| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
* Department of Human Nutrition and Metabolism, Braun School of Public Health, Faculty of Medicine Hebrew University-Hadassah Medical School, Jerusalem, Israel;
The Liver Unit, Hadassah University Hospital, Ein Kerem, Jerusalem, Israel; and
Department of Medicinal Chemistry and Natural Product, Medical Faculty, Hebrew University, Jerusalem, Israel
1Correspondence: Department of Human Nutrition and Metabolism, Braun School of Public Health, Faculty of Medicine Hebrew University-Hadassah Medical School, Jerusalem, Israel. E-mail: berry{at}md.huji.ac.il
 |
ABSTRACT |
|---|
 TOP ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
9-tetrahydrocannabinol (THC) augmented AMPK activity and restored brain function in WT mice but not in their CB-2 KO littermates. These results suggest that HE is a disease of energy flux. CB-2 signaling is a cerebral stress response mechanism and makes AMPK a promising target for its treatment by modulating the cannabinoid system.—Dagon, Y., Avraham, Y., Ilan, Y., Mechoulam, R., Berry, E. M. Cannabinoids ameliorate cerebral dysfunction following liver failure via AMP-activated protein kinase.
Key Words: liver disease • hepatic encephalopathy • AMPK • endocannabinoid receptor
|
INTRODUCTION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. Modern medicine defines hepatic encephalopathy (HE) as a neuropsychiatric syndrome that is associated with acute or chronic liver dysfunction and has quantitatively and qualitatively distinct features relating to its severity. In cirrhosis, cerebral dysfunction is more heterogeneous, ranging from mild neuropsychiatric and psychomotor dysfunction, impaired memory, increased reaction time, sensory abnormalities, and poor concentration to severe features such as confusion, stupor, coma, and eventually death (2)
.
While the symptoms of HE are well documented, its pathogenesis is not clear, and a number of possible scenarios have been suggested (3)
. First, liver failure induces impaired glucose oxidative pathways in the brain, which results in energy failure (4)
. Second, hypoglycemia and hypoxia are also major contributors to the energy failure seen in HE. Third, the liver fails to efficiently convert ammonia to urea or glutamine, resulting in systemic hyperammonia, including the brain (5)
. The brain relies entirely on glutamine synthesis for the removal of blood-borne ammonia. Since glutamine synthetase is dependent on an adequate level of ATP to amidate glutamate to glutamine, depletion of brain ATP resources as well as covalent modification of glutamine synthetase may result in ammonia intoxication and eventually cell death (6
7
8)
.
The AMP-activated protein kinase (AMPK) is an evolutionarily conserved metabolic master switch. AMPK is allosterically activated by 5'-AMP, which accumulates after ATP hydrolysis (9
, 10)
. Conversely, high ATP antagonizes the activating effects of 5'-AMP on AMPK (11)
. Stresses such as nutrient depletion, hypoxia, heat shock, metabolic poisoning, and exercise all activate AMPK by their effect on the ratio of 5'-AMP to ATP. AMPK, in turn, phosphorylates multiple targets, which switch off anabolic pathways and stimulate catabolic ones (12)
. AMPK was recently recognized as a key regulator of whole-body energy metabolism (13)
. Cerebral AMPK responds to integration of nutritional and hormonal input. Hypothalamic AMPK controls energy balance via regulation of food intake, body weight, and glucose and lipid homeostasis (14
, 15)
. Hippocampal AMPK controls cognitive function via regulation of neurogenesis and neuroapoptosis (16)
.
Endocannabinoids are endogenous lipids capable of binding to the cannabinoid receptors CB1 and CB2. These receptors belong to the G-protein-coupled family receptors that were discovered while investigating the mode of action of THC, the major psychoactive constituent of the Cannabis plant. THC binds to both of the receptors with high affinity and produces a myriad of complex effects such as appetite stimulation and increase in body weight (17
18
19
20
21)
. In addition, endocannabinoids were found to be neuroprotective in several types of cerebral insults through regulation of motor control, cognition, emotional responses, motivated behavior, and homeostasis (22)
. Most of the endocannabinoid effects are attributed to CB1, one of the most abundant neuromodulatory receptors in the brain. In contrast, little information is available about the cerebral function of the CB2 receptors, which are considered to be peripheral as they are found primarily in cells of the immune system (19)
. Our previous studies have shown the neuroprotective effect of CB-1 inhibition and CB-2 activation in experimental HE (23)
. Since the metabolic inter-relations between the liver and the brain are responsible for the pathogenesis of HE, this could be the result of a peripheral cannabinoid receptor signaling. Indeed, the two receptor classes have opposite effects on liver fibrosis—CB1 being profibrogenic (24)
and CB2 antifibrogenic (25)
. Thus, the balance between the receptor systems appears to be crucial in determining the outcome of liver injury. Furthermore, recent studies have described an abundance of CB-2 in different sections of the brain and suggest a broader range of cerebral activities especially under conditions of stress and disease.
In attempt to study the cerebral compensatory responses to HE, we have investigated the role of AMPK in the pathogenesis of an experimental model of HE and the interactions between the cannabinoid receptors that regulate its function. We show the significance of AMPK activity in the cerebral response to liver failure and demonstrate the benefits of its activation in improving brain function. We describe the endocannabinoid regulation of such activation of AMPK, and propose the possibility of manipulating the cannabinoid system as a novel therapeutic approach to the treatment of HE.
|
MATERIALS AND METHODS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Mice
Eight- to 10-wk-old female Sabra mice (29–32 g) were assigned at random to different groups of 10 mice per cage and were used in all experiments. All cages contained wood chip bedding and were placed in a temperature-controlled room at 22°C, on a 12 h light/dark cycle (lights on at 07:00 AM). The mice had free access to water 24 h a day. The food provided was Purina chow, the animals were maintained in the animal facility (SPF unit) of the Hebrew University Hadassah Medical School (Jerusalem, Israel).
Mice were sacrificed after treatment by decapitation between 10:00–12:00 AM. Brains were rapidly removed, then dissected out and kept at –70°C.
Induction of hepatic failure
Bile duct ligation
A midline incision was made under general anesthesia. The common bile duct was localized, doubly ligated, and cut between these two ligatures. In sham animals, a midline incision was performed, but with BDL.
TAA
A single dose of 200 mg kg–1 of TAA was injected by the intraperitoneal route (i.p.). Twenty-four hours after injection, all animals (including control) were injected (s.c.) with 0.5 ml solution of 0.45% NaCl, 5% dextrose, and 0.2% KCl in order to prevent hypovolemia, hypokalemia, and hypoglycemia. The mice were intermittently exposed to infrared light in order to prevent hypothermia. THC was administered i.p. either alone or with SR141716A on day 6 after TAA administration. Mice were sacrificed 1 h post-treatment and analyzed for AMPK level. For the behavioral tests that began on day 6 after TAA administration, THC was administered i.p. during days 6–10. Neurological score, activity, and cognitive function were analyzed during these days.
Immunoblot analysis
Total hippocampal protein was extracted using TriFast reagent. Aliquots of the clarified lysates containing 30 mg protein were denatured in Laemmli sample buffer (6% SDS 30%, glycerol, 0.02% bromphenol blue, 200 mM Tris-HCl (pH 6.8), and 250 mM mercaptoethanol, at 95°C for 5 min. The samples were resolved by SDS-PAGE (10% acrylamide) and blotted onto nitrocellulose membrane. Nonspecific binding in a Western blot analysis was prevented by immersing the membranes in blocking buffer [5% nonfat dry milk in Tris buffer saline-Tween 20 (TBS-T)] for 2 h at room temperature. The membranes were then exposed to the indicated antibodies diluted 1:1000 for 1 h at room temperature. AMPK and phospho-AMPK were obtained from Cell Signaling (Danvers, MA, USA). Phospho-AKT was gained from Upstate Biotechnology (Lake Placid, NY, USA). Actin was from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). The blots were rinsed in TBS-T, then incubated with horseradish peroxidase-conjugated goat anti-mouse antibodies 1:10,000 for 1 h at room temperature. Antibody-antigen complexes were visualized by detecting enhanced chemiluminescence with X-ray film.
RT-PCR analysis
Total hippocampal RNA was extracted using TriFast reagent according to the manufacturer’s instructions and reverse transcribed. Primers specific for CB1 were GGAGAACATCCAGTGTGGGG and CATTGGGGCTGTCTTTACGG, for CB2 GGGTCCTCTCAGCATTGATTT, and GTTAACAAGGCACAGCATGGAAC, and for actin they were CAG CTTCTTTGCAGCTCCTT and TCACCCACATAGGAGTCCT. All primers were synthesized by Danyel Biotech (Rehovot, Israel).
Catecholamine measurements
Catecholamines were measured as described previously (26)
. The assays for dopamine were performed by HPLC separation and detection using HPLC-ECD. Values are presented as a concentration (ng/g tissue).
Neurological function
Neurological function on was assessed by a 10-point scale based on reflexes and task performance (27)
: exit from a circle 1 m in diameter in <1 min, seeking, walking a straight line, startle reflex, grasping reflex, righting reflex, placing reflex, corneal reflex, maintaining balance on a beam 3, 2 and 1 cm in width, climbing onto a square and a round pole. For each task failed or showing an abnormal reflex reaction, a score of 1 was assigned. Thus, a higher score indicates poorer neurological function. The neurological score was assessed 1 day after TAA induction (day 2). The mice were then divided between treatment groups so that each group had a similar baseline neurological score after TAA induction. The post-treatment neurological score was assessed 1 day after administration of the agonist, the antagonist, or vehicle (day 3).
Activity
The activity test was performed on day 4, since in the first 3 days after TAA injection almost no motor activity was observed. One of two methods was used. The first made use of an activity apparatus consisting of a cylindrical chamber (60 cm in diameter) with crossing infrared beams. Locomotor activity was recorded by a counter (attached to the apparatus) that counted the number of beam crossings made by the mice at 1 min intervals. The activity of two mice was measured simultaneously for 5 min. Two mice were tested together to lower stress to the minimum. Activity is presented as the mean number of beam crossings in 5 min.
Activity was also assessed in the open field (20x30 cm field divided into 12 squares of equal size) as described previously (28)
. Two mice were observed simultaneously for 5 min. Locomotor activity was recorded by counting the number of crossings by the mice at 1 min intervals. Results are presented as the mean number of crossings per minute.
Eight-arm maze
The animals were placed in an 8-arm maze, which is a scaled-down version of the one developed for rats (29
, 30)
. We used water deprivation achieved by limiting water consumption overnight and a reward of 50 µl of water presented at the end of each arm. The mice were tested until they made entries into all eight arms or until they completed 24 entries, whichever came first. Hence, the lower the score, the better the performance. Maze performance was calculated each day for 5 consecutive days. Results were presented as area under the curve utilizing the formula: (day 2+day 3+day 4+day 5) – 4*(day 1).
Statistical analysis
Data are presented as means and SD or SE. Results were evaluated by 1-way ANOVA and 2-tailed t test. Post hoc testing was carried out using the Tukey-Kramer multiple comparisons procedure.
|
RESULTS |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
. To study the mechanisms underlying cerebral tolerance to the stress of energy deficiency in HE, we performed bile duct ligation (BDL) and measured AMPK activity compared with a sham operation. BDL animals exhibited a firm but modest elevation of AMPK activity compared with the sham group during a 20 day evaluation (Fig. 1
A). This stimulation also occurred when longer experimental periods were studied (data not shown). To confirm this finding, we used another model of cerebral dysfunction caused by administration of the hepatotoxin TAA (32)
. Hippocampal AMPK showed a progressive elevation during the first days after the injection. However, this transient response declined to a more modest level after 10 days similar to that observed in the BDL mice (Fig. 1B
). That such AMPK activation occurred in two different experimental models of liver disease implied a role for AMPK in the brain response to hepatocellular damage.
|
Pharmacological activation of AMPK improves liver failure-induced brain dysfunction
Experimental HE in mice is manifested by impaired cognitive function, reduced neurological score, and poor activity performance (23)
. Yet with the continuing stress, the elevated AMPK activity prominently declines. Therefore, we studied the outcome of augmented AMPK activity during the evolution of HE. 5-Aminoimidazole-4-carboxamide ribonucleoside (AICAR, 0.5 mM), a specific pharmacological activator of AMPK, was administrated daily for 5 days to TAA-treated mice. Amplification of AMPK activity in response to AICAR administration was confirmed in the brains of the experimental animals at the end of the behavioral studies (Fig. 2
A).
|
Next we studied the outcome of AMPK activity amplification on brain function. After the treatment, TAA-induced impaired cognitive function was improved significantly (Fig. 2B
), activity performances were restored (Fig. 2C
), and the impaired neurological score was diminished (Fig. 2D
). To reveal the mechanism by which amplified AMPK activity could improve brain function, we studied the catecholaminergic response to AMPK augmentation. Animals with experimental HE exhibited reduced dopamine concentrations while AICAR treatment restored levels to normal (Fig. 2E
). These results demonstrated the potential of stimulating cerebral AMPK in improving liver failure-induced cerebral dysfunction.
Liver failure is accompanied by activation of cerebral AMPK by cannabinoids
Cannabinoids were recently demonstrated to activate hypothalamic AMPK (33)
. Since we have previously shown the involvement of endocannabinoids in experimental HE, we questioned the role of the endocannabinoid system in HE-induced AMPK stimulation. We analyzed the expression of the hippocampal cannabinoid receptors 1–3 days after TAA treatment. Up-regulation of cerebral CB-1 expression was detected both in protein (Fig. 3
A) and mRNA levels (Fig. 3B
). The expression of CB-2 was much lower, as it was practically undetectable in the control mice, yet TAA-treated mice exhibit a significant up-regulation as detected by mRNA analysis (Fig. 3C
). This stimulation of the endocannabinoid receptors suggested a modulation of the endogenous cannabinoid signal as part of the whole cerebral response to liver failure. To consider their role in AMPK stimulation, we studied the effects of giving exogenous cannabinoids to activate AMPK. In the first step, control mice were administrated with 0.01 to 10 mg/kg THC, and hippocampal AMPK phosphorylation was analyzed. THC treatment showed a biphasic effect (34)
. While low levels of THC (i.e., 0.1 mg/kg and 1.0 mg/kg) had an inhibitory effect on AMPK, higher concentrations (>1 mg/kg) exhibited a stimulatory effect, reaching a significant activation of AMPK by 10 mg/kg THC (Fig. 3D
). In the next step, the effect of THC was tested in TAA-treated mice. In this instance, THC also demonstrated a biphasic effect. However, an inhibitory effect was observed at 0.01 mg/kg and AMPK activation was gained by 0.1 mg/kg. Elevation of the cerebral responsiveness to THC suggested that low doses of THC, which do not activate the AMPK in the healthy animals, could be used in the pathological state.
|
THC activates AMPK and improves liver failure-induced brain dysfunction
Since treatment of 0.1 mg/kg THC augmented AMPK activity in a manner similar to AICAR treatment, we chose this dose to test THC’s physiological effects on the experimental HE. TAA-treated mice were administrated daily with 0.1 mg/kg THC for 5 days. Amplification of AMPK activity in response to THC administration was confirmed in the brains of the experimental animals at the end of the behavioral studies (Fig. 4
A).
|
We next investigated the outcome of AMPK activity amplification on brain function. After the treatment, TAA-induced impaired cognitive function was improved significantly (Fig. 4B
), poor activity performances were restored (Fig. 4C
) and the reduced neurological score was improved (Fig. 4D
). To reveal the mechanism by which THC could improve brain function, we studied the catecholaminergic response to THC treatment. Animals with experimental HE exhibited reduced dopamine concentrations while THC administration, similar to AICAR administration, restored levels to normal (Fig. 4E
). These results demonstrated the potential of THC to stimulate cerebral AMPK activity in treating HE.
CB-1 shutdown abolished the effect of THC in control mice but not in those with liver failure
To reveal the signaling pathway mediating THC effects on AMPK and brain function, we blocked CB-1 by administration of the CB-1 antagonist SR141716A. Mice were cotreated with SR141716A and THC doses that were effective in the previous experiment (0.1–10 mg/kg). In the control mice, SR141716A abolished the basal activity of AMPK as well as all effects of THC administration, demonstrating the role of CB-1 in mediating endogenous cannabinoids control of AMPK (Fig. 5
A). In TAA administrated mice, SR141716A treatment completely abrogated the stimulatory effect of TAA on AMPK observed in the previous experiments. In fact, no significant difference could be found between TAA and control mice treated with SR141716A. However, SR141716A did not counteract the THC effect (Fig. 5B
). To explain this apparent paradox, we analyzed cannabinoid receptor expression in response to SR141716A treatment. SR141716A abolished the experimental HE-induced CB-1 (Fig. 5C
) as well as CB-2 stimulation (Fig. 5D
). This result demonstrated that SR141716A is not a specific cerebral CB-1 inhibitor but confers a general attenuation of cerebral responses to experimental HE. This might be the result of peripheral effects rather than direct cerebral activity.
|
AICAR and THC treatment do not improve markers of hepatic function
To investigate the possibility that the neural benefits of AICAR and THC might also result from peripheral effects rather than cerebral function, we studied their effects on liver function. Animals treated with TAA exhibited hyperammonia as a result of the liver dysfunction; AICAR and THC treatment did not improve this effect (Fig. 6
A). Bilirubin levels and liver enzymes activity are the most generally used laboratory markers of liver function. TAA-treated mice demonstrated increased levels of bilirubin (Fig. 6B
), alanine transaminase (ALT) (Fig. 6C
), aspartate aminotransferase (AST) (Fig. 6D
), and gamma-glutamyltransferase (GGT) (Fig. 6E
). Neither AICAR nor THC ameliorated these markers, indicating a lack of direct action on liver recovery. Glucose analysis revealed a systemic hypoglycemia after TAA treatment (Fig. 6F
), providing additional evidence for the metabolic energy impairment characterizing liver failure.
|
THC does not activate AMPK or improve impaired brain function in CB-2 KO mice with liver failure
To uncover the signaling pathway that mediates THC’s effects in experimental HE, we studied the role of CB-2. CB-2 KO mice were treated with TAA. THC (0.1 mg/kg) was administrated daily for 5 days. While AMPK was stimulated (although moderately) in response to TAA treatment as in the previous experiments (Fig. 2A
and Fig. 4A
), it was not amplified in response to THC administration (Fig. 7
A). After the treatment, TAA-induced impaired cognitive function was not improved (Fig. 7B
), poor activity performances were not restored (Fig. 7C
), and the reduced neurological score was not improved (Fig. 7D
). Analysis of the catecholaminergic response to THC treatment revealed that CB-2 KO mice are characterized by high levels of dopamine, which were not affected by TAA or THC treatment (Fig. 7E
). These results demonstrated the significance of the cerebral CB-2 signaling pathway in liver failure-induced brain dysfunction.
|
THC activates PI3K/AKT signaling pathway in control but not in CB-2 KO mice
We studied the downstream targets of CB-2 signaling in experimental HE. TAA treatment phosphorylated of AKT on Ser-473 and THC amplified the effect (Fig. 8
A). TAA-treated CB-2 KO mice also exhibited AKT phosphorylation yet failed to show any change in AKT after treatment with THC (Fig. 8B
).
|
|
DISCUSSION |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
36
37
38)
. Magnetic resonance spectroscopy in patients with chronic liver disease demonstrated low energy reserves in the brain cells of patients with HE (31)
. Additional research has emphasized the link between a low energy supply and the severity of brain symptoms (39)
. To deal with this threat, the brain is equipped with defense mechanisms that respond to energy depletion by initiating adaptive responses. One such mechanism is the AMPK system.
We have studied a model for hepatic encephalopathy in mice with liver damage generated by bile duct ligation and TAA administration. TAA is a hepatotoxin that causes intrahepatic metabolic changes (40)
and has often been used to induce cirrhosis in animals (41)
. Our previous studies have shown that cerebral dysfunction accompanies TAA-induced cirrhosis and may partly reflect the condition of hepatic encephalopathy (23)
. In this study, we demonstrate that AMPK is potently activated in these models. Nonetheless, as found in acute hepatotoxicity (caused by TAA), this response decreases with time, and eventually reaches the same level as that of the chronic stress induced by bile duct ligation. Such a cerebral adaptation response fails to meet the intact brain energy requirements and may be augmented by pharmacological means (AICAR). The benefits of increased AMPK function in HE stem from its ability to restore energy resources and maintain energy flux. Yet these actions are obtained at the cost of "switching off" most of the cellular ATP consuming processes. Protein synthesis is such an anabolic pathway requiring a significant amount of ATP (4 molecules per peptide bond). We have previously shown that shutdown of protein translation is an important outcome of AMPK activation via phosphorylation of the 
-subunit of the eukaryotic initiation factor-2 (eIF2) (42)
. The necessity of protein synthesis for generating long-term memory has been recognized for several decades and has been demonstrated for a variety of memory paradigms (43
, 44)
. Yet only recently the mechanism of translation control by eIF2 was demonstrated to govern hippocampal synaptic plasticity and memory (45)
. Furthermore, as we have shown, eIF2-induced translation inhibition triggers apoptotic cell death, probably by reduction of the cellular antiapoptotic proteins. This also contributes to AMPK-induced impaired cognitive indices through stimulation of neuroapoptosis and inhibition of neurotransmitters (16)
. Thus, pharmacological activation of AMPK might provide a new strategy for the management of HE. However, unselective drugs such as AICAR that activate AMPK under normal and stress conditions are not suitable for clinical use. THC, the principal active constituent of marijuana, has been repeatedly demonstrated to cause brain dysfunction and neurotoxicity (46)
. This finding is in line with our observations of its ability to stimulate AMPK. In addition, these studies have used high dosages of THC (1–15 mg/kg), which were necessary for AMPK activation under normal circumstances. However, since activation of AMPK in experimental HE is beneficial and the dosage of THC required to activate AMPK drops by a factor of 100 (from 10 mg/kg to 0.1 mg/kg), THC could be suitable as a therapeutic agent that could function as a "stress-specific drug" by activating AMPK only under pathological conditions. The inhibitory effect of the CB-1 antagonist SR141716A on AMPK demonstrates the involvement of CB-1 signaling in regulating cerebral AMPK activity under normal situations, and defines a pathway by which the intracellular function of an energy balance regulator such as the AMPK is linked to a systemic one such as the cannabinoid system. However, several lines of evidence suggest that cerebral CB-1 signaling pathway may not play the same role in experimental HE. First, in this study SR141716A attenuated the overall cerebral response to the disease and therefore did not function as a specific CB-1 inhibitor. Second, in our previous study SR141716A significantly improved HE-induced impaired brain function, which could not be explained based on its cerebral effects only (23)
. Finally, recent as yet unpublished work from our laboratory demonstrates that SR141716A may ameliorate liver damage induced by TAA. Obviously, if SR141716A treatment reverses the hepatic injury, then attenuation of brain function impairment and cerebral stress response (AMPK) should follow. Therefore, we conclude that in experimental HE, the beneficial effect of SR141716A treatment on brain function is derived from a blockade of hepatic CB-1 receptor signaling and might have nothing to do with stimulation of the cerebral AMPK stress response. Nevertheless, this supposition is not relevant to the mechanism by which THC and AICAR improved brain function since there was no improvement in markers for liver injury in these experiments.
The shift toward CB-2 signaling pathway in HE sheds new light on its role in cerebral energy balance, which was formerly considered to be marginal compared with that of CB-1. In light of its relative absence in the healthy brain, it is tempting to speculate that in response to cerebral stress, the receptor functions as a molecular switch for neuroprotective signaling by recruiting endogenous CB-2 agonists to amplify AMPK activity. Yet repetitive stimulation of CB-2 receptors by continuous stress may lead to decreased responsiveness and therefore to cerebral "tolerance" to cannabinoid actions (47)
. This may explain our results regarding the time course of cerebral AMPK stimulation. Up-regulation of CB-2 expression increases the transmitting potential of the system, but the neuroprotective signal will be amplified only if sufficient ligands are available. Therefore, we increased the ligand concentration by administration of exogenous cannabinoids (Fig. 9
). In an effort to understand the neuroprotective mechanisms of THC, we studied the involvement of the phosphoinositide 3-kinase/PKB pathway. Its neuroprotective effect has been demonstrated in several studies, and was found to be activated via both CB-1 and CB-2 receptors (48)
. Stimulation of this pathway through THC may be the route by which endocannabinoids confer neuroprotection in HE. THC treatment could also restore levels of dopamine since cannabinoid agonists stimulate dopamine release via several possible mechanisms (49)
. The prominent role that cannabinoids play in drug addiction (50)
has led to efforts to characterize interactions between the dopaminergic and cannabinergic systems. The discovery that dopamine was capable of forming a fatty acid amide with arachidonic acid is quite relevant, especially since the resulting compound had cannabinoid-like activity (51
, 52)
. In addition, high dopamine levels characterizing CB-2 KO mice imply negative regulatory properties of CB-2 in catecholamine signaling.
|
Regardless of the role of AMPK in experimental HE, modulation of the endocannabinoid signal by receptor regulation may provide a novel mechanism for AMPK fine-tuning in response to metabolic and nutritional stresses by adjusting food intake, body weight, and glucose and lipid homeostasis (15)
. Currently, the treatment of HE is difficult and presents a major clinical challenge. Part of the problem results from the multiplicity of deranged systemic responses in the disease such that each treatment offered relates to a different putative cause of neural intoxication (3)
. Here we present a novel strategy. Since neural intoxication disrupts cerebral energy flux, successful therapy should aim at strengthening energy defense mechanisms. One such mechanism is the cannabinoid system. While our understanding of the neural networks involved is still incomplete, we have identified AMPK as a target that rehabilitates cellular energy sources in response to metabolic injury. Therefore, augmentation of AMPK activity by cannabinoid compounds may protect neural cells from the destructive effects of liver failure and restore disturbed brain function in these patients. Clinical trials of exogenous cannabinoids are warranted in the treatment of HE.
|
ACKNOWLEDGMENTS |
|---|
Received for publication November 6, 2006. Accepted for publication February 15, 2007.
|
REFERENCES |
|---|
|
TOPABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  A A Izzo and M Camilleri Emerging role of cannabinoids in gastrointestinal and liver diseases: basic and clinical aspects Gut, August 1, 2008; 57(8): 1140 - 1155. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
