formation (37) . These data suggest the importance of Cdh1/APC as a critical E3 ligase in facilitating myogenic differentiation.


Figure 2
View larger version (34K):
[in this window]
[in a new window]

 
Figure 2. Cdh1/APC is involved in muscle differentiation. A) Selection of stable Cdh1 siRNA clones in C2C12 cells. B) Depletion of Cdh1 by siRNA impedes myotube differentiation as seen by the failure in the appearance of the morphological phenotype of cellular elongation and multinucleation in comparison with wild-type C2C12 (staining with DAPI and tubulin). C) Disruption of Cdh1 by siRNA abrogates myotube differentiation as detected by immunostaining with antibody MF20 reactive with MHC in both scramble and Cdh1 siRNA cells. D) Graph showing the increase in MF20 positive cells following induction of scramble siRNA C2C12 cells or Cdh1-depleted C2C12 cells. E) Graph showing the increase in fusion index following induction of scramble siRNA C2C12 cells or Cdh1-depleted C2C12 cells. Calculation of fusion index as percent cells containing two or more nuclei within differentiated myotube.

Withdrawal of myoblasts from the cell cycle is one of the hallmarks of myogenic terminal differentiation. To evaluate the cell cycle status of control cells, as well as Cdh1-depleted cells following induction, we measured cellular proliferation rates as reflected by both BrdU incorporation and phospho-histone3 positive immunostaining (38 , 39) . As shown in Fig. 3 A–D, 48 h after induction, less than 5% of control cells were BrdU-positive compared with ~25% of cells labeled before induction. The reduced labeling by BrdU application reflects cell cycle arrest most likely in G1. In contrast, depletion of Cdh1 completely abrogated cell cycle arrest as demonstrated in Fig. 3B and D . To confirm the result from the BrdU analysis, we also analyzed the relative number of mitotic cells before and after induction as demonstrated in Fig. 3E-H . The number of phospho-histone3 positive cells decreased after induction of control cells but not Cdh1-depleted cells.


Figure 3
View larger version (49K):
[in this window]
[in a new window]

 
Figure 3. Cdh1 is required for cell cycle arrest of C2C12 cells following induction. A) Scramble siRNA C2C12 cells exhibit progressively less BrdU positive cells 48 h after induction. B) Cdh1 siRNA C2C12 cells exhibit relatively consistent numbers (or proportion) of BrdU positive cells 48 h after induction. C) Graph showing decrease in the percentage of BrdU positive scramble siRNA C2C12 cells after induction. D) Graph showing relatively consistent percentage of BrdU positive Cdh1 siRNA C2C12 cells after induction. E) Scramble siRNA C2C12 cells exhibit progressively less phospho-histone3 positive cells 48 h after induction. F) Cdh1 siRNA-treated C2C12 cells exhibit relatively consistent numbers of phospho-histone3 positive cells 48 h after induction. G) Graph showing decrease in the percentage of phospho-histone3 positive scramble siRNA C2C12 cells after induction. H) Graph showing relatively consistent percentage of phospho-histone3 positive Cdh1 siRNA-treated C2C12 cells on induction conditions.

Proteolysis of Skp2 and Myf5 in response to myogenic induction requires Cdh1/APC
This present analysis of the protein profiles before and after myogenic induction shows the dramatic alteration of several proteins, including Skp2, Myf5, p21, and p27. The regulation of these proteins by the APC pathway has been previously implicated. The Skp2 protein is targeted by Cdh1/APC for degradation, which results in the elevation of p27, thereby regulating G1/S transition (18 , 19) . Protein stability of p21 is also governed by Skp2 in association with the SCF complex (22 , 23) . In addition, fluctuations of Myf5 during the cell cycle is regulated by APC (13) . This evidence strongly suggests that the importance of Cdh1/APC in myogenesis is through regulating Skp2, Myf5, p21, and p27. To dissect the molecular mechanism by which Cdh1/APC regulates myogenesis, we carefully monitored the protein levels of Skp2, Myf5, p21, and p27 at different times following induction in both control cells and Cdh1-depleted cells. As shown in Fig. 4 A, B, Skp2 levels are reduced by approximately four-fold within one day of induction but are stable in response to induction in Cdh1-depleted cells (Fig. 4A, Ba ). Myf5 levels are also drastically reduced, by approximately four-fold, within the two days following induction, and remain stable in Cdh1-depleted cells (Fig. 4A, Bb ). On Skp2 protein degradation following induction, the protein levels for both p21 and p27 are significantly increased in control cells but not in Cdh1-depleted cells, as demonstrated in Fig. 4A, Bc, Bd . In combination with previous physiological analysis (Fig. 2) , our data suggest that Cdh1/APC plays an important role in governing myogenesis through regulating the Skp2-p21-p27 cascade, as well as the myogenic factor, Myf5.


Figure 4
View larger version (22K):
[in this window]
[in a new window]

 
Figure 4. Time course for the degradation of Skp2 and Myf5 and accumulation of p27 and p21 following muscle differentiation. A) Both protein levels for Skp2 and Myf5 decreased following induction coupled with concomitant increase in the expression of p27 and p21. The rate of Skp2 protein levels dramatically decreased within the day following induction, while the drop in Myf5 protein levels is slightly slower, showing significant decreases within 2 d after induction. Both p27 and p21 showed noticeable increases within the day following induction. Cdh1-depleted C2C12 cells showed no noticeable alteration for Skp2, Myf5, p27, and p21. B) Quantification of protein alterations during myogenic differentiation. a) Graph showing the protein levels of Skp2 in scramble siRNA cells and Cdh1 siRNA-treated cells. b) Graph showing the protein levels of Myf5 in scramble siRNA cells and Cdh1 siRNA-treated cells. c) Graph showing the protein levels of p21 in scramble siRNA cells and Cdh1 siRNA-treated cells. d) Graph showing the protein levels of p27 in scramble siRNA cells and Cdh1 siRNA-treated cells.

Mechanism by which Skp2 and Myf5 are ubiquitylated via Cdh1/APC E3 ligase
This present result has suggested a dual involvement of Cdh1/APC in myogenesis through targeting of Skp2 or Myf5 for degradation. To demonstrate biochemically the interaction between Cdh1 with either Skp2 or Myf5, we cotransfected Myc-tagged Cdh1 along with HA-tagged Skp2 or HA-tagged Myf5 into C2C12 cells. Cells were harvested at different time points following induction as indicated in Fig. 5 A, B. Interaction between Cdh1 and either Skp2 or Myf5 were examined by immunoprecipitation using antibody against HA. Immunocomplexes were resolved by SDS-PAGE. Cdh1 binding to Skp2 or Myf5 was detected by immunoblotting. As shown in Fig. 5A, B , Cdh1 shows significant interaction with Skp2 approximately 8 h after induction, while Cdh1 shows similarly efficient interaction with Myf5 between 12 to 24 h after induction. Colocalization results, as indicated in Fig. 5C , further support the interaction between Cdh1 and either Skp2 or Myf5 in response to myogenic induction.


Figure 5
View larger version (24K):
[in this window]
[in a new window]

 
Figure 5. Mechanism by which Skp2 and Myf5 are ubiquitylated by Cdh1/APC E3 ligase. A) Physical interaction between Myc-Cdh1 and HA-Skp2 following induction. Immunoprecipitation of Skp2 using anti-HA followed by immunoblotting using anti-HA(Skp2) and anti-Myc (Cdh1). B) Physical interaction between Myc-Cdh1 and HA-Myf5 following induction. Immunoprecipitation of Myf5 using anti-HA followed by immunoblotting using anti-HA(Myf5) and anti-Myc (Cdh1). C) Nuclear colocalization of Cdh1, Skp2, and Myf5 as visualized by immunocytochemistry. D) Destruction box motif (RXXLXXXXD/N) is present in various substrates of Cdh1/APC: Myf5, Skp2, Cyclin B and Securin. E) Ubiquitylation assay for Skp2. HA-Skp2 or HA-Skp2{Delta}db cotransfected with Myc-Ub. Immunoprecipitation of Skp2 followed by immunoblotting with anti-Myc to detect polyubiquitylation. F) Ubiquitylation assay for Myf5. HA-Myf5 or HA-Myf5{Delta}db cotransfected with Myc-Ub. Immunoprecipitation of Myf5 followed by immunoblotting with anti-Myc to detect polyubiquitylation. G) In vitro cell-free degradation assay of in vitro translated Skp2, Skp2{Delta}db, Myf5, and Myf5{Delta}db incubated with C2C12 lysates made from induced cells. H) Graph showing the relative rate of degradation for Skp2, Skp2{Delta}db, Myf5, and Myf5{Delta}db in the in vitro cell-free degradation assay.

To elucidate the biochemical mechanism by which Skp2 and Myf5 are ubiquitylated in response to myogenic induction, we performed Skp2 and Myf5 ubiquitylation assays in cultured C2C12 cells. Previous studies have demonstrated that most substrates of APC bear a D-box recognition motif. Skp2 and Myf5 both contain a conserved D-box motif through which the degradation of Skp2 and Myf5 is probably mediated (Fig. 5D ) (40 41 42 43 44) . To analyze the role of the D-box in Skp2 and Myf5 ubiquitylation/degradation, we constructed D-box mutated Skp2 and Myf5. To demonstrate that Skp2 and Myf5 are polyubiquitylated in response to induction, we cotransfected HA-tagged wild-type Skp2 and D-box mutated Skp2 with Myc-tagged ubiquitin or HA-tagged wild-type Myf5 and D-box mutated Myf5 with Myc-tagged ubiquitin into control or Cdh1-depleted C2C12 cells. The Skp2 and the Myf5 immunocomplex were pulled down using an anti-HA antibody coupled to protein A/G beads. Polyubiquitylated Skp2 and Myf5 were then detected using an anti-Myc antibody as shown in Fig. 5E, F . Skp2 is significantly ubiquitylated within 8 h after induction, while Myf5 is ubiquitylated within 24 h after induction. Mutation of the D-box in both Skp2 and Myf5 blocked formation of the polyubiquitin chain in Skp2 and Myf5 (Fig. 5E, F ). Furthermore, depletion of Cdh1 by siRNA abolished the attachment of ubiquitin to Skp2 and Myf5 in response to induction (Fig. 5E, F ).

To further analyze the degradation of Skp2 and Myf5 in response to induction and to dissect the function of the D-box located on both Skp2 and Myf5, we established a cell-free protein degradation assay (27) . As shown in Fig. 5G, H , either Skp2 or Myf5 is significantly degraded in extracts prepared from induced C2C12 cells, while neither D-box mutated Skp2 nor Myf5 is degraded under similar conditions. Taken together, our results suggest that Cdh1/APC serves as an E3 ligase by degrading Skp2 and Myf5 at different times after myogenic induction. Degradation of both Skp2 and Myf5 is mediated by recognition of the D-box motif.

Expression of nondegradable Skp2 or Myf5 blocks myogenic differentiation
The above experiments suggest that degradation of Skp2 and Myf5 is necessary for myogenic differentiation. To examine the physiological consequence of the degradation of Skp2 and Myf5, we next explored whether the expression of nondegradable Skp2 or Myf5 would interfere with muscle differentiation. Data from our present study suggest that both Skp2 and Myf5 are targeted by Cdh1 via a recognition motif, the D-box, because deletion of the D-box in Skp2 and Myf5 stabilized the expression of Skp2 and Myf5. To test whether expression of nondegradable Skp2 and Myf5 would result in abrogation of myogenic differentiation, we engineered constructs for Skp2, Skp2{Delta}db, Myf5, and Myf5{Delta}db based on a retroviral expression system (Fig. 6 A) (45) . In this system, CD2 under the control of IRES (Internal Ribosomal Entry Site) is linked to Skp2 or Skp2{Delta}db, while GFP under the control of IRES is linked to Myf5 and Myf5{Delta}db. Cells stably expressing Skp2 or Skp2{Delta}db and Myf5 or Myf5{Delta}db cells were selected by rapid sorting of either CD2 or GFP positive cells. Protein levels of wild-type Skp2 or nondegradable Skp2 and wild-type Myf5 or nondegradable Myf5 were measured (Fig. 6B ) showing that the protein levels of both wild-type Skp2 and wild-type Myf5 dropped after induction, while neither nondegradable Skp2 nor Myf5 exhibited noticeable degradation. As shown in Fig. 6C-H , stable expression of nondegradable Skp2 and Myf5 significantly blocked cellular elongation and myogenic fusion. In addition, BrdU staining analysis showed that expression of nondegradable Skp2 resulted in a failure to achieve cell cycle arrest during myogenic differentiation for C2C12, further suggesting the role of Skp2 in coordination of myogenic differentiation via regulating cell cycle progression. Taken together, the above results suggest that degradation of Skp2 and Myf5 at different time points in myogenic differentiation is necessary for myogenesis.


Figure 6
View larger version (40K):
[in this window]
[in a new window]

 
Figure 6. Expression of nondegradable Skp2 or Myf5 inhibits muscle differentiation. A) Diagram of retroviral vector expressing wild-type Skp2 and Myf5 and nondegradable Skp2 and Myf5. B) Protein levels of stably expressed wild-type and nondegradable Skp2 and wild-type and nondegradable Myf5 after myogenic induction. C) Expression of nondegradable Skp2 blocks myotube differentiation as detected by staining with DAPI and MF20 antibody. D) Expression of nondegradable Myf5 impedes myotube differentiation as seen by immunostaining with DAPI and MF20 antibody. E) Graph showing the abrogation of fusion index in cells stably transfected with either nondegradable Skp2 or nondegradable Myf5. F) Expression of nondegradable Skp2 causes failure of cell cycle arrest for myogenic differentiation of C2C12 cells as indicated using BrdU staining. G) Graph showing the decrease in percentage of BrdU positive cells after induction. H) Graph showing relative consistent percentage of BrdU positive cells with stable expression of nondegradable Skp2 after induction.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Integration of Cdh1/APC function within the paradigm of myogenesis
Myogenesis consists of multiple events. These myogenic events involve several critical signaling pathways, including FGF2, TGF-beta, Shh, Wnts, Bmp, Notch, as well as IGF signaling (1 , 29) . A cluster of important molecules, such as MyoD family members (MyoD, Myf5, myogenin, Mrf4), as well as Rb, p21, E2F, Cyclin D1, Pax3, Pax7, PKC, c-Jun, and ID family proteins, have been shown to play important roles governing terminal myogenic differentiation (2 , 15 , 17 , 29 , 30 , 32 , 46) . Among these molecules, MyoD family proteins are key proteins, with MyoD and Myf5 being critical for specifying early cell fate determination, while myogenin and Mrf4 are involved in later differentiation and maturation of the myotube (16) . Coordinated arrest of cell cycle by the degradation of positive cell cycle regulators and the elevation of levels of several critical CKIs, are pivotal steps necessary to initiate differentiation (3 , 31) . Previous studies by us and others have implicated a potential role for Cdh1 in muscle differentiation (24 , 26) . To investigate the role of Cdh1 in muscle differentiation and further identify Cdh1 substrates during the myogenic process, we carried out a loss-of-function analysis based on the RNA interference of Cdh1 transcripts coupled with the analysis of the protein profile during myogenesis. The result from this study has revealed a novel regulatory mechanism for Cdh1/APC in the proteolytic regulation of two crucial proteins, Skp2 and Myf5, during myogenesis. Degradation of Skp2 by Cdh1/APC allows for accumulation of p21 and p27, thereby achieving withdrawal from cell cycle, while destruction of Myf5 by Cdh1/APC decreases the basal level of Myf5 necessary for myogenic fusion (Fig. 7 ).


Figure 7
View larger version (16K):
[in this window]
[in a new window]

 
Figure 7. Model for the role of Cdh1/APC in mediating muscle differentiation. Cdh1/APC, a critical ubiquitin E3 ligase, plays an important role in muscle differentiation. Cdh1/APC targets Skp2 for degradation resulting in elevation of p21 and p27, thereby facilitating withdrawal from the cell cycle. Cdh1/APC targets Myf5 for destruction leading to myogenic differentiation.

Degradation of Skp2 by Cdh1/APC is necessary to facilitate myogenesis through regulation of CKIs
Regulated proteolysis has been viewed as an important mechanism for the regulation of cellular differentiation (8 , 14) . APC, a multifunctional E3 ligase, has been demonstrated to control cell cycle progression and some developmental events (24 25 26 , 47) . The function of APC has been initially examined in the control of chromatid separation during mitosis through the destruction of securin (48) . Activation of APC is via WD40 family members, including Cdc20 and Cdh1 with Cdc20 activating APC during mitosis and Cdh1 governing APC activity in G1 (49 , 50) . Studies based on mouse and chicken systems have suggested that Cdh1, in association with APC, has a role in muscle development although the underlying mechanism remains unknown (24 , 26) . Utilizing an RNAi interference approach, we have demonstrated that Cdh1/APC is required for myogenesis. Furthermore, we have identified that Skp2 is the substrate for Cdh1/APC during myogenesis. Using biochemical and immunocytochemical analysis, we have elucidated the mechanism by which Cdh1/APC targets Skp2 for degradation. Degradation of Skp2 is mediated by a D-box recognition motif. Our results suggest that Cdh1/APC is up-regulated in response to induction. Cdh1/APC is utilized under these circumstances to coordinate cell cycle progression by the proteolysis of Skp2, an E3 ligase, which controls protein stability of p21 and p27. Destruction of Skp2 results in up-regulation of p21 and p27 achieving cell cycle arrest via rebalancing negative regulators with the positive regulators of cell cycle (31) .

Although we have shown that Cdh1/APC is required for myogenesis, the mechanism by which APC is regulated in response to an induction environment (certain signaling) still remains to be elucidated. Although our BrdU and phospho-histone3 analyses have demonstrated that Cdh1 is important in determining the status of cell proliferation/differentiation, no suitable system is available to precisely study the cell cycle arrest controlled by Cdh1/APC. Other than p21 and p27, additional cell cycle proteins such as Rb, E2F, cyclin D1 are also critical in cell cycle arrest. How p21 and p27, regulated by the Cdh1/APC-Skp2 cascade, are coordinated with the above cell cycle regulators needs to be further studied. Currently, we have engineered C2C12 cells that stably express Cdh1-TAP (Tandem Affinity Purification), which would allow a comprehensive identification of potential interacting proteins as members of a purified Cdh1 complex. Identification of key interacting proteins in association with Cdh1 during myogenic differentiation would significantly enhance our understanding of the role and regulation of Cdh1/APC during myogenesis.

Targeting Myf5 for degradation by Cdh1/APC ensures myogenic differentiation
Mouse studies, in combination with biochemical studies, have demonstrated that four MyoD family proteins, which includes MyoD, Myf5, myogenin, and Mrf4, are key factors in facilitating muscle differentiation (29) . During initial embryogenesis, early myogenic factors determine the cell fate of somites to become muscle progenitors (myoblasts). Withdrawal of myoblasts from the cell cycle is necessary for subsequent myogenic differentiation. Late-stage myogenic factors ensure myogenic differentiation and the further maturation of myotubes. Previous studies have demonstrated that MyoD and Myf5 are early myogenic factors specifying cell fate, while myogenin and Mrf4 are involved in later events necessary for differentiation (16) . Immunohistological analysis has demonstrated that Myf5 is only present in proliferating progenitor cells, while MyoD continues to be present in postmitotic differentiated muscle (51) . Prolonged expression of Myf5 disrupts the initiation of myogenic differentiation (52) . This information implicates the importance of the down-regulation of Myf5 on the completion the essential role of Myf5 in cell-fate determination. This down-regulation is very likely a vital requirement for subsequent events in myogenic differentiation. In this study, we have demonstrated a novel mechanism of Cdh1/APC targeting Myf5 for destruction that results in the maintenance of lower basal expression of Myf5. Thus, lower Myf5 expression is necessary for continued muscle differentiation. Previous studies have also shown that expression of the Myf5 transcript is maintained at similar levels during myogenesis (53) . Given the notion that Myf5 is down-regulated during myogenic differentiation, the ubiquitin-dependent proteolysis seems to serve an important role ensuring down-regulation of Myf5. Our results have proven that the UPS is an important system orchestrating Myf5 protein levels and therefore regulating muscle differentiation. Although our biochemical study has demonstrated that Cdh1/APC targets both Skp2 and Myf5, our physiological experiments based on Cdh1 knockdown are still not able to differentiate the dual effect of Cdh1/APC on cell cycle arrest and myogenic fusion at this time. A suitable system needs to be developed to further clarify this question in future studies.

UPS provides a critical regulatory mechanism modulating the molecular network of myogenesis
The UPS plays an important role in the control of many critical cellular processes (54) . The biological function of the UPS has been extensively investigated in the regulation of cell cycle, while its role in subsequent development remains less well understood. The UPS has attracted substantial interest especially in the coordination of cell division with cellular differentiation, and in the regulation of transcription during early embryogenesis (8 , 55 56 57) . Muscle differentiation is a relatively well-studied process, which provides an ideal system to study the function of the UPS in regulating differentiation. Functional proteomics and genomics studies based on C2C12 cells have illuminated the importance of the UPS in regulating molecular networks that govern myogenesis, with many components of the UPS machinery significantly altered in response to myogenic differentiation (32 33 34) . Proteolytic regulation of E2F and cyclin D1 is necessary for myoblast withdrawal from the cell cycle (58 , 59) . Modulation of myogenic factors by the UPS, including MyoD and Myf5, have been demonstrated during cell cycle progression and differentiation in myoblasts (12 , 13) . Degradation of ß-catenin by Ozz-E3 ligase is important in myofibrillogenesis (60) . In addition, MuRF1 and MAFbx were shown to be important in skeletal muscle atrophy (61 , 62) . Identification of Cdh1/APC in myogenesis reveals a novel regulatory circuitry of the UPS in modulating myogenic differentiation.


   ACKNOWLEDGMENTS
 
We thank Drs. X. Liu, A. Weissman, D. Zhang, and M. W. Kirschner for cDNA clones. We are grateful to Drs. X. Xiao and Yong Li for the cell lines. We appreciate Dr. W. Liu’s technical support. We appreciate Dr. S. Glickstein and members of the Wan lab for critical reading of the manuscript. This work is supported by NIH grants CA115943 and GM070681. Y. Wan is a scholar of American Cancer Society and V Cancer Research Foundation.

Received for publication February 1, 2007. Accepted for publication May 17, 2007.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Bassel-Duby, R., Olson, E. N. (2006) Signaling pathways in skeletal muscle remodeling. Annu. Rev. Biochem. 75,19-37[CrossRef][Medline]
  2. Olson, E. N. (1992) Interplay between proliferation and differentiation within the myogenic lineage. Dev. Biol. 154,261-272[CrossRef][Medline]
  3. Lassar, A. B., Skapek, S. X., Novitch, B. (1994) Regulatory mechanisms that coordinate skeletal muscle differentiation and cell cycle withdrawal. Curr. Opin. Cell Biol. 6,788-794[CrossRef][Medline]
  4. Vodermaier, H. C. (2004) APC/C and SCF: controlling each other and the cell cycle. Curr. Biol. 14,R787-796[CrossRef][Medline]
  5. Busino, L., Donzelli, M., Chiesa, M., Guardavaccaro, D., Ganoth, D., Dorrello, N. V., Hershko, A., Pagano, M., Draetta, G. F. (2003) Degradation of Cdc25A by beta-TrCP during S phase and in response to DNA damage. Nature 426,87-91[CrossRef][Medline]
  6. Peters, J. M. (2006) The anaphase promoting complex/cyclosome: a machine designed to destroy. Nat. Rev. Mol. Cell. Biol. 7,644-656[CrossRef][Medline]
  7. Burton, J. L., Tsakraklides, V., Solomon, M. J. (2005) Assembly of an APC-Cdh1-substrate complex is stimulated by engagement of a destruction box. Mol. Cell. 18,533-542[CrossRef][Medline]
  8. Petroski, M. D., Deshaies, R. J. (2005) Function and regulation of cullin-RING ubiquitin ligases. Nat. Rev. Mol. Cell. Biol. 6,9-20[CrossRef][Medline]
  9. Jackson, P. K. (2004) Linking tumor suppression, DNA damage and the anaphase-promoting complex. Trends. Cell Biol. 14,331-334[CrossRef][Medline]
  10. Joazeiro, C. A., Anderson, K. C., Hunter, T. (2006) Proteasome inhibitor drugs on the rise. Cancer Res. 66,7840-7842[Abstract/Free Full Text]
  11. Finley, D., Ciechanover, A., Varshavsky, A. (2004) Ubiquitin as a central cellular regulator. Cell 116,S29-3222 p following S32[CrossRef][Medline]
  12. Tintignac, L. A., Lagirand, J., Batonnet, S., Sirri, V., Leibovitch, M. P., Leibovitch, S. A. (2005) Degradation of MyoD mediated by the SCF (MAFbx) ubiquitin ligase. J. Biol. Chem. 280,2847-2856[Abstract/Free Full Text]
  13. Lindon, C., Albagli, O., Domeyne, P., Montarras, D., Pinset, C. (2000) Constitutive instability of muscle regulatory factor Myf5 is distinct from its mitosis-specific disappearance, which requires a D-box-like motif overlapping the basic domain. Mol. Cell. Biol. 20,8923-8932[Abstract/Free Full Text]
  14. Gardrat, F., Montel, V., Raymond, J., Azanza, J. L. (1997) Proteasome and myogenesis. Mol. Biol. Rep. 24,77-81[CrossRef][Medline]
  15. Shen, X., Collier, J. M., Hlaing, M., Zhang, L., Delshad, E. H., Bristow, J., Bernstein, H. S. (2003) Genome-wide examination of myoblast cell cycle withdrawal during differentiation. Dev. Dyn. 226,128-138[CrossRef][Medline]
  16. Sabourin, L. A., Rudnicki, M. A. (2000) The molecular regulation of myogenesis. Clin. Genet. 57,16-25[CrossRef][Medline]
  17. Walsh, K., Perlman, H. (1997) Cell cycle exit upon myogenic differentiation. Curr. Opin. Genet. Dev. 7,597-602[CrossRef][Medline]
  18. Wei, W., Ayad, N. G., Wan, Y., Zhang, G. J., Kirschner, M. W., Kaelin, W. G., Jr (2004) Degradation of the SCF component Skp2 in cell-cycle phase G1 by the anaphase-promoting complex. Nature 428,194-198[CrossRef][Medline]
  19. Bashir, T., Dorrello, N. V., Amador, V., Guardavaccaro, D., Pagano, M. (2004) Control of the SCF(Skp2-Cks1) ubiquitin ligase by the APC/C(Cdh1) ubiquitin ligase. Nature 428,190-193[CrossRef][Medline]
  20. Tamamori-Adachi, M., Hayashida, K., Nobori, K., Omizu, C., Yamada, K., Sakamoto, N., Kamura, T., Fukuda, K., Ogawa, S., Nakayama, K. I., Kitajima, S. (2004) Down-regulation of p27Kip1 promotes cell proliferation of rat neonatal cardiomyocytes induced by nuclear expression of cyclin D1 and CDK4. Evidence for impaired Skp2-dependent degradation of p27 in terminal differentiation. J. Biol. Chem. 279,50429-50436[Abstract/Free Full Text]
  21. Carrano, A. C., Eytan, E., Hershko, A., Pagano, M. (1999) SKP2 is required for ubiquitin-mediated degradation of the CDK inhibitor p27. Nat. Cell Biol. 1,193-199[CrossRef][Medline]
  22. Bornstein, G., Bloom, J., Sitry-Shevah, D., Nakayama, K., Pagano, M., Hershko, A. (2003) Role of the SCFSkp2 ubiquitin ligase in the degradation of p21Cip1 in S phase. J. Biol. Chem. 278,25752-25757[Abstract/Free Full Text]
  23. Wang, W., Nacusi, L., Sheaff, R. J., Liu, X. (2005) Ubiquitination of p21Cip1/WAF1 by SCFSkp2: substrate requirement and ubiquitination site selection. Biochemistry 44,14553-14564[CrossRef][Medline]
  24. Gieffers, C., Peters, B. H., Kramer, E. R., Dotti, C. G., Peters, J. M. (1999) Expression of the CDH1-associated form of the anaphase-promoting complex in postmitotic neurons. Proc. Natl. Acad. Sci. U. S. A. 96,11317-11322[Abstract/Free Full Text]
  25. Konishi, Y., Stegmuller, J., Matsuda, T., Bonni, S., Bonni, A. (2004) Cdh1-APC controls axonal growth and patterning in the mammalian brain. Science 303,1026-1030[Abstract/Free Full Text]
  26. Wan, Y., Kirschner, M. W. (2001) Identification of multiple CDH1 homologues in vertebrates conferring different substrate specificities. Proc. Natl. Acad. Sci. U. S. A. 98,13066-13071[Abstract/Free Full Text]
  27. Wan, Y., Liu, X., Kirschner, M. W. (2001) The anaphase-promoting complex mediates TGF-beta signaling by targeting SnoN for destruction. Mol. Cell. 8,1027-1039[CrossRef][Medline]
  28. Chen, Z., Li, D. Q., Tong, L., Stewart, P., Chu, C., Pflugfelder, S. C. (2006) Targeted inhibition of p57 and p15 blocks transforming growth factor beta-inhibited proliferation of primary cultured human limbal epithelial cells. Mol. Vis. 12,983-994[Medline]
  29. Pownall, M. E., Gustafsson, M. K., Emerson, C. P., Jr (2002) Myogenic regulatory factors and the specification of muscle progenitors in vertebrate embryos. Annu. Rev. Cell Dev. Biol. 18,747-783[CrossRef][Medline]
  30. Bailey, P., Holowacz, T., Lassar, A. B. (2001) The origin of skeletal muscle stem cells in the embryo and the adult. Curr. Opin. Cell Biol. 13,679-689[CrossRef][Medline]
  31. Molkentin, J. D., Olson, E. N. (1996) Defining the regulatory networks for muscle development. Curr. Opin. Genet. Dev. 6,445-453[CrossRef][Medline]
  32. Delgado, I., Huang, X., Jones, S., Zhang, L., Hatcher, R., Gao, B., Zhang, P. (2003) Dynamic gene expression during the onset of myoblast differentiation in vitro. Genomics 82,109-121[CrossRef][Medline]
  33. Puente, L. G., Voisin, S., Lee, R. E., Megeney, L. A. (2006) Reconstructing the regulatory kinase pathways of myogenesis from phosphopeptide data. Mol. Cell. Proteomics. 5,2244-2251[Abstract/Free Full Text]
  34. Tannu, N. S., Rao, V. K., Chaudhary, R. M., Giorgianni, F., Saeed, A. E., Gao, Y., Raghow, R. (2004) Comparative proteomes of the proliferating C(2)C(12) myoblasts and fully differentiated myotubes reveal the complexity of the skeletal muscle differentiation program. Mol. Cell. Proteomics. 3,1065-1082[Abstract/Free Full Text]
  35. Erbay, E., Chen, J. (2001) The mammalian target of rapamycin regulates C2C12 myogenesis via a kinase-independent mechanism. J. Biol. Chem. 276,36079-36082[Abstract/Free Full Text]
  36. Brummelkamp, T. R., Bernards, R., Agami, R. (2002) A system for stable expression of short interfering RNAs in mammalian cells. Science 296,550-553[Abstract/Free Full Text]
  37. Sabourin, L. A., Girgis-Gabardo, A., Seale, P., Asakura, A., Rudnicki, M. A. (1999) Reduced differentiation potential of primary MyoD-/- myogenic cells derived from adult skeletal muscle. J. Cell Biol. 144,631-643[Abstract/Free Full Text]
  38. Epting, C. L., Lopez, J. E., Shen, X., Liu, L., Bristow, J., Bernstein, H. S. (2004) Stem cell antigen-1 is necessary for cell-cycle withdrawal and myoblast differentiation in C2C12 cells. J. Cell Sci. 117,6185-6195[Abstract/Free Full Text]
  39. Ashe, M., Pabon-Pena, L., Dees, E., Price, K. L., Bader, D. (2004) LEK1 is a potential inhibitor of pocket protein-mediated cellular processes. J. Biol. Chem. 279,664-676[Abstract/Free Full Text]
  40. Ayad, N. G., Rankin, S., Murakami, M., Jebanathirajah, J., Gygi, S., Kirschner, M. W. (2003) Tome-1, a trigger of mitotic entry, is degraded during G1 via the APC. Cell 113,101-113[CrossRef][Medline]
  41. Kraft, C., Vodermaier, H. C., Maurer-Stroh, S., Eisenhaber, F., Peters, J. M. (2005) The WD40 propeller domain of Cdh1 functions as a destruction box receptor for APC/C substrates. Mol. Cell. 18,543-553[CrossRef][Medline]
  42. Qi, W., Yu, H. (2007) KEN-box-dependent degradation of the bub1 spindle checkpoint kinase by the anaphase-promoting complex/cyclosome. J. Biol. Chem. 282,3672-3679[Abstract/Free Full Text]
  43. Schmidt, A., Duncan, P. I., Rauh, N. R., Sauer, G., Fry, A. M., Nigg, E. A., Mayer, T. U. (2005) Xenopus polo-like kinase Plx1 regulates XErp1, a novel inhibitor of APC/C activity. Genes Dev. 19,502-513[Abstract/Free Full Text]
  44. Yamano, H., Gannon, J., Mahbubani, H., Hunt, T. (2004) Cell cycle-regulated recognition of the destruction box of cyclin B by the APC/C in Xenopus egg extracts. Mol. Cell. 13,137-147[CrossRef][Medline]
  45. Liu, X., Constantinescu, S. N., Sun, Y., Bogan, J. S., Hirsch, D., Weinberg, R. A., Lodish, H. F. (2000) Generation of mammalian cells stably expressing multiple genes at predetermined levels. Anal. Biochem. 280,20-28[CrossRef][Medline]
  46. Kitzmann, M., Fernandez, A. (2001) Crosstalk between cell cycle regulators and the myogenic factor MyoD in skeletal myoblasts. Cell. Mol. Life. Sci. 58,571-579[CrossRef][Medline]
  47. Wirth, K. G., Ricci, R., Gimenez-Abian, J. F., Taghybeeglu, S., Kudo, N. R., Jochum, W., Vasseur-Cognet, M., Nasmyth, K. (2004) Loss of the anaphase-promoting complex in quiescent cells causes unscheduled hepatocyte proliferation. Genes Dev. 18,88-98[Abstract/Free Full Text]
  48. Zou, H., McGarry, T. J., Bernal, T., Kirschner, M. W. (1999) Identification of a vertebrate sister-chromatid separation inhibitor involved in transformation and tumorigenesis. Science 285,418-422[Abstract/Free Full Text]
  49. Visintin, R., Prinz, S., Amon, A. (1997) CDC20 and CDH1: a family of substrate-specific activators of APC-dependent proteolysis. Science 278,460-463[Abstract/Free Full Text]
  50. Fang, G., Yu, H., Kirschner, M. W. (1998) The checkpoint protein MAD2 and the mitotic regulator CDC20 form a ternary complex with the anaphase-promoting complex to control anaphase initiation. Genes Dev. 12,1871-1883[Abstract/Free Full Text]
  51. Delfini, M. C., Hirsinger, E., Pourquie, O., Duprez, D. (2000) Delta 1-activated notch inhibits muscle differentiation without affecting Myf5 and Pax3 expression in chick limb myogenesis. Development 127,5213-5224[Abstract]
  52. Lindon, C., Montarras, D., Pinset, C. (1998) Cell cycle-regulated expression of the muscle determination factor Myf5 in proliferating myoblasts. J. Cell Biol. 140,111-118[Abstract/Free Full Text]
  53. Amack, J. D., Mahadevan, M. S. (2001) The myotonic dystrophy expanded CUG repeat tract is necessary but not sufficient to disrupt C2C12 myoblast differentiation. Hum. Mol. Genet. 10,1879-1887[Abstract/Free Full Text]
  54. Weissman, A. M. (2001) Themes and variations on ubiquitylation. Nat. Rev. Mol. Cell. Biol. 2,169-178[CrossRef][Medline]
  55. Dyer, M. A., Cepko, C. L. (2001) Regulating proliferation during retinal development. Nat. Rev. Neurosci. 2,333-342[Medline]
  56. DeRenzo, C., Seydoux, G. (2004) A clean start: degradation of maternal proteins at the oocyte-to-embryo transition. Trends. Cell Biol. 14,420-426[CrossRef][Medline]
  57. Bowerman, B., Kurz, T. (2006) Degrade to create: developmental requirements for ubiquitin-mediated proteolysis during early C. elegans embryogenesis. Development 133,773-784[Abstract/Free Full Text]
  58. Shin, E. K., Shin, A., Paulding, C., Schaffhausen, B., Yee, A. S. (1995) Multiple change in E2F function and regulation occur upon muscle differentiation. Mol. Cell. Biol. 15,2252-2262[Abstract]
  59. Skapek, S. X., Rhee, J., Spicer, D. B., Lassar, A. B. (1995) Inhibition of myogenic differentiation in proliferating myoblasts by cyclin D1-dependent kinase. Science 267,1022-1024[Abstract/Free Full Text]
  60. Nastasi, T., Bongiovanni, A., Campos, Y., Mann, L., Toy, J. N., Bostrom, J., Rottier, R., Hahn, C., Conaway, J. W., Harris, A. J., D’Azzo, A. (2004) Ozz-E3, a muscle-specific ubiquitin ligase, regulates beta-catenin degradation during myogenesis. Dev Cell. 6,269-282[CrossRef][Medline]
  61. Bodine, S. C., Latres, E., Baumhueter, S., Lai, V. K., Nunez, L., Clarke, B. A., Poueymirou, W. T., Panaro, F. J., Na, E., Dharmarajan, K., Pan, Z. Q., Valenzuela, D. M., DeChiara, T. M., Stitt, T. N., Yancopoulos, G. D., Glass, D. J. (2001) Identification of ubiquitin ligases required for skeletal muscle atrophy. Science 294,1704-1708[Abstract/Free Full Text]
  62. Gomes, M. D., Lecker, S. H., Jagoe, R. T., Navon, A., Goldberg, A. L. (2001) Atrogin-1, a muscle-specific F-box protein highly expressed during muscle atrophy. Proc. Natl. Acad. Sci. U. S. A. 98,14440-14445[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.07-8159comv1
21/13/3606    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, W.
Right arrow Articles by Wan, Y.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, W.
Right arrow Articles by Wan, Y.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS