| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Department of Neurochemistry, Stockholm University, Stockholm, Sweden
1Correspondence: Department of Neurochemistry, Stockholm University, Svante Arrhenius väg 21A, S-10691 Stockholm, Sweden. E-mail: pontus{at}neurochem.su.se or pontus.lundberg{at}unibas.ch
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Key Words: CPP • gene silencing • siRNA • oligonucleotides • RNA interference
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 2
). Although efficient delivery of DNA and siRNA can be achieved using CPPs, the delivery efficacy rarely exceeds that of commercially available products such as Lipofectamine 2000. Upon understanding that endocytosis is responsible for the uptake of most CPPs, researchers have come to realize that the limiting factor of CPP delivery appears to be material retained in endosomes, with concomitant degradation in lysosomes. So far, few mechanistic studies have been made to investigate the endosomolytic properties of CPPs, but lysosomotropic agents such as chloroquine as well as the HA2 fusion peptide from the influenza virus have been used to increase the delivery of oligonucleotides (ONs) and proteins, respectively (3
4
5
6)
.
RNA interference (RNAi) using short interfering RNA (siRNA) is an attractive approach for silencing gene expression mainly because of the specificity and high gene silencing potential (reviewed in ref. 7
). RNAi was initially described in plants and C. elegans, as it was observed that double-stranded RNA (dsRNA) was much more efficient in silencing gene expression than either the sense or antisense single-stranded RNA (ssRNA) (8)
. RNAi is an endogenous mechanism used mainly for silencing of endogenous gene expression, but also as a means for viral protection in plants and lower invertebrates. The mechanism for siRNA-induced gene silencing is, in a simplified version, based on two steps. In the first step, the dsRNA is processed into a 21–23 nucleotide siRNA by the enzymes Dicer and Drosha (9)
. This is followed by loading the siRNA into the RNA-induced silencing complex (RISC), where it is unwound in a strand-specific manner whereupon the ssRNA can locate the target mRNA by Watson-Crick base pairing (10)
. The potential for using siRNA in treating, for example, viral diseases and cancers is enormous, the only problem so far being the bioavailability.
Previous studies have used two different strategies to deliver siRNA using CPPs: covalently using a disulfide bridge; and noncovalently, where the CPP is coincubated with the siRNA in a molar excess (11
, 12)
. The advantages of using a disulfide bond between the CPP and active cargo is that less peptide is necessary to achieve a biological effect and the fact that the disulfide bridge will be reduced once inside the cell, leading to a minimized risk that the CPP will interfere with the processing and antisense effect of the siRNA. A problem that could be associated with this method is unwanted reduction of the disulfide conjugate before the target cell is reached and the possibility that the carrier peptide is degraded by extracellular proteases. The other method used to enhance siRNA delivery using CPPs is the complex formation strategy where the CPP, in molar excess, is coincubated with siRNA before addition to the cells (12)
, a strategy also proved to be successful for the delivery of biologically active proteins and plasmids (13
, 14)
. This method has some advantages compared with the disulfide bridge strategy. It is easy to use, as only mixing of the two solutions is necessary, and no modification of the peptide or additional purification of the complex is needed. What might be the main advantage with this delivery system, at least in vivo, is degradation shielding of the siRNA as the peptide and siRNA form a stable complex. This complex can be effectively taken up by cells and is protected against nuclease degradation, although still able to exert its biological effect.
We have previously shown that CPPs can be used to transport decoy DNA targeting the Myc protein in N2a and MCF-7 cells, using both of the above-mentioned delivery strategies, decreasing the proliferation rate in a concentration-dependent manner (15)
.
In this study we wanted to investigate and compare the efficacy of various CPPs, some of which are known to be able to promote endosomal escape, to deliver siRNA. The CPPs used in the study are bPrPp [1–30], shown to promote endosomal escape in a plasma membrane mimicking system (16)
; MPG 
NLS, which has been demonstrated to efficiently deliver siRNA using the coincubation strategy (12)
; penetratin, which has been shown to be able to deliver siRNA using a covalent linkage (11)
; and TP10, which has been applied to deliver decoy DNA using the coincubation strategy (15)
. We compared these well-characterized CPPs to a designed endosomolytic peptide, EB1, where certain amino acids in the penetratin sequence were replaced with histidine to yield, in theory, an alpha helix upon protonation in the acidic early-late endosomes. To assess the delivery efficacy, we used the coincubation strategy; this approach is fast and easy to use, and could prove to be advantageous in in vivo applications.
In our setup, all peptides were able to form complexes with siRNA and promote delivery across the plasma membrane. Although significant uptake of siRNA was achieved, no significant biological activity of penetratin- or TP10-mediated siRNA delivery could be observed, whereas MPG NLS and bPrPp showed significant biological effect. More important, the designed endosomolytic penetratin analog EB1 was able to down-regulate luciferase to the same extent as MPG NLS, concluding that the increased ability to escape endosomes results in augmented delivery of biologically active (cytosolic) siRNA. Notably, EB1 also had a superior ability to form complexes and deliver siRNA at low molar ratios compared to penetratin. The peptides used in the study are presented in Table 1
.
|
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
The MPG NLS peptide was a generous gift from Dr. Frédéric Heitz. The siRNA used for luciferase gene silencing (17)
(sense-5' ACGCCAAAAACAUAAAGAAAG 3', antisense-5' UUCUUUAUGUUUUUGGCGUCU 3') with the fluorescein label attached 3' on the antisense strand was ordered from Dharmacon (Chicago, IL, USA).
Cell culture
HeLa and HepG2 cells were obtained from the American Type Culture Collection (Manassas, VA, USA). The cells were cultivated in Dulbecco's modified essential medium (DMEM) supplemented with 10% fetal bovine serum, 2 mM L-glutamine, 1% nonessential amino acids, 1% sodium pyruvate, 100 U ml–1 penicillin, and 100 µg ml–1 streptomycin. All cell culture reagents were purchased from Invitrogen (Stockholm, Sweden).
Gel shift assay
siRNA (0.5 µg) was mixed with increasing concentrations of peptides, giving rise to peptide/RNA molar ratios ranging from 5 to 20. Complexes were analyzed by electrophoresis on a 20% polyacrylamide gel at 150V for 1 h in TBE (Tris-borate/EDTA) buffer containing ethidium bromide (Sigma, Stockholm, Sweden). Pictures were taken in Fujifilm LAS-1000 Intelligent Dark box II using IR LAS-1000 Lite v1.2.
Ethidium bromide exclusion assay
RNA condensation was measured by quenching ethidium bromide (EtBr) fluorescence essentially as described in ref. 18
. Briefly, quadruplicates of 0.5 µg of siRNA were complexed with increasing amounts of penetratin or EB1 in HKR to a final volume of 25 µl. After 30 min incubation, 160 µl HKR was added to each tube and transferred to a black 96-well plate, after which 15 µl EtBr solution (0.1 mg/ml) was added to each well. The fluorescence was measured after 10 min on a Spectra Max Gemini XS fluorometer (Molecular Devices, Palo Alto, CA, USA) at 
ex = 518 nm and em = 605 nm. Results are given as relative fluorescence and a value of 100% is attributed to the fluorescence of RNA with ethidium bromide (rel. F=Fsample/FRNA solution).
Quantitative uptake
The fluorescently labeled siRNA was preincubated in 1/10th of the final volume with various amounts of CPP—from 10:1 to 100:1 (mol peptide:mol siRNA)—for 30 min in serum-free media. After washing the cells with serum-free media, the peptide:siRNA solution was incubated with the cells for 1 h. After treatment, the cells were washed three times with serum-free media and trypsinated for 10 min to remove extracellular peptide/siRNA complexes. The cells were centrifuged for 5 min at 1000 g, after which the supernatant was removed and the cell pellets were lysed in 300 µl 0.1 M NaOH. The cell lysate was centrifuged for 10 min at 10,000 g to remove cell debris, after which 250 µl was transferred to a black 96-well plate to measure fluorescence. Fluorescence was measured at 494/518 nm on a Spectra Max Gemini XS fluorometer (Molecular Devices) and, using the linearity of fluorescein, recalculated to the amount of the internalized compound. The fluorescence was normalized to the amount of protein using a detergent-compatible Lowry method (Bio-Rad, Sundbyberg, Sweden).
Luciferase gene silencing in transiently transfected HeLa cells
HeLa cells were seeded in 60 mm Petri dishes to reach 90% confluence the next day, whereupon the cells were transfected with the pGL3 luciferase plasmid (Promega, Falkenberg, Sweden) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. One day after transfection, the cells were counted and seeded in 24-well plates (100,000/well). The next day the peptide/siRNA complexes were prepared as described above and added to the cells at various concentrations with a final volume of 200 µl in either serum (10%) or serum-free media. Four hours after the complexes were added, 1 ml serum containing media was added to each well. After 36 h, the cells were washed and lysed in 100 µl 0.1% triton; 20 µl of the cell lysate was transferred to a white 96-well plate, followed by the addition of 100 µl luciferase substrate (Molecular Probes, Carlsbad, CA, USA). Luminescence was measured using a Flex Station II fluorometer (Molecular Devices) and normalized to the amount of protein using a detergent-compatible Lowry (Bio-Rad).
Luciferase gene silencing in stably transfected HepG2 cells
HepG2 cells stably expressing luciferase were seeded out in 24-well plates to reach 30% confluence on the day of the experiment. After 2 days the cells were treated with the peptide/siRNA complexes, where preincubation was either carried out as stated above or in the volume that was added directly to the cells (200 µl). Forty-eight hours after the peptide/siRNA complexes were added, the cells were lysed and analyzed as described previously.
Membrane disturbance and long-term toxicity measurements
Membrane integrity was measured using the CytoTox-ONETM (Promega) assay, which measures the release of lactate dehydrogenase (LDH). In brief, 10,000 cells were seeded in 96-well plates 2 days before treatment with peptides for 30 min in serum-free media. Untreated cells are defined as zero and LDH was released by lysis in 0.18% triton in HKR as 100% leakage.
Long-term toxicity was assessed using the WST-1 assay according to the manufacturer's protocol (Sigma). 10,000 cells were seeded 2 days before the experiment in 96-well plates after treatment with peptide/siRNA complexes for 24 h in serum-free media. Absorbance (420–690 nm) was measured on absorbance reader Digiscan (LabVision, Värmdö, Sweden). Untreated cells are defined as 100% viable.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
). Various concentrations of the peptides were added, from a 5-fold molar excess of the peptide compared with siRNA to a 20-fold molar excess. We observed that the peptide with the most charges, penetratin, was able to almost completely retard the siRNA at a molar ratio of 10:1 (Fig. 1C
, lane 3). The retardation efficacy of the peptides is not purely electrostatic—for example, bPrPp shows less affinity for siRNA than does MPG NLS (Fig. 1B
) even though it contains more positive charges. At a molar ratio of 20:1, the retardation of siRNA was complete for all peptides except bPrPp (Fig. 1A
, lane 4).
|
CPP-mediated siRNA delivery increases with peptide concentration
To assess whether the interaction of the peptides with siRNA, as shown in the gel shift assay, was able to increase siRNA uptake, a quantitative study measuring the internalized siRNA was performed. The lowest molar ratio used for the uptake was determined by complete complex formation using gel shift (i.e., 10-fold molar excess for penetratin and 20-fold molar excess for the other peptides). As seen in Fig. 2
, at the lowest molar ratio penetratin increased siRNA uptake quite modestly. This was also the case for MPG NLS and TP10. However, the prion-derived peptide bPrPp yielded a massive increase in siRNA uptake even at the lowest molar ratio, greater than both MPG NLS and TP10 at the highest molar ratio assessed. This is partly a result of aggregate formation between RNA and peptide (data not shown). All peptides increase siRNA uptake in a concentration-dependent manner, where increasing the peptide amount compared with siRNA increases the uptake, an effect observed most significantly with penetratin.
|
The gene silencing effect of CPP-siRNA complexes does not correlate with translocation efficacy, but rather with the endosomolytic characteristics of the CPP
Achieving promising results from the uptake studies, we wanted to examine whether the CPP-siRNA complexes were able to exert a biological effect. We used an siRNA sequence targeting the firefly luciferase mRNA with an established gene silencing effect (17)
. The molar ratios tested for gene silencing were 10:1, 25:1, 50:1, and 100:1 (peptide:siRNA), where bPrPp showed the best effect at 50:1 and EB1 and MPG NLS yielded the best effect at a 25:1 M ratio. Using HeLa cells transiently transfected with the pGL3 luciferase plasmid, we can clearly see that MPG NLS and bPrPp significantly decrease luciferase activity in a concentration-dependent manner (Fig. 3
). For comparison, MPG NLS and Lipofectamine 2000 were used, of which Lipofectamine 2000 in our hands yielded a higher gene silencing effect than any of the peptides tested. Neither penetratin nor TP10 was able to decrease the luciferase activity, even though they showed a higher uptake in the quantitative uptake study than MPG NLS. The penetratin analog EB1 shows a significant effect, implying that the endosomolytic design of this peptide is critical to achieve biological effect. An siRNA sequence targeting GFP was used as a control to establish that the observed gene silencing was specific. This siRNA in complex with the peptides in the study, at the same molar ratio and concentration used for the luciferase siRNA, yielded no significant effect on luciferase expression, implying that the effect observed using siRNA targeting luciferase is specific (data not shown).
|
To confirm that the gene silencing effect seen in HeLa cells was reproducible in a cell line not as easily transfected, HepG2 cells were used to validate the siRNA delivery efficacy of EB1. Using the same protocol as for HeLa cells, no effect could be observed with EB1. However, when changing the preincubation conditions so that it was performed in a greater volume, a significant luciferase down-regulation could be observed when using EB1 (
Fig. 5
). In this cell line, no effect was seen with the parental peptide penetratin (data not shown).
|
|
EB1 is superior to penetratin in its ability to form complexes, transport siRNA, promote endosomolysis, and induce gene silencing
The modifications on EB1 might affect other properties apart from endosomal escape; therefore, we compared penetratin and EB1 to assess their ability to form complexes and transport siRNA at different molar ratios. To establish the siRNA interaction properties of the two peptides more accurately than by using gel shift, an ethidium bromide exclusion assay was performed. To our surprise, EB1 showed far better properties than penetratin to form complexes with siRNA at low molar ratios (Fig. 4
A), where the complex formation ability at a molar ratio of 5:1 for EB1 roughly correlates with a molar ratio of 25:1 for penetratin. These data implicate that the ability to form a complex is not strictly dependent on electrostatic interactions, as both peptides have the same amount of positive charges, but also depends on hydrophobic interactions between the nucleobases in RNA and histidines in EB1. However, as previously observed, the ability to form complexes with siRNA does not always ensure high uptake; therefore, a quantitative assessment of siRNA uptake using EB1 was performed. In concurrence with the ethidium bromide exclusion assay, at low molar ratios EB1 showed drastically higher siRNA delivery properties than did penetratin (Fig. 4B
), where a 10:1 molar ratio for EB1 yields a slightly higher uptake than penetratin at a molar ratio of 50:1 (Fig. 2)
.
As shown in Fig. 3
, EB1 was able to down-regulate luciferase expression to the same extent as MPG NLS; to further evaluate the properties of EB1 as a vector, we assessed whether the effects observed in serum-free media were applicable to serum-containing media. Performing the experiment in serum had no significant effect on gene silencing at a 100 nM siRNA concentration for either peptide. In contrast, at 10 nM no significant gene silencing effect was achieved in serum-containing media when using EB1, in contrast to the serum-free environment (Fig. 4C
).
To confirm that the lack of effect seen with penetratin is due to the inability to induce endosomal escape and not because of other reasons such as the peptide/siRNA complexes being too strongly associated, we added a chimeric peptide consisting of the HA2 influenza fusion peptide conjugated to penetratin (HA2-penetratin; Table 1
). Upon addition of the penetratin-siRNA complex (50:1), 5 µM HA2-penetratin was co-added. This protocol was used to minimize the amount of HA2-penetratin bound to the siRNA but still achieve the desired HA2 fusion peptide in the same endosomal compartment as the penetratin/siRNA complexes. As seen in Fig. 4D
, addition of the lysosomotropic peptide HA2-penetratin significantly increased the gene silencing ability of the CPP-siRNA complex, indicating that the penetratin/siRNA complexes were effectively endocytosed; without induction of endosomolysis, however, the complexes were retained in the endosomes and no biological activity could be observed. Even though HA2-penetratin greatly increased the delivery efficacy of penetratin, it still did not achieve the same gene silencing as the EB1 peptide alone (Fig. 4D
).
Membrane disturbance and cytotoxicity measurements
To further confirm that the observed gene silencing effects were not due to the intrinsic toxicity of the peptides, membrane disturbance and viability were assessed. After 30 min, none of the peptides in complex with siRNA induced more than 5% LDH leakage at the concentrations used in other experiments (data not shown). When performing LDH leakage using peptides not in complex with siRNA, a higher degree of membrane disturbance could be observed, indicating that the strong interaction between the peptide and siRNA yields very little noncomplexed peptide, thus reducing the toxicity.
To examine whether the CPP/siRNA complexes induced any long-term toxicity that could influence the gene silencing experiments, a WST-1 proliferation assay was carried out. After 48 h incubation, none of the peptides in complex with siRNA reduced the proliferation whereas cells treated with Lipofectamine 2000 showed a significant reduction in proliferation (data not shown). The toxicity observations were further supported by the fact that a decrease in total protein content could be observed in wells where siRNA was delivered using Lipofectamine 2000 vs. peptide-mediated delivery, where no decrease was observed. In combination, these assays show that the gene silencing effect observed using peptide-mediated siRNA delivery is not due to either short- or long-term toxicity induced by the peptides.
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
, 13)
. This newly acquired knowledge thus shifts the field of CPPs from examining only the uptake of peptides, to understanding the different mechanisms involved in release of the endocytosed material into the cytoplasm. From recent CPPs studies, one can deduce that the biological effect can be improved almost 100-fold by the addition of endosomolytic agents (3
, 4)
, which would give CPPs delivery properties that far exceed other vectors. Bringing forth this potential is of great importance for achieving low-concentration biological effects both in vitro and in vivo. There are now several different ways to assess CPP delivery efficacy, both in protein and ON delivery, which combined with measuring the total uptake yield the endosomal escape capacity of CPP and cargo. Some reports have used the splice in a system developed by R. Koles et al. (19)
, which is an effective way to assess the relationship between endosytosed material and biological activity for ONs; the CRE-recombinase system has been successfully applied to examine protein transduction efficacy (5)
.
Here we evaluate the ability of various CPPs to form complexes with siRNA, transport it over the plasma membrane, and deliver it to the cytosol with concomitant silencing of luciferase expression. Different types of CPPs were used: penetratin and bPrPp, which are naturally derived peptides; TP10, a fusion between the neuropeptide galanin (7
8
9
10
11
12
13)
and the wasp venom-derived peptide mastoparan, MPG NLS; a chimera between the fusion peptide domain of the HIVgp41 protein and a mutated form of the NLS from the SV40 large T antigen; and EB1, a penetratin analog with the ability to form an alpha helix on protonation.
Using SDS-PAGE, ethidium bromide exclusion, and quantitative uptake, we show there is no direct correlation between the ability of the peptides to form complexes with siRNA and delivery efficacy. The complex formation ability is not purely electrostatic (e.g., EB1 showed a much higher affinity for complex formation at low molar ratios than its parent peptide penetratin) (Fig. 4A
). To investigate whether this complex formation ability was enough to promote internalization of the peptide/siRNA complexes, a quantitative assay using fluorescently labeled siRNA was performed. To our surprise, only bPrPp and EB1 were able to promote uptake at low molar ratios (20:1 or lower), even though gel shift and ethidium bromide exclusion clearly showed that all peptides were able to form complexes with siRNA at these molar ratios (Fig. 1)
. When increasing the peptide concentration, all peptides had the ability to increase siRNA uptake significantly more than Lipofectamine 2000, the exception being MPG NLS.
After screening for the molar ratios resulting in the highest biological response, the molar ratio 50:1 (peptide:siRNA) was used for bPrPp and 25:1 was used for MPG NLS and EB1. Intriguingly, penetratin and TP10, both able to significantly promote siRNA internalization (Fig. 2)
, showed no effect in the luciferase down-regulation assay even at the highest molar ratio used, 100:1 (Fig. 3)
. This is surprising, since penetratin has been shown to effectively transport biologically active siRNA, although in a setting where penetratin and siRNA were conjugated via a disulfide bond (11)
. Our explanation in the case of penetratin is that being linked to its cargo covalently increases its endosomal escape property; hence, no endosomolysis could be induced when using the coincubations strategy. It is difficult to speculate why TP10 is unable to transport biologically active siRNA into the cell, especially since we had already shown that this is possible with DNA (15)
. We hypothesize that it might be due to the differences in the backbone of DNA and RNA, as we have observed different patterns of uptake of these ONs when using the coincubation strategy (data not shown).
Previous reports yielding an increased biological effect of CPPs by enhanced endosomolysis (5
, 6)
encouraged us to develop a penetratin analog with certain amino acids replaced by histidines, the rationale being that upon protonation the peptide would change secondary structure and form an alpha helix with the ability to penetrate the endosomal membrane. The peptide EB1 was also N-terminally extended with six amino acids in order to have the length required in the alpha helical domain to span the endosomal membrane. EB1 showed superior properties compared with penetratin, both in the ability to form complexes with siRNA as well as at low molar ratios, to translocate the siRNA across the plasma membrane. Monitoring uptake using live confocal microscopy showed that EB1, in contrast to penetratin, could promote endosomal escape of siRNA (data not shown). Intriguingly, EB1 yields a better biological response than addition of the fusion peptide HA2-penetratin, indicating that it improves either the uptake or endosomal escape to a higher degree. To establish whether EB1 is suitable for in vivo applications, the down-regulation assay was also performed in serum media, where, at higher concentrations, the effect was comparable of that seen in serum-free media (Fig. 4D
).
To confirm EB1 as a vector suitable for siRNA delivery to cell lines other than HeLa cells, we examined its gene silencing effect in HepG2 cells stably expressing luciferase. An earlier report has shown that induction of macropinocytosis in these cells leads to a decreased polyplex transfection efficacy and that clathrin-mediated endocytosis results in the best gene delivery (20)
. To decrease the peptide/siRNA complex size so as to (at least in theory) reduce the micropinocytosis component, preincubation was also performed in a larger volume (the same as that added to the cells) and compared with the preincubation method used in HeLa cells (where preincubation was performed in 1/10th of the total volume added to the cells). Preincubation in a small volume yielded no significant effect when using EB1, whereas when preincubation was performed in a larger volume, effective gene silencing was observed (Fig. 5)
; no effect could be observed using penetratin. However, the luciferase down-regulation observed in HepG2 cells was not as effective as in HeLa cells, an effect most dramatically observed with lipofectamine and not to the same extent with EB1. We are currently investigating how different preincubation strategies can be related to biological effect and whether different strategies are needed depending on the cell line used.
In conclusion, the results from our study provide additional support for the concept that CPP uptake is mediated by endocytosis; when evaluating CPPs as delivery vectors, an assay giving a biological response is preferred, as we see little correlation between the ability to quantitatively internalize siRNA using CPPs and the biological response. More important, we also show that modifications within a CPP (in this case, penetratin) in order to increase the endosomal escape property can increase the biological effect significantly. To our knowledge, this is the first report where an existing CPP has been rationally modified in order to adopt, upon protonation, a secondary structure leading to endosomolysis with concomitant escape of the endocytosed material (schematically shown in Fig. 6
). This is a first step for rationally designing CPPs in order to achieve increased endosomal escape, and thus improved biological activity.
|
|
ACKNOWLEDGMENTS |
|---|
Received for publication August 14, 2006. Accepted for publication March 29, 2007.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  B. R. McNaughton, J. J. Cronican, D. B. Thompson, and D. R. Liu Mammalian cell penetration, siRNA transfection, and DNA transfection by supercharged proteins PNAS, April 14, 2009; 106(15): 6111 - 6116. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Juliano, Md. R. Alam, V. Dixit, and H. Kang Mechanisms and strategies for effective delivery of antisense and siRNA oligonucleotides Nucleic Acids Res., July 1, 2008; 36(12): 4158 - 4171. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. R. Alam, V. Dixit, H. Kang, Z.-B. Li, X. Chen, J. Trejo, M. Fisher, and R. L. Juliano Intracellular delivery of an anionic antisense oligonucleotide via receptor-mediated endocytosis Nucleic Acids Res., May 1, 2008; 36(8): 2764 - 2776. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) more readily forms complexes with siRNA, giving the same amount of quenching as penetratin at molar ratios 
1/5th the penetratin (
) concentration. B) EB1 increases the siRNA uptake to a greater extent than penetratin at low molar ratios: 
