FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published as doi: 10.1096/fj.06-7905com.
 (The FASEB Journal. 2007;21:3308-3317.)
© 2007 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-7905comv1
21/12/3308    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zanone, M. M.
Right arrow Articles by Camussi, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zanone, M. M.
Right arrow Articles by Camussi, G.

Human pancreatic islet endothelial cells express coxsackievirus and adenovirus receptor and are activated by coxsackie B virus infection

Maria M. Zanone*,1, Enrica Favaro*, Elena Ferioli{dagger}, Guo C. Huang{ddagger}, Nigel J. Klein§, Paolo Cavallo Perin*, Mark Peakman{ddagger}, Pier G. Conaldi{dagger} and Giovanni Camussi*

* Department of Internal Medicine, University of Torino, Italy;

{dagger} Department of Medicine and Public Health, University of Insubria, Varese, Italy;

{ddagger} Department of Immunobiology and Diabetes, Guy’s, King’s and St. Thomas’s School of Medicine, London, UK; and

§ Department of Immunobiology, Institute of Child Health, London, UK

1Correspondence: I Divisione Universitaria di Medicina, Dipartimento di Medicina Interna, Corso Dogliotti 14, 10126 Torino, Italy. E-mail: mmz{at}libero.it


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Enteroviruses, such as the coxsackievirus (CV) group, have been linked to the induction of inflammatory and autoimmune diseases. Virus tropism and tissue access are modulated by endothelial cells. To examine the susceptibility of microvascular endothelial cells (MECs) derived from pancreatic islets to infection with CV group B (CVB), purified cultured human islet MECs were infected with CVB-4 strain, and the immunological phenotype of the infected cells was analyzed. CVB-4 persistently infected the islet MECs, which expressed the CV receptors human coxsackievirus and adenovirus receptor (HCAR) and decay accelerating factor (DAF) and maintained EC characteristics, without overt cytopathic effects. CVB-4 infection transiently up-regulated expression of the adhesion molecules ICAM-1 and VCAM-1 and increased production of the proinflammatory cytokines IL-1ß and IL-6, and chemokines IL-8 and lymphotactin, as well as IFN-{alpha}. Mononuclear cell adhesion to CVB infected monolayers was increased, compared to uninfected monolayers. Moreover, infection up-regulated the viral receptors HCAR and DAF and coreceptor {alpha}vß3 integrin on islet MECs, while down-regulating expression of HCAR on human aortic endothelial cells, indicating potential tissue-specific influence on the pathological outcome of infection. These results provide evidence that islet MECs are natural targets and reservoirs for persistent CVB infection resulting in acute endothelial cell activation by virus, which may contribute to selective recruitment of subsets of leukocytes during inflammatory immune responses, such as insulitis in type 1 diabetes.—Zanone, M. M., Favaro, E., Ferioli, E., Huang, G. C., Klein, N. J., Perin, P. C., Peakman, M., Conaldi, P. G., Camussi, G. Human pancreatic islet endothelial cells express coxsackievirus and adenovirus receptor and are activated by coxsackie B virus infection.


Key Words: autoimmunity • adhesion molecules • cytokines • viral infection


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
HUMAN ENTEROVIRUSES (EV) are associated with a wide variety of clinical syndromes and have long been considered possible culprits of inflammatory conditions and immune-mediated pathological processes, such as chronic dilated cardiomyopathy, chronic myositis, and type 1 diabetes mellitus (1 2 3) . Several mechanisms, including molecular mimicry, bystander activation of autoreactive T cells, and superantigenic activity of viral proteins, not mutually exclusive, have been proposed to explain the relationship between EV infections and induction of autoimmune diseases (4 5 6) .

Although there is substantial evidence that viral myocarditis can progress to idiopathic dilated cardiomyopathy (1 , 2) , evidence of a link between viral infections and initiation or acceleration of pancreatic islet autoimmunity has been under investigation for almost 30 yr, and EVs, especially those of the coxsackievirus B (CVB) group, are historically the prime suspects as important etiological determinants in type 1 diabetes (3 , 4) . ß-Cell infection has been extensively studied, and the issue of whether microvariants of EVs can infect, replicate and persist in, and cause damage of ß-cells remains controversial (7 8 9) .

Major determinants of the different clinicopathological manifestations of EV infections, ranging from silent infections to autoimmune diseases, are represented by the viral variants; the nature of the infection, acute, chronic, or reinfection; and the distinct tissue tropism of the viral strain, modulated by the local expression of appropriate cellular receptors and coreceptors, such as CAR, integrin VLA-2, {alpha}vß3, {alpha}vß5, ICAM-1, and DAF (10 11 12) . These molecules do not simply bind viruses but may activate a series of events influencing the organ-specific outcome of disease (13 , 14) . Moreover, in a murine model of type 1 diabetes, a critical link has been established between the target ß-cell antiviral responses and susceptibility to disease (15 , 16) .

Microvascular endothelial cells (MECs) form the key lining between the vascular space and organ parenchyma and have also been shown to influence organ and tissue specific susceptibility to viral infection, thus modulating the pathological expression of virus-induced diseases (17 18 19 20) . ECs expressing appropriate receptors would fail to act as effective barrier to infections, allowing viral particles to pass through, and replicate in, the vascular endothelium. ECs derived from different organs show distinct susceptibility to CVB infections, and the behavior against a viral challenge of ECs in large vessels and microvessels may differ (17 18 19 20 21) . Notably, using a MEC line, we have provided evidence that small vessel ECs can harbor a persistent viral infection, resulting in quantitative modification of adhesion molecule expression (20) , possibly contributing to the selective recruitment of subsets of leukocytes during inflammatory immune responses. ECs are in fact crucially involved in the control of leukocyte traffic and in the mediation of inflammation (22) .

Against this background and the observations that there is an heterogeneity of endothelial phenotype and function (23 , 24) , in the present study we aimed to investigate the susceptibility of MECs derived from human pancreatic islets to infection with CVB. The cellular expression of HCAR, the persistence of the infection, and the biological effects on receptor modulation and islet MEC activation, in terms of adhesion, costimulatory molecules and cytokine and chemokine secretion were analyzed to explore the potential interplay among CVB, islet microvasculature, and the immune system.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Islet endothelial cell culture and infection
Human islets were obtained from the pancreas of an organ donor using a modification of Ricordi’s technique (25) . Islet isolations were carried out in the Cell Isolation Unit at King’s College Hospital, and these studies were approved by the local Ethical Review Committee. Primary islet MECs were positively selected using anti-CD105 immunomagnetic beads, purified, cultured, and characterized as described previously (26) .

CVB-4 strains was originally obtained from the American Type Culture Collection (Rockville, MD, USA). Virus stock was prepared in serum-free medium as described previously (27) , using human KB cells infected at a multiplicity of infection (MOI) of 0.1. KB cultures displaying >90% cytopathic effect (CPE) after 24 h incubation at 37°C were disrupted by two freeze-thaw cycles. Cell debris was removed by centrifugation; cell-free supernatants were subjected to titer determination and stored at –70°C. Virus titer was determined in quadruplicate by a micromethod using KB cells and expressed as 50% tissue culture infectious dose (TCID50) per ml. The endotoxin levels in the virus preparation were <0.01 U/ml (Limulus assay).

For infection, islet MECs were subcultured in a T25 flask at 50% confluence and 2 days later were washed and infected with CVB-4 strain in serum-free medium. Five separate sets of infection were performed at MOI ranging between 0.01–3. After 2 h of incubation at 37°C, cells were extensively washed with Hanks’ buffered saline solution (HBSS) and replenished with complete medium. A sample of supernatants was taken as the initial point for the time course of virus and cytokine production. CVB infection was monitored by evaluating the development of CPE and extracellular virus titers, as described previously.

For experiments on HCAR expression and modulation, human umbilical vein-derived ECs (HUVEC; ref 28 ), used as positive control (29) , and human aortic ECs (Cambrex Bio Science, Milano, Italy) were cultured and CVB-4 infected using the same conditions. Parallel cultures of uninfected counterparts were generated for comparative experiments.

Detection of endothelial markers, surface molecule, and viral capsid protein
In time-course experiments of cell staining, approximately 50% of infected and uninfected cells were collected with nonenzymatic cell dissociation solution (Sigma Aldrich, Milan, Italy) every 4–5 days and analyzed for adhesion molecules (ICAM-1, CD54; VCAM-1, CD106; E-selectin, CD62E; all anti-human monoclonal Abs from Serotec, Oxford, UK) and costimulatory molecules CD40 (Euroclone, Devon, UK) and CD86 (PharMingen, San Diego, CA, USA) by flow cytometric analysis, using CellQuest software (BD Biosciences, Erembodegem, B, San Jose, CA, USA) as described previously (20) . Each time point experiment is expressed as the mean of two separate flow cytometric analysis.

Staining for basal expression of endothelial markers [von Willebrand’s factor (VWF), CD105, and CD146, using anti-human Abs from Sigma, Serotec, and Chemicon, Temecula, CA, USA, respectively] and integrin {alpha}vß3 (kindly provided by Prof. G. Tarone, University of Torino) was performed at days 7 and 15 of infection by flow cytometric analysis and also by immunofluorescence (IF) technique for vWF, as described previously (20) . Staining for the islet microvasculature specific marker nephrin was performed by IF technique and detected using guinea pig antinephrin polyclonal Ab (GP-N1, Progen Biotechnik GmbH, Heidelberg, Germany), as described previously (26) .

Cultures were also evaluated for expression of the VP1 viral capsid protein by IF microscopy. Briefly, infected and uninfected cells, seeded onto a 24 well plate were cultured for 48 h, washed three times with PBS, 0.25% BSA, and fixed with 4% paraformaldehyde for 30 min at 4°C. After being washed, cells were permeabilized with 1% Triton for 10 min, washed, and incubated with murine anti-Enterovirus VP1 peptide monoclonal Ab (1:40; Dako, Glostrup, DK) for 1 h at room temperature (RT). After being washed, cells were incubated with conjugated secondary Ab for 1 h and examined by inverted ultraviolet microscopy.

Gene array
Human gene microarray kits for the study of EC biology markers (GEArray Q-series, HS-036, SuperArray Inc., Bethesda, MD, USA; www.superarray.com for complete gene list) were used to characterize the gene expression profiles of uninfected and infected islet MECs. Probe synthesis, hybridization, and chemiluminescent detection were performed according to the manufacturer’s instructions. Briefly, total RNA was extracted using Tri Reagent (Sigma) from different cultures of uninfected islet MECs and from infected cultures during the first and the second week of infection and were used as a template for biotinylated cDNA probe synthesis at a concentration of 0.5 µg. RNA was reverse transcribed using gene-specific primers, and cDNA was amplified and labeled with biotin-16-dUTP using an AmpoLabeling-LPR Kit (SuperArray). Biotinylated cDNA probes were denatured and hybridized to the array membranes, which were then washed, blocked, and incubated with alkaline phosphatase-conjugated streptavidin. The hybridized biotinylated probes were detected by a chemiluminescent method using the alkaline phosphatase substrate CDP-Star and directly acquired with the Chemidoc XRS system (Bio-Rad, Hercules, CA, USA). Results were analyzed using GEAarray Expression Analysis Suite (http://geasuite.superarray.com). Expression levels of individual genes in each RNA extract were normalized to the density of the quadruplicate spots representing GAPDH and ß-actin genes (ratio of each gene density/mean GAPDH and ß-actin dot densities) and corrected for background.

Detection of viral receptors
The human islet MEC and aortic EC basal expression of HCAR and of the other CVB receptor DAF (CD55) and their modulation by the CVB infection were analyzed by semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis. Total RNA was isolated from uninfected and infected cells using TRI Reagent, and RNA was treated with Rnase free Dnase (deoxyribonuclease I, Sigma) and purified by salted alcohol precipitation. For cDNA preparation, total RNA (0,5 µg, 0,25 µg, 0,125 µg, and 0,06 µg) was reverse transcribed with Superscript II Reverse Trascriptase (Moloney murine leukemia virus, Invitrogen, Carlsbad, CA, USA) using Oligod(T)16 primers (Applied Biosystems, Monza, Italy). Primer sequences for RT-PCR were as follows: CD55 (forward) GCAACACGGAGTACACCTGT, (reverse) GCTAAGAATGTGATTCCAGG (361bp); HCAR (forward) GACTCACAGAAAATGCCCAC, (reverse) CGACAGCAAAAGATGATAAGACC (222 bp); GAPDH (housekeeping gene) (forward) CGGAGTCAACGGATTTGGTCGTAT, (reverse) AGCCTTCTCCATGGTGGTGAAGAC (309 bp; Invitrogen). Three microliters of cDNA were used as the template for individual PCRs with pairs of gene-specific primers. Each PCR mixture (50 µl) contained 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, 0.2 mM each deoxy nucleoside triphosphate, 0.5 µM each primer, and 2 U of AmpliTaq Gold DNA polymerase (Perkin-Elmer, Wellesley, MA, USA). Thermal cycling programs consisted of 10 min denaturation at 94°C, followed by 30 s at 94°C, 30 s at 55°C (CD55, GAPDH) or 57°C (HCAR), 30 s at 72°C for 27–35 cycles, and a final 7 min extension at 72°C. PCR products were analyzed by electrophoresis through 2% agarose gels with a 50-pDNA molecular size ladder, visualized by ethidium bromide staining and analyzed with GelDoc 2000 System (Bio-Rad).

At the protein level, surface expression of DAF was monitored by flow cytometric analysis, as described previously (20) , while expression of HCAR was further analyzed by flow cytometric analysis, IF staining, and Western blot analysis. Briefly, for flow cytometry, cells were permeabilized and incubated with a rabbit polyclonal Ab directed against the N terminus of HCAR (Santa Cruz Biotechnology, Santa Cruz, CA, USA; 0.5 µg/ml) for 1 h at RT, followed by appropriate secondary FITC-conjugated Ab (Dako). For IF, chamber slide attached cells at subconfluent density were treated with 2% paraformaldehyde, 0.5% Triton for 10 min. After being washed with PBS (0.25% BSA), cells were incubated with anti-HCAR polyclonal Ab (2 µg/ml) for 1 h at RT, washed, and incubated with Alexa Fluor 488 anti-rabbit IgG (Molecular Probes, Leiden, NL) used as secondary Ab for 1 h at RT. Hoechst 33258 (Sigma) dye was added for nuclear staining, and slides were mounted in Vectashield H-1000 mounting medium (Vector Laboratories, Burlingame, CA, USA). Confocal analysis was performed using a Zeiss LSM5 Pascal Model confocal microscope (Carl Zeiss International, Germany) using a x630 magnification lens. Control experiments included incubation with nonimmune isotypic control Ab or the omission of primary Ab.

For WB analysis, cells were lysed at 4°C for 1 h in lysis buffer (26) , and after centrifugation of the lysates at 15,000 g, samples were normalized to 50 µg/sample in 20 µl by appropriate dilution in lysis buffer. Proteins were directly subjected to 8% SDS-PAGE and transferred electrophoretically to nitrocellulose. The membranes were blocked and incubated with anti-HCAR polyclonal Ab (1 µg/ml) in PBS, 0.5% Tween 20, 10% BSA, overnight at 4°C. After being washed extensively, the blots were probed with peroxidase-conjugated goat anti-rabbit IgG (Pierce, Rockford, IL, USA) for 1 h at RT. The enzyme was removed by washing, and blots were incubated for 2 min with a chemiluminescence reagent (ECL, Amersham, Buckingamshire, UK).

Cytokine and chemokine detection
Cell culture supernatants were collected before each subculture and medium exchange, centrifuged, and stored at –80°. IL-1ß, IL-6, TNF-{alpha}, and IFN-{alpha} cytokines and IL-8 and XCL1 (lymphotactin) chemokines were measured in duplicate by quantitative sandwich enzyme immunoassay (R&D Systems, Abingdon, UK), according to the manufacturer’s instructions. Color intensity was read at the appropriate wavelength on a microplate reader (Bio-Rad). Detection limits of assays were 3.9 pg/ml for IL-1ß, 3 pg/ml for IL-6, 0.5 pg/ml for TNF-{alpha}, 12.5 pg/ml for IFN-{alpha}, 31 pg/ml for IL-8, and 62 pg/ml for XCL1.

Time-course analyses of the complete transcript of IL-6, IL-8, IL-1ß, and lymphotactin were performed by semiquantitative RT-PCR. Primer sequences were as follows: IL-6 (forward) ATGAACTCCTTCTCCACAAGCGC, (reverse) GAAGAGCCCTCAGGCTGGACTG (628 bp); IL8 (forward) ATGACTTCCAAGCTGGCCGTGGCT, (reverse) TCTCAGCCCTCTTCAAAAACTTCTC (289 bp); IL-1ß (forward) ATGGCAGAAGTACCTAAGCTCGC, (reverse) ACACAAATTGCATGGTGAAGTCAGTT (802 bp); lymphotactin (forward) TCTGCTCTCTCACTGCATAC, (reverse) CAGCTGTATTGGTCGATTGC (297 bp). Thermal cycling programs consisted of 10 min denaturation at 94°C, followed by 30 s at 94°C, 30 s at 55°C (IL-6, IL-8, IL-1ß) or 60°C (Lymphotactin), 30 s at 72°C for 27–35 cycles, and a final extension of 7 min at 72°C.

Peripheral blood mononuclear cells adhesion assays
Peripheral blood mononuclear cells (PBMCs) were obtained by Ficoll-Hypaque centrifugation of heparinized blood from a healthy donor and washed twice in HBSS, and the pellet was resuspended in EC culture medium at a concentration of 1 x 106 cells/ml. To measure PBMC adhesion to uninfected and infected cell monolayers, 1 x 106 PBMCs in 1 ml of culture medium were added to each well of confluent cells in a 24-well tissue culture plate and incubated for 1 h at 37°C. Nonadherent cells were removed by aspiration of the supernatant and a further two washes. Islet MECs and adherent PBMCs were detached by incubation with nonenzymatic cell dissociation solution and washed, and the cell pellet was suspended and aliquoted for staining for T cells and monocytes (with 10 µl of a mix of anti-human CD3-FITC mAb and anti-CD14-RPE mAb, PharMingen) and isotype control for 30 min at 4°C. After being washed, cells were analyzed by imunofluorescent staining and flow cytometry.

In parallel experiments, PBMCs were labeled for 5 min with 4 µM PKH2 (Sigma), a green fluorescent membrane stain, following the manufacturer’s instructions, and subsequently 1 x 106 PBMCs were added to cell monolayers as above. Adherent cells were counted by digital analysis (Windows MicroImage, ver. 3.4 CASTI Imaging, I) of images, using a video camera (Leica DC100), and expressed as the mean of cells counted in 10 x100 inverted microscope fields. All the adhesion studies were carried out using duplicate wells.

Statistical analysis
Mean values of cytokine and chemokine levels and expression of adhesion molecules and DAF on infected and uninfected islet MECs were compared using the Mann Whitney-U test. Data were analyzed using the SPSS statistical package (SPSS, Chicago, IL, USA), and P values <0.05 were considered significant.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Acute and persistent infection of islet MECs and endothelial cell phenotype
Islet MEC cultures consistently allowed replication of CVB-4, with release of infectious virus for up to 3–4 wk. Virus production peaked 48–72 h after infection (10–3.3-10–3 TCID50/ml), and endothelial cells then harbored a productive, albeit low level (average 10–2 TCID50/ml), infection throughout the course of the experiments. Despite virus replication, islet MECs did not show overt cytolytic changes. However, cell growth reduced, compared to uninfected cells, and cell morphology appeared more granular (Fig. 1 A, B). Infected cells maintained endothelial characteristics, as assessed by detection of vWF expression (Fig. 1B , inset) and endothelial-cell associated markers (Fig. 1C ). Viability of both infected and uninfected islet MECs was 90–96% as detected by trypan blue exclusion.


Figure 1
View larger version (53K):
[in this window]
[in a new window]

  		Figure 1. Microscopy and flow cytometric analysis of infected islet MECs during second week of infection. Uninfected (A) and CVB-4 infected (B) islet MEC monolayers. Original magnification = x100. Infected cells retain endothelial cell characteristics, i.e., positive cytoplasm staining for vWF, assessed by immunofluorescence (B, inset), and expression of CD105 (MFI 18 and 80% of positive cells) and CD146 (MFI 23 and 89% of positive cells), assessed by flow cytometric analysis (C, dark line histogram). Thin line histograms represent corresponding isotype control Abs.

Detection by immunofluorescent staining of VP1 capsid protein during the first and second week of infection indicated a positive staining for VP1 in approximately 20–25% of cells per microscope field (Fig. 2 A, B).


Figure 2
View larger version (22K):
[in this window]
[in a new window]

  		Figure 2. VP1 staining and time-course analysis of adhesion molecule expression in infected islet MECs. Immunofluorescence staining for VP1 capsid protein in uninfected (A) and chronically infected (20 days; B) islet MEC monolayer; positive cells appear as bright spots on cell monolayer. Original magnification = x400. C) Representative example of time-course analysis of mean fluorescence intensity (MFI) of ICAM-1 (close circle, dark line) and VCAM-1 (open circle, dotted line) for CVB-4 infected cells. Virus titer during time course is indicated as TCDI50/ml at top. Mean value ± SD of MFI of ICAM-1 and VCAM-1 of uninfected counterparts (mean of several experiments) are shown as straight lines.

Endothelial cell surface molecule expression
Figure 2C shows a representative time-course analysis of the adhesion molecule expression, during one CVB-4 infection of the islet MEC cell line. Mean MFI and percentage of positive events for ICAM-1 and VCAM-1 were higher in the CVB–4 infected MECs (mean MFI 49.4±26, mean percentage of positive cells 56±19 for ICAM-1; mean MFI 21±13, mean percentage of positive cells 34±18 for VCAM-1), compared to uninfected counterparts (mean MFI 39.1±26, mean percentage of positive cells 59±24 for ICAM-1; mean MFI 10±5, mean percentage of positive cells 28±16 for VCAM-1), although without statistical significance. Within the time-course analysis, the expression of ICAM-1 and VCAM-1 was transiently above the mean MFI of the uninfected MECs in three time points during the first 15 days of infection (P=0.02 for VCAM-1 compared to uninfected cells), and similar kinetics were consistently observed in three individual experiments of infection.

E-selectin expression and costimulatory molecules CD40 and CD86 were not modified by CVB infection (data not shown). Nephrin expression persisted in the infected islet MECs, as assessed by IF staining, without detectable changes of distribution between infected and uninfected MECs.

The gene microarray analysis of the expression of a panel of genes related to endothelial biology indicated that several genes were constitutively expressed at RNA in both uninfected and infected cells (PECAM-1, E-selectin, PAI-1, VEGF, and vWF; Fig. 3 A). Up-regulation of ß3 integrin gene during the first and the second week of infection, and of ANXA5, BAX, ß1 integrin, E-selectin, and VEGF genes during the first week of infection, was evident (Fig. 3B ). Flow cytometric analysis confirmed up-regulation of {alpha}vß3 integrin surface expression, which is a known CVB coreceptor (Fig. 3C ).


Figure 3
View larger version (24K):
[in this window]
[in a new window]

  		Figure 3. Gene microarray analysis of human EC biology markers. A) Comparison of pattern of expressed mRNA indicates that several gene were constitutively expressed in both uninfected and infected cells (PECAM-1, E-selectin, PAI-1, VEGF, and vWF), with up-regulation of ANXA5 (row 2, lane b), BAX (row 2, lane c), ß1 integrin (row 7, lane h), ß3 integrin (row 8, lane a), E-selectin (row 10, lane b), and VEGF (row 12, lane f) genes during 1st week of infection. Complete gene list and position information can be obtained at www.superarray.com. B) Histogram represents fold of variation of gene expression induced by CVB infection. Data are the mean of two different experiments. C) Representative flow cytometric analysis showing {alpha}vß3 integrin surface expression on uninfected (left; MFI 4.5 and 16% of positive cells) islet MECs and its up-regulation on CVB-4 infected (right; MFI 14 and 47% of positive cells) islet MECs after 1 wk culture. Thin line histograms represent corresponding isotype control Ab; 3 experiments were performed with similar results.

HCAR and CD55 expression
Flow cytometric analysis of expression of DAF, indicated up-regulation on the infected islet MECs, compared to uninfected cells (mean MFI 54±36, mean percentage of positive cells 58±14 for the uninfected cells, and mean MFI 87±60, mean percentage of positive cells 67±23 for the infected cells; Fig. 4 A, B). DAF was up-regulated also in human aortic ECs infected by CVB-4 (mean MFI 273±165, mean percentage of positive cells 83±13 for the uninfected cells, and mean MFI 355±56, mean percentage of positive cells 94±2 for the infected cells). Similarly, semiquantitative RT-PCR time-course analysis showed persistently increased transcript of DAF for the infected cells, as a 361 bp band, both in islet MECs and aortic ECs (Fig. 4C, D ).


Figure 4
View larger version (42K):
[in this window]
[in a new window]

  		Figure 4. CD55 expression in uninfected and infected islet MECs and aortic ECs. Representative flow cytometric detection of CD55 expression on uninfected (A; MFI 18 and 48% of positive cells) and CVB-4 infected (B; MFI 110 and 87% of positive cells) cells. Thin line histogram represents corresponding isotype control Ab. Representative agarose gel resolving RT-PCR products after amplification for CD55, detected as a band of 361 bp, in uninfected and CVB-4 infected islet MECs (C) and aortic ECs (D), transcribing different amount of RNA (lane 1: 0.5 µg, lane 2: 0.25 µg, lane 3: 0.125 µg, and lane 4: 0.06 µg). Time-course experiments at different time points were performed with similar results.

Analysis of HCAR expression, by flow cytometry, showed that up to 70% of islet MECs were positive for this receptor (Fig. 5A). This was confirmed by indirect IF confocal microscopy, which showed expression of HCAR on subconfluent islet MECs stained with antibody directed against the N terminus of HCAR, giving rise to a diffuse fine punctate pattern (Fig. 5B ).


Figure 5
View larger version (22K):
[in this window]
[in a new window]

  		Figure 5. HCAR expression in islet MECs. A) By flow cytometry, up to 70% (MFI 26) of islet MECs were positive for HCAR. Thin line histogram represents the corresponding isotype control Ab. B) Representative confocal immunofluorescence micrographs of islet MECs, stained with polyclonal anti-HCAR Ab, showing a diffuse expression in a fine punctate pattern in islet MECs (original magnification x630, nuclei stained in blue).

Semiquantitative RT-PCR analysis detected HCAR mRNA expression both in islet MECs and human aortic ECs as a 222 bp band. In a time-course analysis, CVB infection persistently increased HCAR transcript in islet MECs, whereas HCAR transcript decreased in infected aortic ECs (Fig. 6 A-D). This was confirmed at protein level by WB analysis. A band of 46 kDa, the identified molecular mass of HCAR, was detected in HUVEC (Fig. 6E , lane 3) and in islet MEC lysates, and the expression was up-regulated in CVB-4 infected islet MEC lysates (Fig. 6E , lanes 1 and 2, respectively), consistently during the first and the second week of infection. In contrast, in human aortic ECs, the expression of HCAR was down-regulated by the CVB infection (Fig. 6E , lanes 4 and 5).


Figure 6
View larger version (55K):
[in this window]
[in a new window]

  		Figure 6. RT-PCR and Western blot analysis of HCAR expression in islet MECs and human aortic ECs. Representative agarose gel resolving RT-PCR products after amplification for HCAR, detected as a band of 222 bp in uninfected and CVB-4 infected islet MECs (A) and aortic ECs (C), transcribing different amount of RNA (lane 1: 0,5 µg, lane 2: 0,25 µg, lane 3: 0,125 µg, and lane 4: 0,06 µg). An increased expression of HCAR RNA in infected islet MECs and a decreased expression in infected aortic ECs are observed. Representative agarose gels resolving RT-PCR product after amplification GAPDH (309 bp) in uninfected and CVB-4 infected islet MECs (B) and aortic ECs (D). Time-course experiments at different time points were performed with similar results. In a representative Western blot analysis (E), islet MECs lysates (lane 1) express HCAR as a band of 46 kDa; an increased protein expression is observed after infection with CVB-4 (lane 2). Human aortic EC lysates express HCAR (lane 4) and a decreased expression is observed after infection with CVB-4 (lane 5). HUVEC lysates (lane 3) served as positive control. Three experiments at different time of infection were performed with similar results.

Cytokine levels
Endothelial-derived cytokines and chemokines measured by ELISA on cell free supernatants indicated that CVB infection induced an increased production of IL1-ß, IL-6, and IL-8 compared to mean values in uninfected cell supernatants in a magnitude of approximately three times (P<0 05 for IL-6, IL-8, and IL1-ß), whereas levels of lymphotactin were not increased. Figure 7 A shows mean values for repeated measurements of these cytokines during the 2 wk of all the CVB-4 infections. These data were further confirmed by time-course analysis of the transcripts of these cytokines and chemokines by semiquantitative RT-PCR, indicating that also lymphotactin mRNA was increased by CVB infection (Fig. 7B ).


Figure 7
View larger version (36K):
[in this window]
[in a new window]

  		Figure 7. Endothelial cytokine production. A) Mean value ± SD of IL-6, IL-8, IL-1ß and IFN-{alpha} on cell free supernatants of uninfected (white) and infected (black) islet MECs during the first 2 wk of infection. Values (pg/ml) are represented in logaritmic scale. *P < 0.05. B) Representative agarose gel resolving RT-PCR products after amplification for IL-6, IL-8, IL-1ß, and lymphotactin detected as a band of 628 bp, 289 bp, 802 bp, and 297 bp respectively, in uninfected and CVB-4 infected islet MECs, transcribing different amount of RNA (lane 1 and 3: 0.25 µg; lane 2 and 4: 0.06 µg). Time-course experiments at different time points were performed with similar results.

IFN-{alpha} was undetectable in the supernatants of uninfected cells, whereas a mean of 100 pg/ml were detectable in the first 2 wk of infection (P<0.05). Similarly, TNF-{alpha} was undetectable in supernatants of uninfected cells, and sporadically 3–5 pg/ml were detected in some supernatants of infected cells.

Adhesion of PBMCs on cell monolayer
FACS analysis of harvested adherent PBMCs incubated on islet MECs monolayer during the first 15 days of infection indicated that CVB-4 infection increased adherence of T cells and monocytes by 2-fold (Fig. 8 A, B). Similarly, analysis of digital images of PKH2-labeled PBMCs indicated a mean of 85 ± 39 adherent PBMCs per microscope field in infected islet MEC monolayers compared to a mean of 49 ± 26 cells in uninfected cell monolayers (Fig. 8C, D ).


Figure 8
View larger version (73K):
[in this window]
[in a new window]

  		Figure 8. Adhesion of PBMCs to cell monolayers. Adhesion of PBMCs to islet MEC cultures was performed as described in Materials and Methods. A, B) Representative FACS analysis of harvested adherent PBMCs to uninfected (A) and infected (B) islet MEC monolayers. In a 2-parameter cytogram, lymphocytes (CD3+, CD14–) are represented as signals in lower right-hand quadrant, whereas monocytes (CD14+, CD3–) are represented as signals in the upper left-hand quadrant. C, D) Representative micrographs of fluorescence microscopy detection of adherent PKH2–labeled PBMCs on uninfected (C) and infected (D) islet MECs monolayers. Adherent PBMCs appear as bright spots. Three experiments were performed with similar results.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
In the present study, we focused on the possibility that an interaction between islet MECs and CVB infection triggers a series of proinflammatory events that could be important in islet inflammation and possibly influence the development of autoimmune diabetes, through the initiation or acceleration of islet autoimmunity. Our results indicate that primary human islet MECs express appropriate viral receptors and can harbor a persistent, low level infection by CVB, assessed as detection of VP1 capsid protein and release of infectious particles. The establishment of a persistent infection is a reproducible event, with no obvious effects on MEC morphology or viability, that provides better viral access to the underlying tissue and supports the role of the endothelium in modulating virus tropism. These findings add to a body of work that highlights the possible role of human EVs as environmental triggers that are capable of influencing the incidence of type 1 diabetes, the susceptibility of which to environmental influences is well established (3 , 4) .

Several studies have suggested that a low-grade inflammation may cause profound impairments of endothelial function (30 , 31) . In the present study, we used MOI ranging from 0.01 to 3 to avoid massive cytolysis and possibly to mimic silent in vivo infection, as EV infections can cause little or no clinical symptoms. Under these experimental conditions, only a proportion of cells appeared to be involved in viral replication, suggesting a mechanism of carrier-state culture (19 , 20) . Specific receptors are major determinants for cell and tissue tropism of nonenveloped viruses and may modulate pathogenic expression of disease. In the present study, we show, at RNA and protein levels, that islet MECs express appropriate receptor and coreceptor molecules, such as HCAR, DAF, integrins, and ICAM-1 (10 11 12) , that have differentiated functions on virus attachment and entry into target cells. Notably, the infection appears to up-regulate the expression of DAF, HCAR, and integrin {alpha}vß3 on these cells, in contrast to the behavior of other macro- and microvascular EC lines, i.e., HUVEC, HMEC-1, and human aortic ECs. In fact, it has been shown that CVB infection down-regulates DAF on HUVEC and HMEC-1 (20) and leaves HCAR expression unchanged on HUVEC (29) , and in the present work, we show that the infection down-regulates HCAR expression and up-regulates DAF expression on human aortic ECs. This differential behavior underlines the widely accepted heterogeneity of phenotype and function among ECs derived from different vascular beds (23 , 24) and may be relevant for the pathological sequelae of the infection. Despite detailed knowledge of the molecular structure and virus interaction of HCAR, its biological and possible pathogenic relevance is uncertain. HCAR belongs to the immunoglobulin superfamily and appears to have signaling functions (10 , 11 , 32) . Remarkably, CAR has been shown to be up-regulated on affected cardiomyocytes in a rat model of experimental autoimmune myocarditis (13) and in human idiopatic dilated cardiomyopathy (11) , for which EVs are the most frequently implicated pathogens (33) . CAR expression could therefore represent a key determinant of cardiac susceptibility to viral infections and have a pathogenic relevance in chronic cardiomyopathies. It has also been suggested that cell-to-cell contact modulates CAR-to-CAR interaction-based signals (29 , 32) .

The present study supports the notion that the target cell response critically determines the outcome of a viral infection (15 16 17 18 19 20) , represented in this study by the activation of infected islet MECs. In time-course analyses, infected cells transiently up-regulated expression of two major adhesion molecules, which may have in vivo functional consequences, enhancing cellular recruitment and leading to persistent tissue inflammation. Indeed, in vitro mixed culture experiments with islet MECs and peripheral mononuclear cells showed an increased adhesion to CVB-infected monolayers, providing an indication that endothelial cell infection could be involved in mononuclear cell transmigration and homing in the islets. Infection also increased the production of proinflammatory cytokines, IL-1ß, IL-6, and IL-8, further contributing to viral pathogenetic sequelae and to an indirect amplification of virus specific and nonspecific responses. In this scenario, an exacerbated local inflammatory response secondary to viral infection represents an attempt to restrict virus replication, but it could promote chemoattraction and homing of circulating viral or, in susceptible individuals, islet antigen-specific T cells, in a bystander activation model (5) . Cytokines may also be directly toxic to ß-cells, leading to release of sequestered antigens, presentation by professional dendritic cells, and activation of autoantigen-specific T cells. ECs themselves may serve as antigen-presenting cells (34 , 35) .

The islet MEC infection was accompanied by increased production of IFN-{alpha}; type I interferons through autocrine/paracrine loops may play a role in initiation and maintenance of chronic CVB infection, as shown for other infected cell lines, including islet ß-cells (9 , 18 , 27 , 36) . Due to its immunoregulatory properties, IFN-{alpha} represents a link between the innate and the adaptive immunity: a pathological event may commence with activation of the innate immune system to avoid cytolytic destruction. Viral expansion of nonspecific T cell responses has been shown to be mimicked by injection of IFN-{alpha} (37) or IFN-{alpha} expression by pancreatic ß-cells (38 , 39) . In humans, IFN-{alpha} has been detected in ß-cells (40 , 41) and in blood of type 1 diabetic patients (42) .

Again, in dilated cardiomyopathy inflammatory endothelial activation is present, and endothelial CAM expression correlates with the intramyocardial counterreceptor-bearing lymphocyte infiltrates (43 , 44) . In this model, it is likely that endothelial cells are infected before cardiotropic viruses invade the myocardium (45) . Human and murine studies indicate that also during autoimmune insulitis the islet MECs adopt an activated phenotype and are likely to be involved in regulating mononuclear cell accumulation in the islets (46 47 48) .

In the present study, we observed an increased production of lymphotactin RNA by the infected cells. Lymphotactin is a chemokine with the ability to chemoattract highly specifically CD4+ and CD8+ T cells and NK cells (49 , 50) , with possible antiviral and antitumor effects. An inappropriate T cell infiltration, drawn by lymphotactin, is present in other inflammatory conditions (51 , 52) . In our study, an increased lymphotactin production could not be confirmed in the infected cell supernatants. However, leukocytes respond to chemokines immobilized on the surface of the endothelium presented by highly glycosylated specific proteins, with content and composition of cell surface glycosaminoglycans varying with the endothelial site (53) . Lymphotactin exposed on infected islet MECs could, therefore, play a role in islet infiltration by T cells.

In conclusion, against the background that the islet microendothelium is acquiring a role in type 1 and type 2 diabetes, due to its distinctive structural and functional features (26 , 54) , the present report highlights it as a key target of persistent coxsackievirus infection with a potential, in susceptible individuals, for recruitment and expansion of immune responses directed against islet autoantigens.


   ACKNOWLEDGMENTS
 
This work was supported by a grant from Regione Piemonte (I), Ricerca Sanitaria Finalizzata, and by MURST (I), Progetto FIRB (n.RBAU013W3J-004). E. Favaro is supported by FIRB. M. Peakman was supported by Diabetes UK.

Received for publication January 26, 2007. Accepted for publication April 5, 2007.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Rose, N. R., Herskowitz, A., Neumann, D. A. (1993) Autoimmunity in myocarditis: models and mechanisms. Clin. Immunol. Immunopathol. 2,95-99[CrossRef]
  2. Luppi, P., Rudert, W. A., Zanone, M. M., Stassi, G., Trucco, G., Finegold, D., Boyle, G. J., del Nido, P., McGowan, F. X., Trucco, M. (1998) Idiopathic dilated cardiomyopathy: a superantigen-driven autoimmune disease. Circulation 98,777-785[Abstract/Free Full Text]
  3. Hyöty, H., Taylor, K. W. (2002) The role of viruses in human diabetes. Diabetologia 45,1353-1361[CrossRef][Medline]
  4. Varela-Calvino, R., Peakman, M. (2003) Enteroviruses and type 1 diabetes. Diabetes Metab. Res. Rev. 19,431-441[CrossRef][Medline]
  5. Horwitz, M. S., Bradley, L. M., Harbertson, J., Krahl, T., Lee, J., Sarvetnick, N. (1998) Diabetes induced by Coxsackie virus: initiation by bystander damage and not molecular mimicry. Nature Med. 4,781-785[CrossRef][Medline]
  6. Wucherpfennig, K. W. (2001) Mechanisms for the induction of autoimmunity by infectious agents. J. Clin. Invest. 108,1097-1104[CrossRef][Medline]
  7. Chatterjee, N. K., Nejman, C., Gerling, I. (1988) Purification and characterization of a strain of coxsackievirus B4 of human origin that induces diabetes in mice. J. Med. Virol. 26,57-69[CrossRef][Medline]
  8. Roivainen, M., Rasilainen, S., Ylipaasto, P., Nissinen, R., Ustinov, J., Bouwens, L., Eizirik, D. L., Hovi, T., Otonkoskil, T. (2000) Mechanisms of coxsackievirus-induced damage to human pancreatic beta-cells. J. Clin. Endocrinol. Metab. 85,432-440[Abstract/Free Full Text]
  9. Chehadeh, W., Kerr-Conte, J., Pattou, F., Alm, G., Lefebvre, J., Wattre, , Hober, D. (2000) Persistent infection of human pancreatic islets by coxsackievirus B is associated with alpha interferon synthesis in beta cells. J. Virol. 74,10153-10164[Abstract/Free Full Text]
  10. Bergelson, J. M., Cunningham, J. A., Droguett, G., Kurt-Jones, E. A., Krithivas, A., Hong, J. S., Horwitz, M. S., Crowell, R. L., Finberg, R. W. (1997) Isolation of a common receptor for Coxsackie B viruses and Adenoviruses 2 and 5. Science 275,1320-1323[Abstract/Free Full Text]
  11. Noutsias, M., Fechner, H., de Jonge, H., Wang, X., Dekkers, D., Houtsmuller, A.B., Pauschinger, M., Bergelson, J., Warraich, R., Yacoub, M., et al (2001) Human coxsackie-adenovirus receptor is colocalized with integrins alpha(v) beta(3) and alpha(v) beta(5) on the cardiomyocyte sarcolemma and up-regulated in dilated cardiomyopathy: implications for cardiotropic viral infections. Circulation 104,275-280[Abstract/Free Full Text]
  12. Shafren, D. R. (1998) Viral cell entry induced by cross-linked decay-accelerating factor. J. Virol. 72,9407-9412[Abstract/Free Full Text]
  13. Ito, M., Kodama, M., Masuko, M., Yamaura, M., Fuse, K., Uesugi, Y., Hirono, S., Okura, Y., Kato, K., Hotta, Y., et al (2000) Expression of coxsackievirus and adenovirus receptor in hearts of rats with experimental autoimmune myocarditis. Circ. Res. 86,275-280[Abstract/Free Full Text]
  14. Selinka, H. C., Wolde, A., Pasch, A., Klingel, K., Schnorr, J. J., Kupper, J. H., Lindberg, A. M., Kandolf, R. (2004) Virus-receptor interactions of coxsackie B viruses and their putative influence on cardiotropism. Med. Microbiol. Immunol. 193,127-131[CrossRef][Medline]
  15. Flodstrom, M., Maday, A., Balakrishna, D., Cleary, M. M., Yoshimura, A., Sarvetnick., N. (2002) Target cell defense prevents the development of diabetes after viral infection. Nat. Immunol. 3,373-382[CrossRef][Medline]
  16. Flodstrom, M., Tsai, D., Fine, C., Maday, A., Sarvetnick, N. (2003) Diabetogenic potential of human pathogens uncovered in experimentally permissive beta-cells. Diabetes 52,2025-2034[Abstract/Free Full Text]
  17. Friedman, H. M., Macarak, E. J., MacGregor, R. R., Wolfe, J. A., Kefalides, N. A. (1981) Virus infection of endothelial cells. J. Infect. Dis. 143,266-273[Medline]
  18. Huber, S. A., Haisch, C., Lodge, P. A. (1990) Functional diversity in vascular endothelial cells: role in Coxsackievirus tropism. J. Virol. 64,4516-4522[Abstract/Free Full Text]
  19. Conaldi, P. G., Serra, C., Mossa, A., Falcone, V., Basolo, F., Camussi, G., Dolei, A., Toniolo, A. (1997) Persistent infection of human vascular endothelial cells by Group B Coxsackieviruses. J. Infect. Dis. 175,693-696[Medline]
  20. Zanone, M. M., Favaro, E., Conaldi, P. G., Greening, J., Bottelli, A., Cavallo Perin, P., Klein, N. J., Peakman, M., Camussi, G. (2003) Persistent infection of human microvascular endothelial cells by Coxsackie B viruses induces increased expression of adhesion molecules. J. Immunol. 171,438-446[Abstract/Free Full Text]
  21. Saijets, S., Ylipaasto, P., Vaarala, O., Hovi, T., Roivainen, M. (2003) Enterovirus infection and activation of human umbilical vein endothelial cells. J. Med. Virol. 70,430-439[CrossRef][Medline]
  22. Carlos, T. M., Harlan, J. M. (1994) Leukocyte-endothelial adhesion molecules. Blood 84,2068-2101[Abstract/Free Full Text]
  23. Swerlick, R. A., Lee, K. H., Wick, T. M., Lawley, T. J. (1992) Human dermal microvascular endothelial cells but not human umbilical vein endothelial cells express CD36 in vivo and in vitro. J. Immunol. 148,78-83[Abstract]
  24. Lidington, E. A., Moyes, D. L., McCormack, A. M., Rose, M. L. (1999) A comparison of primary endothelial cells and endothelial cell lines for studies of immune interactions. Transpt. Immunol. 7,239-246[CrossRef]
  25. Huang, G. C., Zhao, M., Jones, P., Persaud, S., Ramracheya, R., Lobner, K., Christie, M., Banga, J. P., Peakmam, M., Sirinivsan, P., Rela, M., Heaton, N., Amiel, S. (2004) The development of new density gradient media for purifying human islets and islets-quality assessments. Transplantation 77,143-145[Medline]
  26. Zanone, M. M., Favaro, E., Doublier, S., Lozanoska-Oscher, B., Deregibus, M. C., Greening, J., Huang, G. C., Klein, N., Cavallo Perin, P., Peakman, M., et al (2005) Expression of nephrin by human pancreatic islet endothelial cells. Diabetologia 48,1789-1797[CrossRef][Medline]
  27. Conaldi, P. G., Biancone, L., Bottelli, A., De Martino, A., Camussi, G., Toniolo, A. (1997) Distinct pathogenetic effects of Group B Coxsackieviruses on the human glomerular and tubular kidney cells. J. Virol. 71,9180-9187[Abstract]
  28. Camussi, G., Aglietta, M., Malavasi, F., Tetta, C., Piacibello, W., Sanavio, F., Bussolino, F. (1983) The release of plateled activating factor from human endothelial cell in culture. J. Immunol. 131,2397-2403[Abstract]
  29. Carson, S. D., Hobbs, J. T., Tracy, S. M., Chapman, N. M. (1999) Expression of the coxsackievirus and adenovirus receptor in cultured human umbilical vein endothelial cells: regulation in response to cell density. J. Virol. 73,7077-7079[Abstract/Free Full Text]
  30. Hingonari, A. D., Cross, J. C., Kharbanda, R. K., Mullen, M. J., Bhagat, K., Taylor, M., Donald, A. E., Palacios, M., Griffin, G. E., Deanfield, J. E., et al (2000) Acute systemic inflammation impairs endothelium-dependent dilatation in humans. Circulation 102,994-999[Abstract/Free Full Text]
  31. Charakida, M., Donald, A. E., Terese, M., Leary, S., Halcox, J. P., Ness, A., Smith, G. D., Golding, J., Friberg, P., Klein, N. K., et al (2005) Endothelial dysfunction in childhood infection. Circulation 2005,1660-1665
  32. Fechner, H., Noutsias, M., Tschoepe, C., Hinze, K., Wang, X., Escher, F., Pauschinger, M., Dekkers, D., Vetter, R., Paul, M., et al (2003) Induction of Coxsackievirus-adenovirus receptor expression during myocardial tissue formation and remodelling. Circulation 107,876-882[Abstract/Free Full Text]
  33. Feldman, A. M. (2000) Medical progress: myocarditis. N. Engl. J. Med. 343,1388-1398[Free Full Text]
  34. Greening, J. E., Tree, T. I., Kotowicz, K., van Halteren, A. G., Roep, B. O., Klein, N., Peakman, M. (2003) Processing and presentation of the islet autoantigen GAD by vascular endothelial cells promotes transmigration of autoreactive T cells. Diabetes 52,717-725[Abstract/Free Full Text]
  35. Savinov, A. Y., Wong, F. S., Stonebraker, A. C., Chervonsky, A. V. (2003) Presentation of antigen by endothelial cells and chemoattraction are required for homing of insulin-specific CD8+ T cells. J. Exp. Med. 197,643-656[Abstract/Free Full Text]
  36. Heim, A., Canu, A., Kirschner, P., Simon, T., Mall, G., Hofschneider, P. H., Kandolf, R. (1992) Synergistic interaction of interferon-beta and interferon-gamma in coxsackievirus B3-infected carrier cultures of human myocardial fibroblasts. J. Infect. Dis. 166,958-965[Medline]
  37. Tough, D. F., Sprent, J. (1996) Viruses and T cell turnover: evidence for bystander proliferation. Immunol. Rev. 150,129-142[CrossRef][Medline]
  38. Stewart, T. A., Hultgren, B., Huang, X., Pitts-Meek, S., Hully, J., MacLachlan, N. J. (1993) Induction of type I diabetes by interferon-alpha in transgenic mice. Science 260,1942-1946[Abstract/Free Full Text]
  39. Chakrabarti, D., Hultgren, B., Stewart, T. A. (1996) IFN-alpha induces autoimmune T cells through the induction of intracellular adhesion molecule-1 and B7.2. J. Immunol. 157,522-528[Abstract]
  40. Foulis, A. K., Farquharson, M. A., Meager, A. (1987) Immunoreactive alpha-interferon in insulin-secreting beta cells in type 1 diabetes mellitus. Lancet 2,1423-1427[CrossRef][Medline]
  41. Huang, X., Yuang, J., Goddard, A., Foulis, A., James, R. F., Lernmark, A., Pujol-Borrell, R., Rabinovitch, A., Somoza, N., Stewart, T. A. (1995) Interferon expression in the pancreases of patients with type I diabetes. Diabetes 44,658-664[Abstract]
  42. Chehadeh, W., Weill, J., Vantyghem, M. C., Alm, G., Lefebvre, J., Wattre, P., Hober, D. (2000) Increased level of interferon-alpha in blood of patients with insulin-dependent diabetes mellitus: relationship with coxsackievirus B infection. J. Infect. Dis. 181,1929-1939[CrossRef][Medline]
  43. Noutsias, M., Seeberg, B., Schultheiss, H. P., Kuhl, U. (1999) Expression of cell adhesion molecules in dilated cardiomyopathy: evidence for endothelial activation in inflammatory cardiomyopathy. Circulation 99,2124-2131[Abstract/Free Full Text]
  44. Seko, H., Matsuda, K., Kato, Y., Hashimoto, H., Yagita, K., Okumura, , Yasaki, Y. (1993) Expression of intercellular adhesion molecule 1 in murine hearts with acute myocarditis caused by coxsackievirus B3. J. Clin. Invest. 91,1327-1336[Medline]
  45. Klingel, K., Hohenadl, C., Canu, A., Albrecht, M., Seemann, M., Mall, G., Kandolf, R. (1992) Ongoing enterovirus-induced myocarditis is associated with persistent heart muscle infection: quantitative analysis of virus replication, tissue damage, and inflammation. Proc. Natl. Acad. Sci. U. S. A. 89,314-318[Abstract/Free Full Text]
  46. Hanninen, A., Taylor, C., Streeter, P. R., Stark, L. S., Sarte, J. M., Shizuru, J. A., Simell, O., Michie, S. A. (1993) Vascular addressins are induced on islet vessels during insulitis in nonobese diabetic mice and are involved in lymphoid cell binding to islet endothelium. J. Clin. Invest. 92,2509-2515[Medline]
  47. Hanninen, A., Jalkanen, S., Salmi, M., Toikkanen, S., Nikolakaros, G., Simell, O. (1992) Macrophages, T cell receptor usage, and endothelial cell activation in the pancreas at the onset of insulin-dependent diabetes mellitus. J. Clin. Invest. 90,1901-1910[Medline]
  48. Somoza, N., Vargas, F., Roura-Mir, C., Vives-Pi, M., Fernandez-Figueras, M. T., Ariza, A., Gomis, R., Bragado, R., Marti, M., et al (1994) Pancreas in recent onset insulin-dependent diabetes mellitus: changes in HLA, adhesion molecules and autoantigens, restricted T-cell receptor V beta usage, and cytokine profile. J. Immunol. 153,1360-1377[Abstract]
  49. Kennedy, J., Kelner, G. S., Kleyensteuber, S., Schall, T. J., Weiss, M. C., Yssel, H., Schneider, P. V., Cocks, B. G., Bacon, K. B., Zlotnik, A. (1995) Molecular cloning and functional characterization of human lymphotactin. J. Immunol. 155,203-209[Abstract]
  50. Hedrick, J. A., Saylor, V., Figueroa, D., Mizoue, L., Xu, Y., Menon, S., Abrams, J., Handel, T., Zlotnik, A. (1997) Lymphotactin is produced by NK cells and attracts both NK cells and T cells in vivo. J. Immunol. 158,1533-1540[Abstract]
  51. Middel, P., Thelen, P., Blaschke, S., Polzien, F., Reich, K., Blaschke, V., Wrede, A., Hummel, K. M., Gunawan, B., Radzun, H. J. (2001) Expression of the T-cell chemoattractant chemokine lymphotactin in Crohn’s disease. Am. J. Pathol. 159,1751-1761[Abstract/Free Full Text]
  52. Blaschke, S., Middel, P., Dorner, B. G., Blaschke, V., Hummel, K. M., Kroczek, R. A., Reich, K. P., Benoehr, M., Koziolek, , Muller, G. A. (2003) Expression of activation-induced, T cell-derived, and chemokine-related cytokine/lymphotactin and its functional role in rheumatoid arthritis. Arthritis Rheum. 48,1858-1872[CrossRef][Medline]
  53. Peterson, F. C., Elgin, E. S., Nelson, T. J., Zhang, F., Hoeger, T. J., Linhardt, R. J., Volkman, B. F. (2004) Identification and characterization of a glycosaminoglycan recognition element of the C chemokine lymphotactin. J. Biol. Chem. 279,12598-12604[Abstract/Free Full Text]
  54. Olsson, R., Carlsson, P. O. (2006) The pancreatic islet endothelial cell: emerging roles in islet function and disease. Int. J. Biochem. Cell Biol. 38,492-497[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Arterioscler. Thromb. Vasc. Bio.Home page
Y.-L. Guo, R. Bai, C. X-J Chen, D.-Q. Liu, Y. Liu, C.-Y. Zhang, and K. Zen
Role of Junctional Adhesion Molecule-Like Protein in Mediating Monocyte Transendothelial Migration
Arterioscler. Thromb. Vasc. Biol., January 1, 2009; 29(1): 75 - 83.
[Abstract] [Full Text] [PDF]

Home page
 JCBHome page
C. Q.F. Wang and C. Y. Cheng
A seamless trespass: germ cell migration across the seminiferous epithelium during spermatogenesis
J. Cell Biol., August 9, 2007; 178(4): 549 - 556.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-7905comv1
21/12/3308    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zanone, M. M.
Right arrow Articles by Camussi, G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zanone, M. M.
Right arrow Articles by Camussi, G.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS