| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,||,1
,||,||,2
Departments of
* Plastic Surgery,
Surgery,
Nephrology, and
Pathology, Rambam Medical Center and the Ruth and Bruce Rappaport Faculty of Medicine and
|| Research Institute, Technion-Israel Institute of Technology, Haifa, Israel
2Correspondence: Department of Surgery, Rambam Medical Center, Haifa 31096, Israel. E-mail: d_hershko{at}rambam.health.gov.il
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: tumorigenesis • cyclin-dependent kinase • hESc differentiation • F-box protein • ubiquitin system
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2
3)
. These kinases, in turn, are under rigorous control by specific Cdk inhibitors at different phases of the cell cycle (4
, 5)
. Among the different Cdk inhibitors, p27 has been shown to have a particularly important role in controlling the rate of cell proliferation. p27 is a negative regulator of protein kinases Cdk2/cyclin E and Cdk2/cyclin A, which drive cells to the S-phase of the cell division cycle. In the normal cell cycle, levels of p27 are high in the G0/G1-phase. After mitogenic stimulation, p27 is rapidly degraded, thus allowing the action of Cdk2/cyclin E and Cdk2/cyclin A to promote cell proliferation (4
, 5)
.
It is now well established that p27 also serves as an important factor in cell differentiation programs of mammalian somatic cells (6)
. Thus, expression of p27 levels is high in differentiated nonproliferative tissue compartments such as skeletal muscle, cartilage, and mesenchymal fibroblasts but low in the transit-amplifying or progenitor compartments of many rapidly renewing epithelial tissues (7)
. The essential role of p27 in regulating normal cell growth and differentiation is clearly demonstrated by the finding of increased body size, organomegaly, and spontaneous pituitary tumor formation in mice lacking p27, and by altered differentiation programs in p27 knockout cells (8
9
10
11)
. Furthermore, loss of p27 was found to promote tumor proliferation and has been shown to be strongly associated with loss of tumor differentiation and poor prognosis in many human cancers (12
13
14
15)
.
The mechanisms that regulate p27 cellular abundance in somatic and transformed cells have been well characterized. It is now clear that the expression of p27 is mainly controlled by its rate of degradation rather than by changes in transcriptional or translational activities (16)
. Degradation of p27 is carried out by the ubiquitin system (17)
, whereby covalent ligation to ubiquitin targets proteins for degradation by the proteasome (18)
. The specificity of the ubiquitin system in targeting proteins for degradation is defined mainly by its ubiquitin ligase complexes (18)
. The machinery involved in targeting p27 for degradation is an SCF-type ubiquitin ligase complex that contains Skp2 as the specific substrate recognition subunit (19
20
21)
. SCF (Skp1-Cullin-F-box protein) complexes belong to a large family of ubiquitin ligases that include several constant subunits (called Cullin-1, Skp1, and ROC1) and a variable subunit known as an F-box protein (22)
. Skp2 is an F-box protein that was originally discovered, along with Skp1, as a protein associated with the S-phase kinase Cdk2/cyclin A (23)
, and hence its name (S-phase kinase-associated protein 2). In the normal cell cycle, levels of Skp2 are low in G0/G1 and rise in the S-phase (23)
. The role of Skp2 as the main rate-limiting regulator for the degradation of p27 has been clearly shown in both intact cells and cell-free systems (19
20
21)
. Moreover, overexpression of Skp2 was found to be the cause of low p27 levels in many human cancers leading to uncontrolled tumor proliferation and poor overall survival (24
25
26
27
28
29)
.
In contrast to mammalian somatic cells, embryonic stem cells are uniquely capable of differentiation into the entire spectrum of specialized cell types derived from all three developmental germ layers, a property termed pluripotency (30)
. However, when propagated in the undifferentiated state under appropriate culture conditions after derivation from the inner cell mass of blastocysts, these cells adopt certain features reminiscent of the transformed state, including abnormal cell cycle regulation and unlimited replicative capacity without senescence (30
31
32)
. This combination of features puts stem cells at the forefront of intensive investigation as potential alternatives for tissue regeneration and other therapeutic interventions, and at the same time raises important questions regarding detailed cellular and molecular mechanisms that govern proliferation and differentiation. Recent studies in murine embryonic stem cells (mESc) provide some clues that may also be applicable to hESc. It has been shown that the rapid cell division observed in undifferentiated mESc is associated with an unusual cell cycle profile dissociated from the usually expected fluctuations in Cdk activities. These cells devote more than half of their cell cycle to S-phase and have relatively short gap phases (31
32
33
34
35)
. It has been suggested that dysregulation of Cdk2 activity may contribute to truncation of G1 (34)
. Moreover, it has been shown that, as differentiation progresses, Cdk2 activity becomes cell cycle dependent and that p27 may have an important role in controlling Cdk2 activity (32)
. Other studies have suggested that p27 may also be essential for the in vitro differentiation process of mESc and mouse embryoid bodies (EBs). mESc lacking p27 undergo apoptosis before completing their differentiation program; mEBs lacking p27 display abnormal development, including larger cell mass and the proliferation and formation of cavities (6
, 36)
.
In contrast to mESc, somatic, or transformed cells, more detailed information regarding the cell cycle and its regulatory proteins in hESc has yet to be obtained. Furthermore, the potential role of cell cycle regulatory proteins in the transition from the undifferentiated to the differentiated state of hESc has yet to be explored. Accordingly, in the present study we focused on the expression and regulation of p27 and its specific ubiquitin ligase subunit Skp2 in undifferentiated and differentiating hESc. The data herein show that p27 and Skp2 are strongly associated with cellular differentiation. Thus, Skp2 was overexpressed and stable in undifferentiated cells, maintaining low p27 levels and high proliferation rates. Moreover, we show for the first time that, in undifferentiated cells, Skp2 was also expressed in the G1-phase of the cell cycle. Up-regulation of p27 levels was observed in differentiated cells along with concomitant down-regulation of Skp2 levels in most cells. Those cells that maintained a high Skp2/p27 ratio showed poorer differentiation features than cells with a low Skp2/p27 ratio.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. For RNA studies, Western blot, and FACS analysis, undifferentiated cells were harvested after two passages on fibronectin-coated plates with supplementation of MEF conditioned medium (37
, 38)
. Differentiation of hES cells was initiated by detaching cells from the feeder layer using collagenase. Cells were replated on bacterial plates and grown in suspension to form embryoid bodies (EBs) for immunohistochemical studies or grown on gelatin-coated plates, where they differentiate as adherent colonies. The latter growth condition is more suitable for RNA, FACS, and Western blot studies. In both differentiation protocols, cells were cultured in DMEM medium supplemented with 10% FBS and 1% glutamine. Samples were collected from the undifferentiated cells and from days 5, 10, 20, and 30 after initiation of cellular differentiation.
Immunohistochemical analysis of paraffin-embedded sections
Undifferentiated hESc and EBs were harvested and fixed for 24 h in 10% neutral buffered formalin (NBF), transferred to 70% ethanol, and processed using a routine wax-embedding procedure for histology examination. Six micrometer sections were deparaffinized with xylene and rehydrated in a series of solutions of progressively decreasing ethanol concentration. For epitope retrieval, slides were heated in 1 mM EDTA buffer in an Antigen Retrieval Processor (Milestone Inc., Sorsiole, Italy) at 120°C for 8 min. After cooling, slides were washed in distilled water. Skp2, cyclin A2, and Ki67 stainings were carried out in a NexES IHC Immunostainer (Ventana Medical Systems, Tucson, AZ, USA), according to the manufacturer's instructions, using monoclonal Skp2 (1:100 dilution; Zymed Inc., San Francisco, CA, USA) and Ki67 (1:300 Dako Cytomation, Glostrup, Denmark) antibodies and a polyclonal antibody for cyclin A2 (1:100 Santa Cruz Biotechnology, Santa Cruz, CA, USA). Slides for p27 and Oct4 staining were treated for 10 min at room temperature with 3% H2O2 in methanol to block endogenous peroxidase and for 30 min with 10% nonimmune rabbit serum to block nonspecific protein binding. The slides were then washed in water and soaked in washing buffer (pH 7.4, Optimax; Biogenex, San Ramon, CA, USA) for 5 min. The monoclonal 27Kip1 antibody (1:500 dilution; BD Transduction Laboratories, Lexington, KY, USA) and Oct4 antibody (1:25 dilution, Santa Cruz Biotechnology) were incubated at 4°C overnight. Staining was completed with a Histostain-plus kit (Zymed) according to the manufacturer's instructions. AEC (3-amino-9-ethylcarbozole) was used as a chromogen for Skp2, p27, and cyclin A2, and D-amino-benzidine was used as a chromogen for Ki67 and Oct4 staining. Finally, slides were counterstained with hematoxylin.
Immunoblotting
Cells were washed, scraped off, and centrifuged for 5 min at 200 g at 4°C, then immediately frozen and stored at –80°C until used. Frozen samples were lysed by incubation with an ice-cold buffer consisting of 50 mM Tris-HCl pH 7.6, 250 mM NaCl, 10 mM EDTA, 0.5% Nonidet P-40, 50 mM NaF, 10 µg/ml leupeptin, 10 µg/ml chymostatin, 10 µg/ml pepstatin, 2 mM N-ethylmaleimide, 1 mM PMSF, and 1:100 protease inhibitor cocktail (Sigma-Aldrich, Urbana, IL, USA). This mixture of protease inhibitors was used to prevent proteolytic degradation of cellular proteins. The homogenates were incubated on ice for 30 min and centrifuged again at 4°C for 15 min at 20,000 g. Supernatants were mixed with sodium dodecyl sulfate electrophoresis (SDS) sample buffer and stored at –20°C until used. Protein concentrations were in the range of 3 to 12 mg/ml. Samples containing 50 µg protein were resolved by electrophoresis on a 12.5% SDS-polyacrylamide gel and transferred to nitrocellulose membranes. The membranes were probed with mouse monoclonal antibodies directed against Skp2 (1:500). p27 (1:500), Oct4 (1:200), p21 (1:500 BD Transduction Laboratories), and Cdh1 (Calbiochem, San Diego, CA, USA), or rabbit polyclonal antibodies against cyclin A2 (1:5000) and Cks1 (1:200 dilution; Zymed) antibodies were diluted in TBS-T (Tris-buffered saline and 0.1% Tween 20) containing 5% (w/v) nonfat dry milk. The same nitrocellulose membranes were also probed with a mouse MoAb directed against Skp1 (1:1000 dilution; Transduction Laboratories). Since levels of Skp1 do not change in the cell cycle, this protein served as an internal control to normalize for loading of cellular protein. After washing with TBST, the immunoreactive proteins were visualized with horseradish-conjugated IgG (Pierce, Rockford, IL, USA) diluted 1:10,000 and an enhanced chemiluminescence system (SuperSignal West Pico, Pierce). All immunoblot analyses were repeated at least twice. Samples were quantified with ImageMaster VSD-CL (Rhenium, Jerusalem, Israel) using DNR Bio Imaging System 303PC software (DNR Bio Imaging Systems, Jerusalem, Israel). Analyses were done using TINA 2.1 software (Raytest, Straubenhardt, Germany).
RNA extraction and real-time RT-PCR
Total RNA was isolated from H9 cells using an RNA isolation kit (Stratagene, Cedar Creek, TX, USA) according to the manufacturer's instructions. The final pellet was dissolved in 40 µl RNase-free water with 1 µg/µl RNasin (Promega, Madison, WI, USA). RNA quantification was performed using spectrophotometry, and samples were diluted to a concentration of 0.5 µg/µl. RNA quality was ascertained by loading 2 µg RNA on RNA-agarose gel (1.2%) and a fine concentration correction was made after quantification using UVIgelstarMw software (UVItec, Cambridge, UK). Only intact RNA was used for further experiments. Quantitative real-time reverse transcription polymerase chain reaction (RT-PCR) analyses for mRNA were performed using Rotor Gene 2000 real-time cycler instrument and software (Corbett, Sydney, Australia) with QuantiTec SYBR Green RT-PCR kit (Qiagen, Valencia, CA, USA). Phosphoglycerate kinase (PGK), a housekeeping gene, was chosen as an internal standard to control for variability in amplification. For each condition, duplicate test tubes containing 100 ng of total RNA and 400 nM Skp2 or PGK gene primers in a total volume of 25 µl were used. The primers used were Skp2: sense primer GCTGCTAAAGGTCTCTGGTGT and antisense primer AGGCTTAGATTC TGCAACTTG; PGK: sense primer TTTAAGGGTTCCTGGCACTG, antisense primer CAGTTTGGAGCTCCTGGAAG, Those PCR reactions yielded single products of either 292 or 200 bp lengths with Tm of 81°C and 83°C for Skp2 and PGK genes, respectively. Reaction profiles used were 35 cycles of 95°C for 5 s, 60°C for 20 s, and 72°C for 15 s, followed by melting at 72–90°C. The number of copies was determined from a standard curve of 103–107 copies per microliter for each gene separately, and levels of expression were calculated as the ratio between Skp2 and PGK copies in each RNA sample.
Bivariate analysis of DNA content and Skp2 expression by flow cytometry
After trypsinization, cells were centrifuged for 7 min at 1300 rpm and the medium was aspirated. Cell pellets were washed once in PBS before being resuspended in 1.5 ml PBS and forcefully pipetted into 3.5 ml of ice-cold 100% ethanol. Alcohol fixation was carried out overnight at 4°C. Cells were then pelleted and washed once with 5 ml of 1% BSA in PBS. After centrifugation, cells were resuspended in 1 ml of rinsing buffer with 0.25% Triton X-100 and placed on ice for 5 min. After the addition of 4 ml of rinsing buffer, cells were repelleted and suspended in 100 µl of rinsing buffer with 10% NGS and antibodies to Skp2, cyclin A2, or rabbit IgG (isotypic control, Jackson Immunoresearch Laboratories, West Grove, PA, USA) at 0.5 µg per sample and left overnight at 4°C with gentle agitation. After incubation, 5 ml of rinsing buffer was added to each sample. The cells were pelleted and resuspended in 100 µl of FITC-conjugated F(ab')2 fragment goat anti-rabbit IgG (Jackson Immunoresearch Laboratories) for 30 min in the dark with gentle agitation. Cells were then pelleted and resuspended in 400 µl of staining solution [PBS containing 200 µg/ml RNase A and 5 µg/ml propidium iodide (both from Sigma)] and incubated in the dark for 30 min at room temperature. Flow cytometry was done on a FACS Calibur cell sorter (Becton Dickinson, Franklin Lakes, NJ, USA). Data were acquired and analyzed using CellQuest software (Becton Dickinson). This method allows estimation of a specific protein at different stages of the cell cycle. A population of cells was designated as positive for Skp2 or cyclin A2 when the FITC intensity for that population of cells was greater than that of 95% of cells in the concomitant isotypic control. DNA content was evaluated (PI staining) and cell cycle analysis was performed by a commercial DNA analysis package (ModFit LT 2.0, Verity Software House Inc., Topsham, ME, USA) for the entire sample and for positive and negative populations separately.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Undifferentiated cells displayed very low p27 levels (Fig. 1
, upper row). As cellular differentiation progressed, the expression of p27 gradually increased and reached maximal expression at 30 days. The changes in p27 levels were inversely related to changes in Skp2 levels (Fig. 1
, second row). Thus, Skp2 levels were high in undifferentiated cells and decreased as differentiation progressed. Changes in the expression of other cell cycle regulatory proteins were also observed during cellular differentiation of hESc. p21, a cyclin-dependent kinase inhibitor regulated in part by Skp2-dependent degradation (39)
, was absent in undifferentiated cells and was detectable only on day 30 (Fig. 1
, third row). In contrast, protein levels of cyclin A2 and Cks1, a cofactor required for efficient Skp2-mediated degradation of p27, were high in undifferentiated cells (Fig. 1
, fourth and fifth rows). Similar to Skp2, the significant decrease in the expression of these proteins was observed between days 5 and 10 of differentiation; by day 30, the expression of these proteins was very low or absent. Oct4 is commonly used as a marker to determine pluripotency in hESc. Oct4 was highly expressed in undifferentiated cells, but its expression decreased significantly after 10 days and was undetectable at 30 days of differentiation, confirming loss of pluripotency (Fig. 1
, sixth row).
|
Because immunoblot analysis provides the average protein levels of a given population of cells, in the next set of experiments we examined protein expression in individual cells using immunohistochemical staining on serial sections of paraffin-embedded, undifferentiated hESc and differentiated embryoid bodies (EBs) at 5, 10, and 20 days of differentiation. We consistently observed in five independent experiments that less than 5% of undifferentiated cells stained positively for p27, whereas 88 ± 2.05% of cells stained positively for Skp2 (Fig. 2
, arrowheads, upper row). MEFs stained strongly for p27 but did not stain for Skp2. Undifferentiated cells stained diffusely for Oct4 whereas MEFs did not, as expected. Similar findings were also observed in freshly fixed undifferentiated hES cells grown on coverslips (data not shown). The inverse relationship between Skp2 and p27 levels was maintained during the course of differentiation; by day 20, only 30% of cells stained positively for Skp2 whereas nearly 70% of cells stained positively for p27 (Fig. 2
, bottom row). Undifferentiated cells that stained positively for Skp2 and were p27 negative also displayed positive staining for Oct4 (Fig. 2
, upper row). In contrast, during differentiation, Oct4 levels decreased more rapidly than Skp2 and were undetectable on day 20, suggesting that some cells maintain a high Skp2/p27 ratio despite losing their pluripotency (Fig. 2
, bottom row).
|
We also found a strong relationship between the expression of Skp2 and Ki67, and an inverse relationship with p27 (Fig. 3
). Ki67 is present during all active phases of the cell cycle (G1, S, G2, and mitosis) but is absent in quiescent cells (G0). Thus, this marker is commonly used to determine the proliferating fraction of a given cell population (40)
. In the undifferentiated state, 85% of cells stained positively for both Skp2 and Ki67, suggesting that unlike other cell types, Skp2 is also expressed during cell cycle phases other than S and late G2/M. At 10 days of differentiation, 
40% of cells were Ki67 negative, Skp2 negative, and p27 positive, suggesting that these cells were at quiescence (G0), whereas most of the proliferating cells were Skp2 positive (Fig. 3
, bottom row).
|
Since the expression of Skp2 observed in undifferentiated hESc differed from that expected in somatic cells, we examined the expression of cyclin A2 in relation to Ki67. Cyclin A2 promotes G1/S and G2/M transitions in somatic cells and is highly expressed in S-phase. We found that only about half the cells staining for Skp2 or Ki67 stained for cyclin A2 (47±3.04%; n=5) (Fig. 3)
, indicating that, in undifferentiated hESc, the different cell cycle proteins may be subject to independent modes of regulation.
Differential staining for p27 and Skp2 reveals morphologically distinct populations of cells in differentiating EBs
EBs represent a well-recognized 3-dimensional form of hESc differentiation and display differentiated cells derived from all three germ layers. At the beginning of the differentiation process, simple EBs are formed in suspension, and as differentiation proceeds they become more complex and form cysts (cystic EBs). At 10 days of differentiation, the EB population is heterogeneous and can be distinguished by morphology into simple and cystic EBs. Cells of simple EBs are less differentiated, with a more homogeneous appearance; they display close spacing to each other and have a high nucleus-to-cytoplasm ratio. In contract, cystic EBs have a more mature phenotype wherein the cells are characterized by smaller and lower density nuclei, a lower nucleus-to-cytoplasm ratio, and the formation of cavitations.
We found that less differentiated EBs displayed high expression of Skp2, cyclin A2, and Ki67, with low p27 levels (Fig. 3
, middle row, black arrowhead). In contrast, mature cystic EBs displayed low Skp2, cyclin A2, and Ki67 expression, whereas p27 staining was observed in >50% of cells (Fig. 3
, middle row, gray arrowhead). In some EBs, different populations could be identified in terms of maturity. In these EBs, cells that were positive for Skp2 and Ki67 were localized in the same area within the EB (Fig. 3
, lower row, black arrows), while cells that were positive for p27 and absent for Skp2 and Ki67 were localized to distinctly different areas (Fig. 3
, lower row, red arrows). Taken together, these findings suggest that during the process of differentiation many hES cells lose their proliferative capacity whereas some cells maintain this capacity in association with low levels of p27 expression.
Skp2 is stable in undifferentiated hESc and regulates p27 levels during the process of differentiation
Cellular abundance of Skp2 may be regulated by its rate of synthesis and/or degradation (41)
. To examine the mechanisms that regulate Skp2 expression in differentiating hESc, we first examined the expression of Skp2 mRNA at different times during the differentiation process. Levels of Skp2 mRNA were similar in undifferentiated cells and throughout the different stages of differentiation (Fig. 4
A), suggesting that Skp2 is mainly regulated by its rate of degradation in this experimental system. To determine the rate of protein degradation, cells were treated with the protein synthesis inhibitor cycloheximide and the rates of protein breakdown were assessed. The half-life of Skp2 in undifferentiated cells was 7.3 ± 1.1 h, but only 3.0 ± 0.8 h at 10 days of differentiation (Fig. 4B
), suggesting that in the undifferentiated state Skp2 is stable, but Skp2 protein degradation is accelerated after the initiation of differentiation. Recent studies have shown that degradation of Skp2 is mediated by the ubiquitin-proteasome pathway (42)
. To determine the role of this pathway in regulating Skp2 degradation, cells were treated with the proteasome inhibitor MG-132 (40 µg/ml) for up to 6 h and subjected to immunoblot analysis to determine Skp2 and p27 levels. In undifferentiated cells, Skp2 levels were unchanged by the inhibition of proteasomal activity, suggesting that the ubiquitin pathway does not modulate Skp2 levels under these conditions (Fig. 4C
). In contrast, levels of p27 were markedly up-regulated after MG-132 treatment, confirming that the ubiquitin-proteasome pathway, rate limited by Skp2, is involved in the regulation of p27 levels in these cells. At 10 days of differentiation, treatment with MG-132 increased levels of Skp2 (by a factor of 2.2±0.28 at 2 h) as well as p27 levels, suggesting that in differentiated cells Skp2 also becomes subject to regulation by the ubiquitin-proteasome pathway. Taken together, the results of these experiments suggest that Skp2 is mainly regulated by its rate of degradation and that, in turn, it regulates p27 expression in differentiating hESc.
|
The expression of Skp2 and its relationship to the cell cycle in differentiating hESc
Although hESc are expected to display a very high proliferation rate, the high percentage of Skp2-positive undifferentiated cells (>85%) was unexpected, since Skp2 levels normally fluctuate during the cell cycle and therefore should be detected only in a percentage of cells corresponding to the S- and G2/M-phases of the cell cycle. We next examined the cell cycle profile of asynchronous populations of undifferentiated hESc cells and the changes that occur during differentiation by subjecting cells to FACS analysis. In this set of experiments, we demonstrated that, in undifferentiated cells, 31 ± 2.6% were in G1, 40.3 ± 3.1% in S-phase, and 28.7 ± 2% in G2/M (Fig. 5
, upper row: n=7). At 10 and 30 days of differentiation, 46.8 ± 0.8% and 85.8 ± 0.9% of the cells were in G1, 22.9 ± 0.1%, 6.6 ± 1.1% in S-phase, and 25.5 ± 0.4% and 7.3 ± 0.4% in G2/M, respectively (Fig. 5
, upper row).
|
The percentage of undifferentiated cells in the S- and G2/M-phases of the cell cycle correlates well with the expression of cyclin A2, but at the same time a significant discrepancy exists between the expected and observed percentage of cells staining for Skp2 (88±0.04%), suggesting that Skp2 may also be expressed in G1 in these cells. We next examined the percentage of cells staining positively for Skp2 at different phases of the cell cycle, using bivariate FACS analysis applied to undifferentiated hESc and after 10 days of differentiation (Fig. 5
, middle row). We found that in undifferentiated hESc cells, Skp2 was expressed at all phases of the cell cycle and that 60% of cells in G1 stained positively for Skp2. On the other hand, cyclin A2 was expressed mainly in G2/M- and S-phases, and only 9% of cells in G1 stained positively (Fig. 5
, bottom row). At 10 days of differentiation, a decrease of nearly 50% in Skp2-positive cells in G1 was noted. Cdh1 is the subunit of the anaphase-promoting complex that is responsible for Skp2 degradation in G1 (41)
. In Xenopus, the early embryonic cell cycle is devoid of cdh1. Therefore, we next examined whether lack of Cdh1 in undifferentiated hSEc represents the mechanism responsible for the high levels of Skp2 in G1 cells. Undifferentiated cells and cells at different levels of differentiation were subjected to immunoblot analysis. Cdh1 was present in undifferentiated cells and its levels were unchanged during differentiation (Fig. 1)
, suggesting that some other, so far unknown mechanisms affect Skp2 degradation. Taken together, these results suggest that the expression of Skp2 in undifferentiated hESc deviates from that normally observed in most other types of cells, then becomes cell cycle dependent in association with the process of cellular differentiation.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Previous studies in mESc have suggested that the absence of G1 regulators, including p27, may have important effects on self-renewal, differentiation, and proliferation of these cells. In contrast to mESc, there is limited information about the role of cell cycle regulators on the differentiation/proliferation programs of hESc. Due to the importance of p27 regulation for these processes in other cell types, we examined the expression and regulation of p27 and its ubiquitin ligase subunit Skp2 in undifferentiated and differentiating hESc. Removal of p27 from its Cdk2 complexes by Skp2-mediated degradation has a major role in determining the rate of G1 to S progression in normal cells and cells that have undergone malignant transformation. We found that, in undifferentiated cells, Skp2 is expressed in nearly all cells; in turn, this expression is associated with very low levels of p27. During differentiation, however, Skp2 levels decrease, allowing up-regulation of p27 levels. The observation of a tight reciprocal association between the expression of the p27 and Skp2 proteins, both at the whole population level and by immunohistochemical analysis of individual cells, suggests an important potential contribution in the differentiation process. We also found this association when different types of EBs were compared. The relatively less differentiated simple EBs maintained high Skp2 levels and low p27 levels compared with the more mature cystic EBs, which expressed high p27 but low Skp2 levels. Moreover, a distinct pattern could be found within the same EBs. In some areas of the EB, a cluster of cells containing a high Skp2/p27 ratio was found and in other areas the opposite pattern was found, but in no case were either high or low levels of Skp2 and p27 expression observed simultaneously. The findings of zones with different Skp2/p27 ratios suggest that p27 may influence the differentiation/proliferation programs of various developing cell types in a differential manner.
Abnormalities in the development of specific cell lineages have been reported in EBs of p27-deficient mESc (6)
, suggesting that p27 has an essential role in establishing different aspects of the differentiated phenotype. Thus, it is possible that Skp2 serves to finely tune the balance of proliferation and differentiation by accelerating entry into S-phase and shortening the time spent in the G1-phase of the cell cycle, which in turn may be critical for decisions regarding differentiation. The high expression in hESc of Skp2 in G1 is very different from that of differentiating proliferative cells, where Skp2 is very low in G1 and increases with the transition to S-phase (43)
. This unusual pattern of high expression of Skp2 in G1 in hESc may be related to shortening of G1 in these cells and more rapid transition to S. The regulation of Skp2 in hESc is also somewhat different from that seen in other cell types where transcriptional regulation predominates (44)
. Since we did not find differences in Skp2 mRNA levels throughout the differentiation process, it would seem that changes in its protein degradation rate serve as a predominant mechanism for regulating Skp2 expression in these cells. The expression in undifferentiated hESc of Skp2 protein at levels in excess of those expected was associated with protein stability, as demonstrated by the relatively long half-life of the protein and the lack of effect of proteosomal inhibition. The finding of high Skp2 expression in G1 suggests that the protein is also stable in this phase. This is in contradistinction to the findings previously reported in somatic cells, where Skp2 is unstable in G1 and is protected from ubiquitin-mediated degradation during the S-phase of the cell cycle (41)
. At present, the molecular mechanisms responsible for the decreased degradation of Skp2 in G1-phase of undifferentiated embryonic stem cells are unclear and require further investigation. The finding that Cdk2 activity in undifferentiated mESc is not cell cycle dependent (31)
strengthens the notion that, in the pluripotent state, Skp2 levels are not regulated by the mechanisms normally observed in cycling somatic cells. The fact that the expression of cyclin A2, in contrast to Skp2, did correlate with the cell cycle profile of undifferentiated hESC cells suggests that these two proteins are under different regulatory influences. In particular, levels of Skp2 appear not to oscillate in relation to the cell cycle.
The results of the present study raise a number of questions that motivate further study. At the present time it is unclear what mechanisms promote Skp2 breakdown and cell cycle-dependent regulation after the initiation of differentiation. The answer to this question is of great importance, since in the undifferentiated state of hESc, the cell cycle configuration as well as Skp2 regulation resembles these features in transformed cells. However, unlike transformed cells, the regulation of both is "corrected" in hESc by progressive transition to the differentiated state. One possible scenario is that Skp2 down-regulation and cell cycle dependency of this regulation occur in association with modulation of proliferative capacity, which in turn is a necessary accompaniment of the differentiation process. On the other hand, it cannot be ruled out that Skp2 is more directly involved in the differentiation process and that the shift that occurs in Skp2 levels is a feature that serves as a prerequisite for initiation of differentiation. This notion is supported by the observation that EBs and clusters of cells within EBs that remained in the immature or undifferentiated state, as determined either by morphological criteria or using measurement of Oct 4 levels, also maintained high Skp2 levels accompanied, as expected, by low levels of p27. This also raises the additional question regarding the identity of those cell types that maintain high levels of Skp2 expression during the differentiation process: do they represent a population of cells that are remnants of the undifferentiated state or are they still in the process of differentiation; or are they differentiated cells that maintain a high replicative capacity, corresponding perhaps to populations of adult stem cells? Finally, it is unclear how undifferentiated hESc expressing exceedingly high levels of Skp2 (levels that are significantly higher than those found in aggressive cancers) do not experience the characteristics of malignant transformation, since expression at these levels drives somatic cells to tumorigenesis but not in embryonic stem cells. This is even more remarkable given that hESc also express high levels of Cdks and telomerase activity (45)
. It may be that hESc are "protected" from tumorigenesis properties by virtue of the fact that they differentiate when present in an environment that would otherwise be conducive to tumorigenesis (46)
. Indeed, it will be of interest to compare levels of p27, Skp2, and related proteins as well as their interaction and regulation in hESc and cancer cells in tumorigenesis models to unravel these questions. It is recognized that the pluripotent state of hESc in cell culture represents an experimental model that is not maintained during actual development and maturation of the inner cell mass of the blastocycst in vivo; nevertheless, this system may provide some unique and facile opportunities and tools to further investigate the machinery that enables hESc to develop normally without experiencing malignant transformation and to relate this to the process of differentiation. Recent studies in other systems have shown that conditional reversal of oncogene-mediated malignant transformation is associated with differentiation (47)
.
In summary, our results suggest that shifts in the expression of p27 and Skp2 have an important effect on the proliferation and differentiation process of hESc. Future studies should define the machinery that promotes Skp2 stability in the undifferentiated state and the molecular mechanisms that down-regulate its expression and restore normal patterns of cell cycle dependency during differentiation and prevent malignant transformation.
|
ACKNOWLEDGMENTS |
|---|
|
FOOTNOTES |
|---|
Received for publication March 19, 2007. Accepted for publication March 26, 2007.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  G. Ambartsumyan and A. T. Clark Aneuploidy and early human embryo development Hum. Mol. Genet., April 15, 2008; 17(R1): R10 - R15. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Sicinski, S. Zacharek, and C. Kim Duality of p27Kip1 function in tumorigenesis Genes & Dev., July 15, 2007; 21(14): 1703 - 1706. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
