|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Pathology, Peking (Beijing) University Health Science Center, Beijing, China
1Correspondence: Department of Pathology, School of Basic Medical Sciences, Peking University Health Science Center, 38 Xueyuan Rd., Haidian District, Beijing 100083, China. E-mail: Jianggu{at}bjmu.edu.cn
| ABSTRACT |
|---|
|
|
|---|
-C
sterile transcript were detected by nested RT-PCR, and Ig
and Ig
proteins were detected by immunofluorescence and Western blot. In surgically resected carcinoma tissues, we detected mRNA of the IGHG1 constant region by in situ hybridization, and by laser microdissection-assisted nested RT-PCR. Ig
and Ig
proteins were detected by immunohistochemistry. The V(D)J recombination of IgH and IgL loci, the S
1/2-Sµ switch circle, and the expression of RAG1 and RAG2 were also found in these cancer cell lines. These data suggest that cancer cells are capable of producing IgG. Because of its potential biological and clinical significance, this phenomenon warrants further investigation.—Chen, Z. and Gu, J. Immunoglobulin G expression in carcinomas and cancer cell lines.
Key Words: in situ hybridization laser microdissection
| INTRODUCTION |
|---|
|
|
|---|
in a nasopharyngeal carcinoma (NPC) cell line (4)
chain as a product in other nonlymphoid cells. Because of scarcity of reports on the gene expression of IgG in cancer cell lines and cancer tissues, there is still a controversy regarding the expression of Ig protein by these cells. Qiu et al. reported the presence of Ig in cultured cancer cell lines, as well as in human cancer tissues and secreted Ig was also found in the culture medium (2)
The human immune system recognizes an immense variety of different pathogens and responds dynamically as microorganisms evolve in the course of an infection (5)
. Immature B lymphocytes generate diversity in the antibody repertoire by rearranging the variable (V), diversity (D), and joining (J) segments of the light and heavy Ig chains. The rearrangement of V(D)J segments is initiated by proteins RAG1 (recombination activating gene 1), and RAG2 (6
, 7)
, which bind to and cleave the double-stranded DNA at specific recombination signal sites, and the cleaved ends are subsequently joined together by the end joining repair system (8
, 9)
. Qiu et al. found gene expression of RAG1 and RAG2 in three epithelial cancer cell lines (2)
. In contrast, Babbage et al. did not detect the expression of RAG1 or RAG2 in breast cancer cell lines (3)
.
There are two additional types of genetic alteration in B cells, namely, somatic hypermutation of V genes and class switch recombination (CSR) of Ig genes. Both of these processes take place in the germinal centers of lymphoid organs (10
, 11)
. Activation-induced cytidine deaminase (AID) is required for both CSR and somatic hypermutation (12
13
14
15
16
17
18)
. CSR is yielded by looping-out deletion of the genomic DNA between the recombined S regions (19)
and the switch circle (SC), which includes the IH promoter upstream of the targeted S region, the DNA segment between Sµ and the targeted S region, and Cµ is generated as an extrachromosomal reciprocal switch DNA recombination product (20)
. It is of note that Babbage et al. found AID constitutively expressed in breast cancer cell lines (3)
. The expression of AID in other cancer cell lines has not been studied.
In this study, we first examined a number of human cancer cell lines and cancerous tissues from various organs in order to determine whether the IgG1 heavy chain (IGHG1) constant region was expressed by using nested RT-PCR, in situ hybridization and laser microdissection-assisted nested RT-PCR. Then, we investigated the I
-C
sterile germ line transcripts, the endogenous V(D)J recombination of IgH and IgL loci and the S
1/2-Sµ switch circle in the cell lines. We also investigated whether there was expression of IgG proteins and Ig
chain in these cell lines and tissues, as the literature up to now has been controversial with respect to these points. Lastly, we explored the mechanism of IgG production in these cells by examining the expression of RAG1, RAG2, and AID.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Paraffin-embedded sections from a total of 66 resected tissues, including 11 lung carcinomas (7 squamous cell carcinomas, 2 adenocarcinomas, 1 adenosquamous carcinoma, and 1 small cell carcinoma), 10 cervical carcinomas (7 squamous cell carcinomas and 3 adenocarcinomas), 10 hepatocellular carcinomas, 1 liver cirrhosis, 10 prostate carcinomas, 11 breast carcinomas (8 invasive ductal carcinomas, 1 invasive lobular carcinoma, 1 medullary carcinoma, and 1 intraductal carcinoma in situ), 6 fibroadenomas of breast, and 7 mastopathies were selected from the archives of the Department of Pathology, Peking University Health Science Center, Beijing, PR China. The surgical tissues had been fixed immediately after excision in 10% buffered formalin for 24 h, processed, and sectioned at 5 µm.
Flow cytometry
To exclude the possibility of contamination by B lymphocytes in these cell lines (A549, BCL-7402, 293, HeLa S3, PC3), the cells were harvested and washed with PBS, then stained with monoclonal anti-human CD19-FITC (Becton Dickinson, San Diego, CA) for 30 min at 4°C, washed, and analyzed by flow cytometry. In all cases, 10,000 events were acquired. The CD19+ Raji cell line was used as a positive control. Background corrections were obtained by incubating cells with a control antibody of appropriate isotype.
Genomic PCRs
Genomic DNA was extracted from the cell lines using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI). The primers for the endogenous VDJ recombination of IgH were V3, V4f, V6, and LJH used previously (2)
. The primers for the VJ recombination of IgL were V
1 5' GACATCGAGCTCACCCAGTCTCC 3'or V
2 5' GAAATTGAGCTCACGCAGTCTCCA 3' (sense) and a common J-gene antisense primer (21)
. The S
1/2-Sµ switch circle was amplified from 1 µg of genomic DNA using a previously described nested PCR strategy (22)
. The identity of PCR products was confirmed by DNA sequencing. Genomic ß-actin was amplified as previously reported (22)
.
RT-PCRs
Total RNA was extracted using Trizol reagent (Invitrogen) and reverse transcription of total RNA was performed using the ThermoscriptTM RT-PCR System (Invitrogen) following the manufacturer's instructions. PCR primers used for amplifying the constant region of the IgG1 heavy chain (IGHG1) were as follows: External 5' ACGGCGTGGAGGTGCATAATG 3' (sense) and 5' CGGGAGGCGTGGTCTTGTAGTT 3' (antisense) and internal 5' GACTGGCTGAATGGCAAGGAG 3' (sense) and 5' GGCGATGTCGCTGGGATAGAA 3' (antisense). The sense and antisense primers were located in different exons, so we could discriminate between transcripts and genomic DNA easily. The PCR product, predicted to be 201 bp in size, was separated on 2% agarose gel by electrophoresis. The identification of the PCR product was confirmed by DNA sequencing.
We analyzed the I
-C
sterile germ line transcript by nested RT-PCR. The external primers were I
and C
primers described previously (23)
. The internal primers were 5' GGTGAACCGAGGGGCTTGT 3' (sense) and 5' CGCTGCTGAGGGAGTAGAGT 3' (antisense). The final product was 311 bp in size. The identity of the PCR product was confirmed by DNA sequencing.
To analyze AID gene expression, a nested RT-PCR assay was used. We chose the conserved active site of cytidine deaminase as our target. Primers were prepared as follows: External 5' GAAGAGGCGTGACAGTGCT 3' (sense) and 5' CGAAATGCGTCTCGTAAGT 3' (antisense); internal 5' CCTTTTCACTGGACTTTGG 3' (sense) and 5' TGATGGCTATTTGCACCCC 3' (antisense). The final product was 294 bp in size.
For amplification of RAG1 and RAG2, which have no introns, RQ1 RNase-free DNase (Promega, Madison, WI) was used to treat RNA samples to exclude contamination by genomic DNA. Negative control was amplified using the treated RNA as a template. Raji was used as a positive control. Nested RT-PCR was performed as described previously (24)
. The identity of the PCR product was confirmed by DNA sequencing.
Immunofluorescence and immunohistochemistry
Cells were grown on slides and fixed in acetone for 15 min. The slides were incubated with 0.2% Triton X-100 for 15 min, washed with PBS, and blocked for 60 min in PBS containing 10% normal goat serum. The primary antibody, rabbit anti-human IgG antibody (
chain specific, 1:500; Dako, Carpinteria, CA) or mouse anti-human
chain antibody (1:50; Zymed Laboratories, South San Francisco, CA) was added and incubated overnight at 4°C. PBS was used for the control sections. The slides were then washed and incubated with goat anti-rabbit IgG-TRITC or goat anti-mouse IgG-FITC for 30 min at room temperature, washed, and incubated with Hoechst 33342 (1:500; Sigma, St. Louis, MO) for 30 min. After a final wash, slides were mounted with glycerine PBS and examined under a standard confocal microscope.
Deparaffinized, rehydrated tissue sections were incubated with 3% hydrogen peroxide for 30 min, placed in 1 mM Tris/EDTA antigen retrieval solution (pH 9.0), and heated at 95°C in a microwave oven for 20 min. The slides were then washed with PBS, treated with 10% normal horse serum for 30 min, and reacted overnight at 4°C with the primary antibody, rabbit anti-human IgG antibody (
chain specific, 1:1000; Dako, Carpinteria, CA) or mouse anti-human Ig
chain antibody (1:500; Zymed Laboratories, South San Francisco, CA). PBS was used for the control sections. After slides were washed, they were incubated with goat anti-rabbit or goat anti-mouse IgG-HRP (PV9000, Zymed Laboratories, South San Francisco, CA) for 30 min at room temperature, and the reaction was detected using DAB (Dako). Finally, all sections were counterstained lightly with hematoxylin.
SDS-PAGE and Western blot
The cytosol protein (crude protein at 40 µg/well) was analyzed in 10% SDS-PAGE (IgG under nonreducing conditions and Ig
under reducing conditions). Standard human IgG (0.05 µg/well, Sigma, St. Louis, MO) was used as a positive control. After electrophoresis, the separated proteins were transferred from the gel to a polyvinylidene difluoride membrane. For indirect staining, goat anti-human IgG (whole molecule, 1:1500; Sigma, St. Louis, MO), goat anti-human IgG (
chain, 1:500; Sigma, St. Louis, MO) and rabbit anti-human
light chain (1:1500; Dako) were used as primary antibodies. Rabbit anti-goat IgG-HRP (1:5000; Dako) and goat anti-rabbit IgG-HRP (1:5000; Dako) were used as secondary antibodies.
cDNA subclone and generation of digoxigenin-labeled cRNA probes
Three milliliters of peripheral blood were obtained from a healthy individual, and mononuclear cells were isolated by density gradient centrifugation with Ficoll-Hypaque. Interphase cells (mononuclear cells) were collected and washed with 0.01 M PBS. Total RNA was extracted using Trizol reagent (Invitrogen), and reverse transcription of total RNA was performed using random primers and AMV-RT (Promega) following the manufacturer's instructions. PCR primers used for amplifying the constant region of the IgG1 heavy chain (IGHG1) are shown as follows: Upstream primer 5' ACGGCGTGGAGGTGCATAATG 3' and downstream primer 5' CGGGAGGCGTGGTCTTGTAGTT 3'. The PCR product was 351 bp in size. By using the Gel DNA Extraction kit (Tiangen Biotech, Beijing, China), the PCR product was extracted from gel and subcloned into pGM-T vector by T4 ligase (Tiangen Biotech, Beijing, China). The identity of the plasmid was confirmed by DNA sequencing. The plasmid was linearized with NcoI or SalI and used for RNA transcription with T7 or Sp6 RNA polymerase to generate antisense or sense probes, respectively, in the presence of digoxigenin-labeled rUTP (Roche Diagnostics, Rotkreuz, Switzerland).
In situ hybridization
Deparaffinized, dehydrated tissue sections (5 µm) were incubated in 0.1 M HCl for 10 min, and heated to 95°C in a microwave oven in 0.01 M citrate buffer (pH 6.0) for 20 min. The slides were cooled to room temperature, washed with PBS, fixed in 4% paraformaldehyde for 10 min, and hybridized overnight at 45°C with human IGHG1 cRNA probe. After hybridization, sections were washed in 2xSSC plus 50% formamide for 30 min and 2xSSC twice for 15 min (55°C). The samples were incubated with antidigoxigenin antibody conjugated with alkaline phosphatase (dilution 1:500; Roche Diagnostics, Rotkreuz, Switzerland). 5-Bromo-4-chloro-3-indolyl phosphate and nitro-blue-tetrazolium (Sigma) were used for the color reaction. For the controls, slides were incubated with hybridizing solution only, or with corresponding sense probes. Finally, all sections were counterstained lightly with methyl green.
Laser microdissection
For this experiment, we chose 8 frozen clinical samples, including 6 breast invasive ductal carcinomas, 1 pulmonary squamous cell carcinoma, and 1 pulmonary adenosquamous cell carcinoma (archival tissues, Department of Pathology, Peking University Health Science Center). Frozen tissues were sectioned at 8 µm and mounted on pretreated slides (Leica Microsystems). The slides were quickly fixed in 70% ethanol for 1 min, rinsed in diethyl pyrocarbonate (DEPC), rinsed with water for 30 s, stained with hematoxylin for 1 min, and rinsed in DEPC-treated water for 30 s. All of the reagents were prepared with DEPC-treated water. Slides were then used for LMD using the Leica Microdissection Systems (Leica Microsystems). Total RNA was isolated from microdissected cancer cells by using the RNeasy Micro Kit (Qiagen, Hilden, Germany). Reverse transcription was carried out with the Sensiscript RT Kit (Qiagen). The primers for IGHG1 and AID were the same as those used for the cell lines. The identity of the PCR product was confirmed by DNA sequencing.
| RESULTS |
|---|
|
|
|---|
-C
sterile transcript in several human cancer cell lines
-C
sterile germ line transcript in BCL-7402, 293, HeLa S3, PC3, and Raji (Fig. 2
|
|
V(D)J recombination of IgH and IgL loci, the S
1/2-Sµ switch circle and gene expression of RAG1, RAG2 and AID in human cancer cell lines
We detected the endogenous V(D)J recombination of IgH and IgL loci in A549, Bcl-7402, 293, HeLa S3, PC3, and Raji cells at the genomic DNA level. Then we detected the S
1/2-Sµ switch circle in A549, Bcl-7402, 293, and Raji cells (Fig. 3
). We also detected the expression of RAG1 and RAG2 in these cell lines (Fig. 2)
. These results indicated that V(D)J recombination of IgH and IgL loci and class switching of IgH took place in these cell lines.
|
To examine the expression of AID, the essential component for somatic hypermutation and CSR in B lymphocytes, we performed nested RT-PCR, choosing its conserved active site as the target. Raji was used as a positive control. We detected expression of AID only in HeLa S3 and Raji (Fig. 2)
.
IgG heavy and light chains were detected in the cytoplasm of many human cancer cell lines
To localize IgG heavy and light chains, which were expressed, we performed immunofluorescence using rabbit anti-human IgG (
heavy chain specific) polyclonal antibody and mouse anti-human Ig
chain monoclonal antibody. We found Ig
and Ig
staining in A549, BCL-7402, 293, HeLa S3, and PC3 cell lines. Ig
and Ig
were located predominantly in the cytoplasm but were also found on the cell membrane (
Fig. 5A
). Consistent with this finding, Western blot analysis using goat anti-human IgG whole molecule antibody and goat anti-human IgG
chain antibody demonstrated immune staining at MW 150,000, which corresponds to the molecular size of standard human IgG. We also detected the
light chain by using rabbit anti-human
light chain antibody in these cell lines (Fig. 4
).
|
|
Detection of IgG heavy and light chains in malignant and benign human epithelial tissues
We first used rabbit anti-human IgG
chain specific polyclonal antibody and mouse anti-human Ig
chain monoclonal antibody to determine the expression of IgG in resected tissues. Using immunohistochemistry, both antibodies gave similar results. In all evaluated cancer tissues, including those from breast cancer (n=11), liver cancer (n=10), cervical cancer (n=10), prostate cancer (n=10), and lung cancer (n=11), positive staining was detected in the cytoplasm and on the cell membrane. Usually,
50% of the tumor cells on a given slide expressed Ig
and Ig
, mainly in the cytoplasm (Fig. 5
B, C). B lymphocytes and plasma cells were clearly identifiable among the tumor cells by their morphology. Furthermore, tumor-infiltrating B lymphocytes and plasma cells had a stronger positive reaction than tumor cells. In the cirrhotic liver tissue, Ig
and Ig
could also be detected in many hepatocytes. In 2 out of 6 breast fibroadenomas, myoepithelium was focally positive for Ig
and Ig
immunostaining, while the glandular epithelium was negative. In 1 out of 7 mastopathy tissues, Ig
- and Ig
-positive granules could be detected in the apical side of the cytoplasm or in the lumen of the gland (Fig. 5C
), and the latter was probably secreted by the glandular epithelium. Tissues from the remaining cases of breast fibroadenoma and mastopathy were negative for Ig
and Ig
immunostaining.
IgG heavy chain constant region mRNA was expressed in many human cancer tissues as detected by in situ hybridization and laser microdissection-assisted nested RT-PCR
We also examined the expression of IgG mRNA by in situ hybridization using the cRNA of the IGHG1 constant region segment as a probe. Human IgG gene transcripts were demonstrated in samples of breast cancer, lung cancer, cervical cancer, liver cancer, and prostate cancer (Fig. 5D
). The tumor cells had a light purple color, while the infiltrating B lymphocytes or plasma cells had a purple blue color, suggesting that the quantity of IgG RNA in the tumor cells was much less. We did laser microdissection (LMD) and examined the expression of IGHG1 and AID using nested RT-PCR in cancer cells from tissue. Eight clinical cancer samples, including 1 pulmonary squamous cell carcinoma, 1 pulmonary adenosquamous cell carcinoma, and 6 invasive ductal breast carcinomas were chosen. Raji was used as a positive control. We detected the expression of IGHG1 in all 8 samples but did not detect the expression of AID (Fig. 6
).
|
| DISCUSSION |
|---|
|
|
|---|
It has been known for decades that the growth of tumor grafts can be enhanced by immune reaction, including antibody production (25)
. Prehn suggested that immunostimulation of primary tumors may occur and that weak immune reactions against primary tumors stimulate, rather than suppress, cancer growth (26
, 27)
. In some models, Igs, either produced actively or administered passively, enhanced the growth of tumor transplants (28
, 29)
. Although the exact mechanism of antibody enhancement of tumor growth remains unclear, it was hypothesized that antibodies may do so by blocking target epitopes on the cancer cells (30)
. Hellstrom et al. suggested that the ability of lymphocytes to destroy their targets may be diminished in vivo by serum "factors" that protect the neoplastic cells specifically (akin to enhancing antibodies) or nonspecifically (31)
. Sjogren suggested that the blocking factor in sera from tumor-bearing animals is an antigen-antibody complex, capable of binding to target cells and/or reacting with lymphocytes immune to their antigens, thus blocking the lymphocyte reactivity (32)
. Our data and previous studies (2
, 3)
suggest that one source of tumor-protecting Ig could be the epithelial tumor cells. Qiu et al. reported induction of cancer cell apoptosis and inhibition of cancer growth by blocking tumor-derived IgG, using either antisense oligodeoxynucleotide (ASODN) or anti-human Ig, thus confirming that IgG secreted by epithelial cancers had some unidentified capacity to promote the growth and survival of tumor cells (2)
.
It is also possible that the tumor-reactive antibodies are modified. An increased level of highly glycosylated Igs was reported in ovarian cancer patients (33)
. These highly glycosylated Igs are asymmetrically glycosylated, and exhibit enhanced concanavalin-A binding (33)
. Similar asymmetrically glycosylated Igs were isolated from placenta and are elevated in sera of pregnant women (33
, 34)
. Although the altered Igs in pregnancy can recognize self-antigen, they are nonprecipitating and do not mediate effector functions (35)
. This is proposed as one potential mechanism involved in suppression of the maternal immune response against the fetus. A similar mechanism may protect tumors from being suppressed by antibodies (36)
. However, it is not certain in this study whether the IgG produced by epithelial tumor cells was asymmetrically glycosylated Ig.
Other types of Igs might be also produced by cancer cells. Qiu et al. reported that IgM was expressed in tumor cell lines, albeit at a much lower level than IgG (2)
. By the same token, Babbage et al. found expression of VH of IgM and IgA in breast cancer cell lines (3)
.
It is of interest that we also detected IgG in cirrhotic tissue and embryonic renal cells (293). There was also weak and focal expression of IgG heavy and light chains in benign breast lesions. Reportedly, the expression of Igs is not limited to epithelial cancer cells, but can also be detected in non-neoplastic proliferating cells (2)
, thus explaining the presence of IgG in cirrhosis, embryonic cells and possibly fibroadenoma of the breast. While the production of IgG by cancer cells derived from epithelium and other proliferating cells has been established, its function and clinical significance in cancer development and growth remains to be explored.
| ACKNOWLEDGMENTS |
|---|
Received for publication March 5, 2007. Accepted for publication March 8, 2007.
| REFERENCES |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
T. Adamovic, D. McAllister, V. Guryev, X. Wang, J. W. Andrae, E. Cuppen, H. J. Jacob, and S. L. Sugg Microalterations of Inherently Unstable Genomic Regions in Rat Mammary Carcinomas as Revealed by Long Oligonucleotide Array-Based Comparative Genomic Hybridization Cancer Res., June 15, 2009; 69(12): 5159 - 5167. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen, X. Qiu, and J. Gu Immunoglobulin Expression in Non-Lymphoid Lineage and Neoplastic Cells Am. J. Pathol., April 1, 2009; 174(4): 1139 - 1148. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |