FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.07-8073com.
(The FASEB Journal. 2007;21:2931-2938.)
© 2007 FASEB
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.07-8073comv1
21/11/2931    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, Z.
Right arrow Articles by Gu, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Z.
Right arrow Articles by Gu, J.

Immunoglobulin G expression in carcinomas and cancer cell lines

Zhengshan Chen and Jiang Gu1

Department of Pathology, Peking (Beijing) University Health Science Center, Beijing, China

1Correspondence: Department of Pathology, School of Basic Medical Sciences, Peking University Health Science Center, 38 Xueyuan Rd., Haidian District, Beijing 100083, China. E-mail: Jianggu{at}bjmu.edu.cn


   ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
The traditional view that immunoglobulin is produced only by differentiated B lymphocytes has been challenged as immunoglobulin genes have been found to be expressed in nonhematopoietic human cancer cells. However, this phenomenon has not been widely accepted, and knowledge about this newly discovered concept is limited. In this study, we investigated the IgG1 heavy chain (IGHG1) constant region gene and IgG protein expression in 6 cell lines, including epithelial cancer cells, and in tissues from 66 hyperplasias, adenomas, and carcinomas. We also studied the mechanism of IgG production in these cells by examining the expression of RAG1 (recombination activating gene 1), RAG2, and AID (activation-induced cytidine deaminase). In cancer cell lines, mRNA of the IGHG1 constant region and I{gamma}-C{gamma} sterile transcript were detected by nested RT-PCR, and Ig {gamma} and Ig {kappa} proteins were detected by immunofluorescence and Western blot. In surgically resected carcinoma tissues, we detected mRNA of the IGHG1 constant region by in situ hybridization, and by laser microdissection-assisted nested RT-PCR. Ig {gamma} and Ig {kappa} proteins were detected by immunohistochemistry. The V(D)J recombination of IgH and IgL loci, the S{gamma}1/2-Sµ switch circle, and the expression of RAG1 and RAG2 were also found in these cancer cell lines. These data suggest that cancer cells are capable of producing IgG. Because of its potential biological and clinical significance, this phenomenon warrants further investigation.—Chen, Z. and Gu, J. Immunoglobulin G expression in carcinomas and cancer cell lines.


Key Words: in situ hybridization • laser microdissection


   INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
TRADITIONALLY, IT WAS believed that the only source of immunoglobulins (Igs) was mature B lymphocytes. Recently, some researchers reported that Ig could also be detected in carcinoma cells (which are derived from epithelium). In 1998, Kimoto, using nested RT-PCR, detected gene transcripts of the Ig heavy chain constant region and T cell receptor (TCR) in four carcinoma cell lines, including SW116 (human colon carcinoma), HEp2 (human esophagus carcinoma), MCF-7 (human breast carcinoma), and MDA-MB-231 (human breast carcinoma) (1) , but expression of the corresponding proteins were not examined in that study. Recently, two reports showed that human cancer cell lines expressed mRNA of IgG heavy chain variable region (2 , 3) . Cao et al. detected expression of Ig {kappa} in a nasopharyngeal carcinoma (NPC) cell line (4) . However, as yet, no study has identified the Ig {kappa} chain as a product in other nonlymphoid cells. Because of scarcity of reports on the gene expression of IgG in cancer cell lines and cancer tissues, there is still a controversy regarding the expression of Ig protein by these cells. Qiu et al. reported the presence of Ig in cultured cancer cell lines, as well as in human cancer tissues and secreted Ig was also found in the culture medium (2) . In contrast, Babbage et al. did not detect any expression of immunoglobulins in epithelial breast cancer cell lines by flow cytometry, although they detected mRNA of the IgG heavy chain variable region (3) .

The human immune system recognizes an immense variety of different pathogens and responds dynamically as microorganisms evolve in the course of an infection (5) . Immature B lymphocytes generate diversity in the antibody repertoire by rearranging the variable (V), diversity (D), and joining (J) segments of the light and heavy Ig chains. The rearrangement of V(D)J segments is initiated by proteins RAG1 (recombination activating gene 1), and RAG2 (6 , 7) , which bind to and cleave the double-stranded DNA at specific recombination signal sites, and the cleaved ends are subsequently joined together by the end joining repair system (8 , 9) . Qiu et al. found gene expression of RAG1 and RAG2 in three epithelial cancer cell lines (2) . In contrast, Babbage et al. did not detect the expression of RAG1 or RAG2 in breast cancer cell lines (3) .

There are two additional types of genetic alteration in B cells, namely, somatic hypermutation of V genes and class switch recombination (CSR) of Ig genes. Both of these processes take place in the germinal centers of lymphoid organs (10 , 11) . Activation-induced cytidine deaminase (AID) is required for both CSR and somatic hypermutation (12 13 14 15 16 17 18) . CSR is yielded by looping-out deletion of the genomic DNA between the recombined S regions (19) and the switch circle (SC), which includes the IH promoter upstream of the targeted S region, the DNA segment between Sµ and the targeted S region, and Cµ is generated as an extrachromosomal reciprocal switch DNA recombination product (20) . It is of note that Babbage et al. found AID constitutively expressed in breast cancer cell lines (3) . The expression of AID in other cancer cell lines has not been studied.

In this study, we first examined a number of human cancer cell lines and cancerous tissues from various organs in order to determine whether the IgG1 heavy chain (IGHG1) constant region was expressed by using nested RT-PCR, in situ hybridization and laser microdissection-assisted nested RT-PCR. Then, we investigated the I{gamma}-C{gamma} sterile germ line transcripts, the endogenous V(D)J recombination of IgH and IgL loci and the S{gamma}1/2-Sµ switch circle in the cell lines. We also investigated whether there was expression of IgG proteins and Ig {kappa} chain in these cell lines and tissues, as the literature up to now has been controversial with respect to these points. Lastly, we explored the mechanism of IgG production in these cells by examining the expression of RAG1, RAG2, and AID.


   MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Cell lines and clinical tissues
Human epithelial cancer cell lines derived from lung (A549), liver (BCL-7402), uterine cervix (HeLa S3), prostate (PC3), and embryonic renal epithelial cell line (293) were cultured in DMEM (GIBCO) with 10% FBS. Burkitt lymphoma cell line (Raji) was cultured in RPMI 1640 (GIBCO) with 10% FBS at 37°C in a humidified atmosphere with 5% CO2.

Paraffin-embedded sections from a total of 66 resected tissues, including 11 lung carcinomas (7 squamous cell carcinomas, 2 adenocarcinomas, 1 adenosquamous carcinoma, and 1 small cell carcinoma), 10 cervical carcinomas (7 squamous cell carcinomas and 3 adenocarcinomas), 10 hepatocellular carcinomas, 1 liver cirrhosis, 10 prostate carcinomas, 11 breast carcinomas (8 invasive ductal carcinomas, 1 invasive lobular carcinoma, 1 medullary carcinoma, and 1 intraductal carcinoma in situ), 6 fibroadenomas of breast, and 7 mastopathies were selected from the archives of the Department of Pathology, Peking University Health Science Center, Beijing, PR China. The surgical tissues had been fixed immediately after excision in 10% buffered formalin for 24 h, processed, and sectioned at 5 µm.

Flow cytometry
To exclude the possibility of contamination by B lymphocytes in these cell lines (A549, BCL-7402, 293, HeLa S3, PC3), the cells were harvested and washed with PBS, then stained with monoclonal anti-human CD19-FITC (Becton Dickinson, San Diego, CA) for 30 min at 4°C, washed, and analyzed by flow cytometry. In all cases, 10,000 events were acquired. The CD19+ Raji cell line was used as a positive control. Background corrections were obtained by incubating cells with a control antibody of appropriate isotype.

Genomic PCRs
Genomic DNA was extracted from the cell lines using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI). The primers for the endogenous VDJ recombination of IgH were V3, V4f, V6, and LJH used previously (2) . The primers for the VJ recombination of IgL were V{kappa}1 5' GACATCGAGCTCACCCAGTCTCC 3'or V{kappa}2 5' GAAATTGAGCTCACGCAGTCTCCA 3' (sense) and a common J-gene antisense primer (21) . The S{gamma}1/2-Sµ switch circle was amplified from 1 µg of genomic DNA using a previously described nested PCR strategy (22) . The identity of PCR products was confirmed by DNA sequencing. Genomic ß-actin was amplified as previously reported (22) .

RT-PCRs
Total RNA was extracted using Trizol reagent (Invitrogen) and reverse transcription of total RNA was performed using the ThermoscriptTM RT-PCR System (Invitrogen) following the manufacturer's instructions. PCR primers used for amplifying the constant region of the IgG1 heavy chain (IGHG1) were as follows: External 5' ACGGCGTGGAGGTGCATAATG 3' (sense) and 5' CGGGAGGCGTGGTCTTGTAGTT 3' (antisense) and internal 5' GACTGGCTGAATGGCAAGGAG 3' (sense) and 5' GGCGATGTCGCTGGGATAGAA 3' (antisense). The sense and antisense primers were located in different exons, so we could discriminate between transcripts and genomic DNA easily. The PCR product, predicted to be 201 bp in size, was separated on 2% agarose gel by electrophoresis. The identification of the PCR product was confirmed by DNA sequencing.

We analyzed the I{gamma}-C{gamma} sterile germ line transcript by nested RT-PCR. The external primers were I{gamma} and C{gamma} primers described previously (23) . The internal primers were 5' GGTGAACCGAGGGGCTTGT 3' (sense) and 5' CGCTGCTGAGGGAGTAGAGT 3' (antisense). The final product was 311 bp in size. The identity of the PCR product was confirmed by DNA sequencing.

To analyze AID gene expression, a nested RT-PCR assay was used. We chose the conserved active site of cytidine deaminase as our target. Primers were prepared as follows: External 5' GAAGAGGCGTGACAGTGCT 3' (sense) and 5' CGAAATGCGTCTCGTAAGT 3' (antisense); internal 5' CCTTTTCACTGGACTTTGG 3' (sense) and 5' TGATGGCTATTTGCACCCC 3' (antisense). The final product was 294 bp in size.

For amplification of RAG1 and RAG2, which have no introns, RQ1 RNase-free DNase (Promega, Madison, WI) was used to treat RNA samples to exclude contamination by genomic DNA. Negative control was amplified using the treated RNA as a template. Raji was used as a positive control. Nested RT-PCR was performed as described previously (24) . The identity of the PCR product was confirmed by DNA sequencing.

Immunofluorescence and immunohistochemistry
Cells were grown on slides and fixed in acetone for 15 min. The slides were incubated with 0.2% Triton X-100 for 15 min, washed with PBS, and blocked for 60 min in PBS containing 10% normal goat serum. The primary antibody, rabbit anti-human IgG antibody ({gamma} chain specific, 1:500; Dako, Carpinteria, CA) or mouse anti-human {kappa} chain antibody (1:50; Zymed Laboratories, South San Francisco, CA) was added and incubated overnight at 4°C. PBS was used for the control sections. The slides were then washed and incubated with goat anti-rabbit IgG-TRITC or goat anti-mouse IgG-FITC for 30 min at room temperature, washed, and incubated with Hoechst 33342 (1:500; Sigma, St. Louis, MO) for 30 min. After a final wash, slides were mounted with glycerine PBS and examined under a standard confocal microscope.

Deparaffinized, rehydrated tissue sections were incubated with 3% hydrogen peroxide for 30 min, placed in 1 mM Tris/EDTA antigen retrieval solution (pH 9.0), and heated at 95°C in a microwave oven for 20 min. The slides were then washed with PBS, treated with 10% normal horse serum for 30 min, and reacted overnight at 4°C with the primary antibody, rabbit anti-human IgG antibody ({gamma} chain specific, 1:1000; Dako, Carpinteria, CA) or mouse anti-human Ig {kappa} chain antibody (1:500; Zymed Laboratories, South San Francisco, CA). PBS was used for the control sections. After slides were washed, they were incubated with goat anti-rabbit or goat anti-mouse IgG-HRP (PV9000, Zymed Laboratories, South San Francisco, CA) for 30 min at room temperature, and the reaction was detected using DAB (Dako). Finally, all sections were counterstained lightly with hematoxylin.

SDS-PAGE and Western blot
The cytosol protein (crude protein at 40 µg/well) was analyzed in 10% SDS-PAGE (IgG under nonreducing conditions and Ig {kappa} under reducing conditions). Standard human IgG (0.05 µg/well, Sigma, St. Louis, MO) was used as a positive control. After electrophoresis, the separated proteins were transferred from the gel to a polyvinylidene difluoride membrane. For indirect staining, goat anti-human IgG (whole molecule, 1:1500; Sigma, St. Louis, MO), goat anti-human IgG ({gamma} chain, 1:500; Sigma, St. Louis, MO) and rabbit anti-human {kappa} light chain (1:1500; Dako) were used as primary antibodies. Rabbit anti-goat IgG-HRP (1:5000; Dako) and goat anti-rabbit IgG-HRP (1:5000; Dako) were used as secondary antibodies.

cDNA subclone and generation of digoxigenin-labeled cRNA probes
Three milliliters of peripheral blood were obtained from a healthy individual, and mononuclear cells were isolated by density gradient centrifugation with Ficoll-Hypaque. Interphase cells (mononuclear cells) were collected and washed with 0.01 M PBS. Total RNA was extracted using Trizol reagent (Invitrogen), and reverse transcription of total RNA was performed using random primers and AMV-RT (Promega) following the manufacturer's instructions. PCR primers used for amplifying the constant region of the IgG1 heavy chain (IGHG1) are shown as follows: Upstream primer 5' ACGGCGTGGAGGTGCATAATG 3' and downstream primer 5' CGGGAGGCGTGGTCTTGTAGTT 3'. The PCR product was 351 bp in size. By using the Gel DNA Extraction kit (Tiangen Biotech, Beijing, China), the PCR product was extracted from gel and subcloned into pGM-T vector by T4 ligase (Tiangen Biotech, Beijing, China). The identity of the plasmid was confirmed by DNA sequencing. The plasmid was linearized with NcoI or SalI and used for RNA transcription with T7 or Sp6 RNA polymerase to generate antisense or sense probes, respectively, in the presence of digoxigenin-labeled rUTP (Roche Diagnostics, Rotkreuz, Switzerland).

In situ hybridization
Deparaffinized, dehydrated tissue sections (5 µm) were incubated in 0.1 M HCl for 10 min, and heated to 95°C in a microwave oven in 0.01 M citrate buffer (pH 6.0) for 20 min. The slides were cooled to room temperature, washed with PBS, fixed in 4% paraformaldehyde for 10 min, and hybridized overnight at 45°C with human IGHG1 cRNA probe. After hybridization, sections were washed in 2xSSC plus 50% formamide for 30 min and 2xSSC twice for 15 min (55°C). The samples were incubated with antidigoxigenin antibody conjugated with alkaline phosphatase (dilution 1:500; Roche Diagnostics, Rotkreuz, Switzerland). 5-Bromo-4-chloro-3-indolyl phosphate and nitro-blue-tetrazolium (Sigma) were used for the color reaction. For the controls, slides were incubated with hybridizing solution only, or with corresponding sense probes. Finally, all sections were counterstained lightly with methyl green.

Laser microdissection
For this experiment, we chose 8 frozen clinical samples, including 6 breast invasive ductal carcinomas, 1 pulmonary squamous cell carcinoma, and 1 pulmonary adenosquamous cell carcinoma (archival tissues, Department of Pathology, Peking University Health Science Center). Frozen tissues were sectioned at 8 µm and mounted on pretreated slides (Leica Microsystems). The slides were quickly fixed in 70% ethanol for 1 min, rinsed in diethyl pyrocarbonate (DEPC), rinsed with water for 30 s, stained with hematoxylin for 1 min, and rinsed in DEPC-treated water for 30 s. All of the reagents were prepared with DEPC-treated water. Slides were then used for LMD using the Leica Microdissection Systems (Leica Microsystems). Total RNA was isolated from microdissected cancer cells by using the RNeasy Micro Kit (Qiagen, Hilden, Germany). Reverse transcription was carried out with the Sensiscript RT Kit (Qiagen). The primers for IGHG1 and AID were the same as those used for the cell lines. The identity of the PCR product was confirmed by DNA sequencing.


   RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
Expression of IgG heavy chain constant region mRNA and I{gamma}-C{gamma} sterile transcript in several human cancer cell lines
To confirm that the human cell lines were not contaminated with B lymphocytes, we used flow cytometry with monoclonal anti-human CD19-FITC, and used Raji cells as a positive control. None of the cell lines tested expressed CD19 except Raji cells (Fig. 1 ). Since previous studies have demonstrated gene expression of the IgG heavy chain variable region in several cell lines, including HeLa S3, HeLa MR, A549, HT-29 (2) , and three breast cancer cell lines (3) , we investigated only the IgG expression of the constant region in this study. We analyzed for the mRNA of the IGHG1 constant region using nested RT-PCR and detected it in lung cancer cell line (A549), liver cancer cell line (BCL-7402), human embryonic renal epithelial cell line (293), cervical cancer cell line (HeLa S3), prostate cancer cell line (PC3) and in the Burkitt lymphoma cell line (Raji). We also detected the I{gamma}-C{gamma} sterile germ line transcript in BCL-7402, 293, HeLa S3, PC3, and Raji (Fig. 2 ).


Figure 1
View larger version (26K):
[in this window]
[in a new window]

 
Figure 1. Flow cytometry showing the lack of expression of CD19 in various cell lines except Raji cells (positive control). Black line: negative control; Gray line: monoclonal anti-human CD19-FITC.


Figure 2
View larger version (46K):
[in this window]
[in a new window]

 
Figure 2. Expression of IGHG1, I{gamma}-C{gamma}, AID, RAG1, and RAG2 in various cell lines. Raji was used as a positive control. M, DNA marker; Lane 1, A549; lane 2, Bcl-7402; lane 3, 293; lane 4, HeLa S3; lane 5, PC3; lane 6, Raji. R, DNase treated RNA as template; C, cDNA as template.

V(D)J recombination of IgH and IgL loci, the S{gamma}1/2-Sµ switch circle and gene expression of RAG1, RAG2 and AID in human cancer cell lines
We detected the endogenous V(D)J recombination of IgH and IgL loci in A549, Bcl-7402, 293, HeLa S3, PC3, and Raji cells at the genomic DNA level. Then we detected the S{gamma}1/2-Sµ switch circle in A549, Bcl-7402, 293, and Raji cells (Fig. 3 ). We also detected the expression of RAG1 and RAG2 in these cell lines (Fig. 2) . These results indicated that V(D)J recombination of IgH and IgL loci and class switching of IgH took place in these cell lines.


Figure 3
View larger version (49K):
[in this window]
[in a new window]

 
Figure 3. PCR showing the endogenous V(D)J recombination of IgH and IgL loci and the S{gamma}1/2-Sµ switch circle in various cell lines.

To examine the expression of AID, the essential component for somatic hypermutation and CSR in B lymphocytes, we performed nested RT-PCR, choosing its conserved active site as the target. Raji was used as a positive control. We detected expression of AID only in HeLa S3 and Raji (Fig. 2) .

IgG heavy and light chains were detected in the cytoplasm of many human cancer cell lines
To localize IgG heavy and light chains, which were expressed, we performed immunofluorescence using rabbit anti-human IgG ({gamma} heavy chain specific) polyclonal antibody and mouse anti-human Ig {kappa} chain monoclonal antibody. We found Ig {gamma} and Ig {kappa} staining in A549, BCL-7402, 293, HeLa S3, and PC3 cell lines. Ig {gamma} and Ig {kappa} were located predominantly in the cytoplasm but were also found on the cell membrane ( Fig. 5A ). Consistent with this finding, Western blot analysis using goat anti-human IgG whole molecule antibody and goat anti-human IgG {gamma} chain antibody demonstrated immune staining at MW 150,000, which corresponds to the molecular size of standard human IgG. We also detected the {kappa} light chain by using rabbit anti-human {kappa} light chain antibody in these cell lines (Fig. 4 ).


Figure 4
View larger version (25K):
[in this window]
[in a new window]

 
Figure 4. Western blot showing IgG expression in various cell lines. A) Primary antibody: goat anti-human IgG (whole molecule). B) Primary antibody: goat anti-human IgG ({gamma} chain). C) Primary antibody: rabbit anti-human {kappa} light chain.


Figure 5
View larger version (112K):
[in this window]
[in a new window]

 
Figure 5. A) Immunofluorescence showing IgG expression in various cell lines. 2, 3) Primary antibody was rabbit anti-human IgG antibody ({gamma} chain specific), and secondary antibody was goat anti-rabbit IgG-TRITC. 1, 2) PC3 cell line, with 1 as negative control. 3) A549 cell line. 5, 6) Primary antibody was mouse anti-human Ig {kappa} chain antibody and secondary antibody was goat anti-mouse IgG-FITC. 4, 5) 293 cell line, with 4 as the negative control. 6) HeLa S3 cell line. B and C) Immunohistochemistry showing IgG expression in human epithelial tumor tissues. B) Primary antibody was rabbit anti-human IgG antibody ({gamma} chain specific). 1, 2) Squamous cell lung carcinoma. 3) Hepatocellular carcinoma. 4) Cervical squamous cell carcinoma. 5) Prostate carcinoma. 6) Invasive ductal breast carcinoma. C) Primary antibody was mouse anti-human Ig {kappa} chain antibody. 1, 2) Prostate carcinoma. 3) Hepatocellular carcinoma. 4) Cervical carcinoma. 5) Squamous cell lung carcinoma. 6) Invasive ductal breast carcinoma. 7, 8) Breast fibroadenoma. 9, 10) Mastopathy. 11, 12) Liver cirrhosis. 1, 7, 9, 11 were negative controls. D) In situ hybridization showing IgG gene expression in human cancerous tissues and cancer sample before and after LMD. 1, 2) Cervical squamous cell carcinoma. 3, 4) Hepatocellular carcinoma. 1, 3 were detected with sense probe. 2, 4 were detected with antisense probe. 5) Lung adenosquamous cell carcinoma before LMD. 6) After LMD.

Detection of IgG heavy and light chains in malignant and benign human epithelial tissues
We first used rabbit anti-human IgG {gamma} chain specific polyclonal antibody and mouse anti-human Ig {kappa} chain monoclonal antibody to determine the expression of IgG in resected tissues. Using immunohistochemistry, both antibodies gave similar results. In all evaluated cancer tissues, including those from breast cancer (n=11), liver cancer (n=10), cervical cancer (n=10), prostate cancer (n=10), and lung cancer (n=11), positive staining was detected in the cytoplasm and on the cell membrane. Usually, ~50% of the tumor cells on a given slide expressed Ig {gamma} and Ig {kappa}, mainly in the cytoplasm (Fig. 5 B, C). B lymphocytes and plasma cells were clearly identifiable among the tumor cells by their morphology. Furthermore, tumor-infiltrating B lymphocytes and plasma cells had a stronger positive reaction than tumor cells. In the cirrhotic liver tissue, Ig {gamma} and Ig {kappa} could also be detected in many hepatocytes. In 2 out of 6 breast fibroadenomas, myoepithelium was focally positive for Ig {gamma} and Ig {kappa} immunostaining, while the glandular epithelium was negative. In 1 out of 7 mastopathy tissues, Ig {gamma}- and Ig {kappa}-positive granules could be detected in the apical side of the cytoplasm or in the lumen of the gland (Fig. 5C ), and the latter was probably secreted by the glandular epithelium. Tissues from the remaining cases of breast fibroadenoma and mastopathy were negative for Ig {gamma} and Ig {kappa} immunostaining.

IgG heavy chain constant region mRNA was expressed in many human cancer tissues as detected by in situ hybridization and laser microdissection-assisted nested RT-PCR
We also examined the expression of IgG mRNA by in situ hybridization using the cRNA of the IGHG1 constant region segment as a probe. Human IgG gene transcripts were demonstrated in samples of breast cancer, lung cancer, cervical cancer, liver cancer, and prostate cancer (Fig. 5D ). The tumor cells had a light purple color, while the infiltrating B lymphocytes or plasma cells had a purple blue color, suggesting that the quantity of IgG RNA in the tumor cells was much less. We did laser microdissection (LMD) and examined the expression of IGHG1 and AID using nested RT-PCR in cancer cells from tissue. Eight clinical cancer samples, including 1 pulmonary squamous cell carcinoma, 1 pulmonary adenosquamous cell carcinoma, and 6 invasive ductal breast carcinomas were chosen. Raji was used as a positive control. We detected the expression of IGHG1 in all 8 samples but did not detect the expression of AID (Fig. 6 ).


Figure 6
View larger version (24K):
[in this window]
[in a new window]

 
Figure 6. Expression of IGHG1 and AID in cancer cells, using laser microdissection assisted nested RT-PCR. M, DNA marker; Lane 1, squamous cell lung carcinoma; lane 2, adenosquamous cell lung carcinoma; lanes 3–8, invasive ductal breast carcinoma.


   DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 
In this study, we examined various human epithelial cancers, including cancers of the lung, liver, prostate, breast, and uterine cervix, together with their corresponding cell lines, and detected gene expression of IgG in these cells. The expression of IgG was widespread in epithelial cancers from many organs. Previous reports have demonstrated the expression of IgG heavy chain in tissue from epithelial cancers of lung, liver, colon, and breast, as well as in cancer cell lines of the same provenance (2 , 3) . However, whether IgG protein exists intracellularly has been controversial (2 , 3) . Here, we established the presence of cytoplasmic and membranous IgG heavy chain, as well as light chain, in these cells. In addition, because it has been reported that the variable (V) region of the IgG gene is expressed in tumor cells and cancer cell lines (2 , 3) , we also investigated the mechanism of IgG formation by examining the expression of RAG1, RAG2, and AID in these cells. We found RAG1 and RAG2 expression in all of the cell lines that expressed IGHG1, but AID was expressed only in a cervical cancer cell line (HeLa S3) and in Raji cells. Our finding of RAG1 and RAG2 expression by cancer cells is concordant with that of Qiu et al. (2) . Babbage et al. did not detect RAG1 and RAG2 but found constitutive expression of AID in six breast cancer cell lines (3) , whereas we detected AID expression only in HeLa S3 and Rajii cells, but not in others. It is possible that this discrepancy is related to employment of different cell lines in the study of Babbage et al.'s and in our study. It is also possible that AID is not involved in IgG production in epithelial cancers, because we did not detect expression of AID in resected epithelial cancer tissues.

It has been known for decades that the growth of tumor grafts can be enhanced by immune reaction, including antibody production (25) . Prehn suggested that immunostimulation of primary tumors may occur and that weak immune reactions against primary tumors stimulate, rather than suppress, cancer growth (26 , 27) . In some models, Igs, either produced actively or administered passively, enhanced the growth of tumor transplants (28 , 29) . Although the exact mechanism of antibody enhancement of tumor growth remains unclear, it was hypothesized that antibodies may do so by blocking target epitopes on the cancer cells (30) . Hellstrom et al. suggested that the ability of lymphocytes to destroy their targets may be diminished in vivo by serum "factors" that protect the neoplastic cells specifically (akin to enhancing antibodies) or nonspecifically (31) . Sjogren suggested that the blocking factor in sera from tumor-bearing animals is an antigen-antibody complex, capable of binding to target cells and/or reacting with lymphocytes immune to their antigens, thus blocking the lymphocyte reactivity (32) . Our data and previous studies (2 , 3) suggest that one source of tumor-protecting Ig could be the epithelial tumor cells. Qiu et al. reported induction of cancer cell apoptosis and inhibition of cancer growth by blocking tumor-derived IgG, using either antisense oligodeoxynucleotide (ASODN) or anti-human Ig, thus confirming that IgG secreted by epithelial cancers had some unidentified capacity to promote the growth and survival of tumor cells (2) .

It is also possible that the tumor-reactive antibodies are modified. An increased level of highly glycosylated Igs was reported in ovarian cancer patients (33) . These highly glycosylated Igs are asymmetrically glycosylated, and exhibit enhanced concanavalin-A binding (33) . Similar asymmetrically glycosylated Igs were isolated from placenta and are elevated in sera of pregnant women (33 , 34) . Although the altered Igs in pregnancy can recognize self-antigen, they are nonprecipitating and do not mediate effector functions (35) . This is proposed as one potential mechanism involved in suppression of the maternal immune response against the fetus. A similar mechanism may protect tumors from being suppressed by antibodies (36) . However, it is not certain in this study whether the IgG produced by epithelial tumor cells was asymmetrically glycosylated Ig.

Other types of Igs might be also produced by cancer cells. Qiu et al. reported that IgM was expressed in tumor cell lines, albeit at a much lower level than IgG (2) . By the same token, Babbage et al. found expression of VH of IgM and IgA in breast cancer cell lines (3) .

It is of interest that we also detected IgG in cirrhotic tissue and embryonic renal cells (293). There was also weak and focal expression of IgG heavy and light chains in benign breast lesions. Reportedly, the expression of Igs is not limited to epithelial cancer cells, but can also be detected in non-neoplastic proliferating cells (2) , thus explaining the presence of IgG in cirrhosis, embryonic cells and possibly fibroadenoma of the breast. While the production of IgG by cancer cells derived from epithelium and other proliferating cells has been established, its function and clinical significance in cancer development and growth remains to be explored.


   ACKNOWLEDGMENTS
 
We thank Professor Xiaoyan Qiu (Peking University Center for Human Disease Genomics) for providing the cell line Raji and for her advice. We also thank Feng Li (Department of Anatomy, Histology and Embryology, Peking University Health Science Center) and Jingping Yang (Department of Pathology, Peking University Health Science Center) for their help in tissue sectioning. We thank Professors Wei Hsueh and Michael McNutt for their invaluable assistance in preparing the manuscript. We also want to acknowledge the support of the Li Fu Educational Foundation.

Received for publication March 5, 2007. Accepted for publication March 8, 2007.


   REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
 

  1. Kimoto, Y. (1998) Expression of heavy-chain constant region of immunoglobulin and T-cell receptor gene transcripts in human non-hematopoietic tumor cell lines. Genes Chromosomes Cancer 22,83-86[CrossRef][Medline]
  2. Qiu, X., Zhu, X., Zhang, L., Mao, Y., Zhang, J., Hao, P., Li, G., Lv, P., Li, Z., Sun, X., et al (2003) Human epithelial cancers secrete immunoglobulin g with unidentified specificity to promote growth and survival of tumor cells. Cancer Res. 63,6488-6495[Abstract/Free Full Text]
  3. Babbage, G., Ottensmeier, C. H., Blaydes, J., Stevenson, F. K., Sahota, S. S. (2006) Immunoglobulin heavy chain locus events and expression of activation-induced cytidine deaminase in epithelial breast cancer cell lines. Cancer Res. 66,3996-4000[Abstract/Free Full Text]
  4. Liu, H. D., Zheng, H., Li, M., Hu, D. S., Tang, M., Cao, Y. (2007) Upregulated expression of kappa light chain by Epstein-Barr virus encoded latent membrane protein 1 in nasopharyngeal carcinoma cells via NF-kappaB and AP-1 pathways. Cell Signal. 19,419-427[CrossRef][Medline]
  5. Maizels, N. (2005) Immunoglobulin gene diversification. Annu. Rev. Genet. 39,23-46[CrossRef][Medline]
  6. Bassing, C. H., Swat, W., Alt, F. W. (2002) The mechanism and regulation of chromosomal V(D)J recombination. Cell 109(Suppl),S45-S55[CrossRef][Medline]
  7. Gellert, M. (2002) V(D)J recombination: RAG proteins, repair factors, and regulation. Annu. Rev. Biochem. 71,101-132[CrossRef][Medline]
  8. Gellert, M. (1997) Recent advances in understanding V(D)J recombination. Adv. Immunol. 64,39-64[Medline]
  9. Oettinger, M. A. (1999) V(D)J recombination: on the cutting edge. Curr. Opin. Cell Biol. 11,325-329[CrossRef][Medline]
  10. Jacob, J., Kelsoe, G., Rajewsky, K., Weiss, U. (1991) Intraclonal generation of antibody mutants in germinal centres. Nature 354,389-392[CrossRef][Medline]
  11. Liu, Y. J., Malisan, F., de Bouteiller, O., Guret, C., Lebecque, S., Banchereau, J., Mills, F. C., Max, E. E., Martinez-Valdez, H. (1996) Within germinal centers, isotype switching of immunoglobulin genes occurs after the onset of somatic mutation. Immunity 4,241-250[CrossRef][Medline]
  12. Muramatsu, M., Sankaranand, V. S., Anant, S., Sugai, M., Kinoshita, K., Davidson, N. O., Honjo, T. (1999) Specific expression of activation-induced cytidine deaminase (AID), a novel member of the RNA-editing deaminase family in germinal center B cells. J. Biol. Chem. 274,18470-18476[Abstract/Free Full Text]
  13. Revy, P., Muto, T., Levy, Y., Geissmann, F., Plebani, A., Sanal, O., Catalan, N., Forveille, M., Dufourcq-Labelouse, R., Gennery, A., et al (2000) Activation-induced cytidine deaminase (AID) deficiency causes the autosomal recessive form of the Hyper-IgM syndrome (HIGM2). Cell 102,565-575[CrossRef][Medline]
  14. Muramatsu, M., Kinoshita, K., Fagarasan, S., Yamada, S., Shinkai, Y., Honjo, T. (2000) Class switch recombination and hypermutation require activation-induced cytidine deaminase (AID), a potential RNA editing enzyme. Cell 102,553-563[CrossRef][Medline]
  15. Petersen, S., Casellas, R., Reina-San-Martin, B., Chen, H. T., Difilippantonio, M. J., Wilson, P. C., Hanitsch, L., Celeste, A., Muramatsu, M., Pilch, D. R., et al (2001) AID is required to initiate Nbs1/gamma-H2AX focus formation and mutations at sites of class switching. Nature 414,660-665[CrossRef][Medline]
  16. Okazaki, I. M., Kinoshita, K., Muramatsu, M., Yoshikawa, K., Honjo, T. (2002) The AID enzyme induces class switch recombination in fibroblasts. Nature 416,340-345[CrossRef][Medline]
  17. Petersen-Mahrt, S. K., Harris, R. S., Neuberger, M. S. (2002) AID mutates E. coli suggesting a DNA deamination mechanism for antibody diversification. Nature 418,99-103[Medline]
  18. Yoshikawa, K., Okazaki, I. M., Eto, T., Kinoshita, K., Muramatsu, M., Nagaoka, H., Honjo, T. (2002) AID enzyme-induced hypermutation in an actively transcribed gene in fibroblasts. Science 296,2033-2036[Abstract/Free Full Text]
  19. Snapper, C. M., Marcu, K. B., Zelazowski, P. (1997) The immunoglobulin class switch: beyond "accessibility". Immunity 6,217-223[CrossRef][Medline]
  20. Iwasato, T., Shimizu, A., Honjo, T., Yamagishi, H. (1990) Circular DNA is excised by immunoglobulin class switch recombination. Cell 62,143-149[CrossRef][Medline]
  21. Goebel, P., Janney, N., Valenzuela, J. R., Romanow, W. J., Murre, C., Feeney, A. J. (2001) Localized gene-specific induction of accessibility to V(D)J recombination induced by E2A and early B cell factor in nonlymphoid cells. J. Exp. Med. 194,645-656[Abstract/Free Full Text]
  22. Cerutti, A., Zan, H., Schaffer, A., Bergsagel, L., Harindranath, N., Max, E. E., Casali, P. (1998) CD40 ligand and appropriate cytokines induce switching to IgG, IgA, and IgE and coordinated germinal center and plasmacytoid phenotypic differentiation in a human monoclonal IgM+IgD+ B cell line. J. Immunol. 160,2145-2157[Abstract/Free Full Text]
  23. Cerutti, A., Zan, H., Kim, E. C., Shah, S., Schattner, E. J., Schaffer, A., Casali, P. (2002) Ongoing in vivo immunoglobulin class switch DNA recombination in chronic lymphocytic leukemia B cells. J. Immunol. 169,6594-6603[Abstract/Free Full Text]
  24. Lynch, S., Kelleher, D., McManus, R., O'Farrelly, C. (1995) RAG1 and RAG2 expression in human intestinal epithelium: evidence of extrathymic T cell differentiation. Eur. J. Immunol. 25,1143-1147[Medline]
  25. Schreiber, H., Wu, T. H., Nachman, J., Rowley, D. A. (2000) Immunological enhancement of primary tumor development and its prevention. Semin. Cancer Biol. 10,351-357[CrossRef][Medline]
  26. Prehn, R. T. (1994) Stimulatory effects of immune reactions upon the growths of untransplanted tumors. Cancer Res. 54,908-914[Abstract/Free Full Text]
  27. Prehn, R. T. (1996) The paradoxical association of regression with a poor prognosis in melanoma contrasted with a good prognosis in keratoacanthoma. Cancer Res. 56,937-940[Abstract/Free Full Text]
  28. Snell, G. D. (1957) Incompatibility reactions to tumor homotransplants with particular reference to the role of the tumor; a review. Cancer Res. 17,2-10[Free Full Text]
  29. Kaliss, N. (1958) Immunological enhancement of tumor homografts in mice: a review. Cancer Res. 18,992-1003[Free Full Text]
  30. Manson, L. A. (1994) Anti-tumor immune responses of the tumor-bearing host: the case for antibody-mediated immunologic enhancement. Clin. Immunol. Immunopathol. 72,1-8[CrossRef][Medline]
  31. Hellstrom, I., Hellstrom, K. E., Evans, C. A., Heppner, G. H., Pierce, G. E., Yang, J. P. (1969) Serum-mediated protection of neoplastic cells from inhibition by lymphocytes immune to their tumor-specific antigens. Proc. Natl. Acad. Sci. U. S. A. 62,362-368[Abstract/Free Full Text]
  32. Sjogren, H. O., Hellstrom, I., Bansal, S. C., Hellstrom, K. E. (1971) Suggestive evidence that the "blocking antibodies" of tumor-bearing individuals may be antigen–antibody complexes. Proc. Natl. Acad. Sci. U. S. A. 68,1372-1375[Abstract/Free Full Text]
  33. Gercel-Taylor, C., Bazzett, L. B., Taylor, D. D. (2001) Presence of aberrant tumor-reactive immunoglobulins in the circulation of patients with ovarian cancer. Gynecol. Oncol. 81,71-76[CrossRef][Medline]
  34. Zenclussen, A. C., Gentile, T., Kortebani, G., Mazzolli, A., Margni, R. (2001) Asymmetric antibodies and pregnancy. Am. J. Reprod. Immunol. 45,289-294[CrossRef][Medline]
  35. Margni, R. A., Malan Borel, I. (1998) Paradoxical behavior of asymmetric IgG antibodies. Immunol. Rev. 163,77-87[CrossRef][Medline]
  36. Luborsky, J. L., Barua, A., Shatavi, S. V., Kebede, T., Abramowicz, J., Rotmensch, J. (2005) Anti-tumor antibodies in ovarian cancer. Am. J. Reprod. Immunol. 54,55-62[Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.07-8073comv1
21/11/2931    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chen, Z.
Right arrow Articles by Gu, J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chen, Z.
Right arrow Articles by Gu, J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS