FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published as doi: 10.1096/fj.05-5622fje.
This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.05-5622fjev1
20/9/1558    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kong, K. C.
Right arrow Articles by Penn, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kong, K. C.
Right arrow Articles by Penn, R. B.
(The FASEB Journal. 2006;20:1558-1560.)
© 2006 FASEB

Cooperative mitogenic signaling by G protein-coupled receptors and growth factors is dependent on Gq/11

Kok Choi Kong*, Charlotte K. Billington*, Uma Gandhi*, Reynold A. Panettieri, Jr.{dagger} and Raymond B. Penn*,1

* Department of Internal Medicine and Center for Human Genomics, Wake Forest University Health Sciences, Winston-Salem, North Carolina, USA; and

{dagger} Department of Medicine, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA

1Correspondence: Wake Forest University Health Sciences Center, Center for Human Genomics, Medical Center Blvd., Winston-Salem, NC 27157, USA. E-mail: rpenn{at}wfubmc.edu

ABSTRACT

Previously we reported that the G protein-coupled receptor (GPCR) agonist thrombin potentiated the mitogenic effect of epidermal growth factor (EGF) on human airway smooth muscle (ASM) by promoting sustained late-phase activation of PI3K and p70S6K via a pathway dependent on Gß{gamma} subunits of heterotrimeric G proteins. Here, we provide additional mechanistic insight and reveal the robustness of this phenomenon by demonstrating that H1 histamine and thromboxane receptors utilize the same mechanism to augment ASM growth via specific activation of the heterotrimeric G protein Gq/11. Thrombin, histamine, and U46619 all enhanced EGF-stimulated [3H]-thymidine incorporation as well as late-phase Akt and p70S6K phosphorylation in ASM cultures. Heterologous expression of Gß{gamma} sequestrants (GRK2CT-GFP or G{alpha}iG203A), as well as GRK2NT-GFP (an RGS protein for Gq/11) but neither p115RhoGEFRGS-GFP (an RGS for G12/13) nor pertussis toxin pretreatment (inactivating Gi/o), attenuated the effects on both signaling and growth. Inhibition of Rho, Rho kinase, or Src, or modulation of arrestin expression did not significantly affect the cooperative signaling by EGF and any of the GPCR agonists. Thus, Gq/11-coupled receptors are the principal GPCR subfamily mediating cooperative mitogenic signaling in ASM, acting through Gß{gamma}-dependent, and Src/arrestin-independent activation of PI3K and p70S6K.—Kong, K. C., Billington, C. K., Gandhi, U., Panettieri, R. A., Penn, R. B. Cooperative mitogenic signaling by G protein-coupled receptors and growth factors is dependent on Gq/11.


Key Words: airway remodeling • airway smooth muscle • asthma • p70S6 kinase • phosphoinositide 3'-kinase

FOR YEARS, G PROTEIN-COUPLED receptors (GPCRs) had been viewed as associated with tissue-specific functions (e.g., contraction, exocytosis) in fully differentiated cells (1) , whereas receptor tyrosine kinases (RTKs) activated by polypeptide growth factors were critical to mitogenic signaling and mediating cell growth (2) . However, these distinctions ultimately faded as GPCRs and heterotrimeric G proteins could be shown to act as oncogenes (3) , mediate cell transformation (4) , and promote mitogenesis in various disease and experimental states [reviewed in (5) ]. Numerous ligands activating GPCRs coupled to the Gs, Gi/o, Gq/11, or G12/13 subfamilies have been shown to regulate proliferative responses in numerous cell types. In airway smooth muscle (ASM) cells, various GPCR agonists, although often weak mitogens by themselves, have been shown to promote synergistic stimulation of cell proliferation when combined with growth factors such as epidermal growth factor (EGF) or platelet-derived growth factor (PDGF) (6 7 8) . This phenomenon is likely manifested in inflammatory airway diseases such as asthma, in which increased ASM mass is evident and the levels of many GPCR agonists (such as thrombin, histamine, serotonin, acetylcholine, and thromboxane) (9 10 11 12 13) , as well as levels of growth factors (14) , are elevated in the airway.

Although the mechanism(s) underlying the cooperative effects of RTKs and GPCRs in augmenting cell growth are not fully elucidated, we have recently demonstrated that combined EGF and thrombin stimulation of human ASM cell proliferation is associated with a synergistic increase in the late-phase p70S6K activity (6) and that both cooperative signaling and effects on cell proliferation are mediated by a late-phase, sustained activation of PI3K/Akt/p70S6K pathways by thrombin via a Gß{gamma}-dependent pathway (15) . Here we provide additional mechanistic insight and demonstrate that this phenomenon represents a fundamental mechanism by which signaling by numerous G protein-coupled receptors interacts with RTK signaling to regulate cell proliferation.

MATERIALS AND METHODS

All phospho-p70S6K and phospho-Akt antibodies were from Cell Signaling Technology (Beverly, MA). p70S6K antibody (Ab) (C-18) was from Santa Cruz Biotechnology (Santa Cruz, CA). IRDye 700 or 800 secondary antibodies were from Rockland (Gilbertsville, PA). Alexa Fluor 680 secondary Ab was from Molecular Probes (Eugene, OR). [methyl-3H]-Thymidine (50Ci/mmol) was from Amersham Biosciences (Piscataway, NJ). EGF was from RD Systems (Benicia, CA). U46619 was from Cayman Chemical (An Arbor, MI). All other materials were obtained from Sigma (St. Louis, MO) or from previously identified sources (15) .

Cell culture
Human ASM cultures were established as described previously by Panettieri et al. (16) from human tracheae obtained from lung transplant donors. Characterization of these cells with regard to immunofluorescence of smooth muscle actin and agonist-induced changes in cytosolic calcium has been reported previously (16 , 17) . Third to sixth passage cells, or fifth to eighth passage cells stably selected after retroviral infection as described below, were plated at a density of 104 cells/cm2 in either 24-well ([3H]-thymidine assay) or 6-well plates (immunoblots) and maintained in Ham’s F-12 medium supplemented with 10% FBS. Twenty-four h prior to stimulation, cells were growth-arrested by washing once in PBS and refeeding with Ham’s F-12 media supplemented with 0.1% BSA. One hour before stimulation, the cells were washed once again with PBS and refed with Ham’s F-12 supplemented with 0.1% BSA.

[3H]-Thymidine incorporation assay
After growth-arrest, cells were stimulated with various agents as indicated. Standard concentrations of agents, unless otherwise noted, were as follows: EGF (10 ng/ml); thrombin (1 u/ML); histamine (10µM); and U46619 (100 nM). After 16 h of stimulation, cells were labeled with 3 µCi of [methyl-3H]-thymidine (50 Ci/mmol) for 24 h at 37°C. Cells were then washed once with PBS, harvested with 0.05% trypsin (0.53 mM) EDTA and lysed with equal vol of 20% trichloroacetic acid for 20 min at 4°C. The precipitate was collected using Brandel Cell Harvester (Gaithersburg, MD) onto filter paper, and the radioactivity was quantified by liquid scintillation counter. Data points from individual experiments represent the mean values derived from six wells.

Immunoblotting
Cells were grown to near confluence in 6-well plates and growth-arrested for 24 h in serum-free Ham’s F-12 supplemented with 0.1% BSA, as described above, then stimulated with indicated agents for 30 min, 4 h, or 6 h. Cells were then washed twice with ice-cold TBS buffer (25 mM Tris, 150 mM NaCl, pH 8.0), then solubilized in a 25 mM Tris buffer (pH 8.0) containing 150 mM NaCl, 20 mM NaF, 5 mM EGTA, 1 mM EDTA, 10 mM sodium pyrophosphate, 10 mM p-nitrophenyl phosphate, 1 mM benzamidine, 0.1 M PMSF, and 1% (v/v) NP-40 (lysis buffer) for 30 min at 4°C. Following scraping, cell lysates were centrifuged at 13,200 g at 4°C for 10 min. Supernatants were collected and boiled for 5 min in 1% sodium dodecyl sulfate (SDS) sample buffer before being electrophoresed on 7.5% SDS-polyacrylamide gel, transferred to nitrocellulose membranes, and subsequently probed with antibodies that recognize p70S6K phosphorylated at residue T389, Akt phosphorylated at residue S473, and total Akt and Alexa Fluor 680 secondary Ab conjugated with infrared fluorophores. Bands were visualized and signals (infrared emission) quantified directly using the Odyssey Infrared Imaging System (Li-Cor, Lincoln, NE).

Generation of constructs
GRK2-(495–689) (GRK2CT; (18) , GRK2-(45–178) (GRK2NT; (19) , p115RhoGEFRGS (20) , and arrestin2 and arrestin 3 (21) were subcloned into pEGFPN1 by polymerase chain reaction (PCR) cloning. HindIII/NotI fragments, encoding GFP, GRK2NT-GFP, p115RhoGEFRGS-GFP, arrestin2-GFP, or arrestin3-GFP were cloned into the retrovirus expression vector pLNCX2. pLNCX2GRK2CT-GFP and pLNCX2G{alpha}iG203A were generated as described previously (15) . Arrestin2/3 siRNA (sense sequence: 5'-GATCCGACCTGCGCCTTCCGCTATGTTCAAGAGACATAGCGG AAGGCGCAGGTCTTTTTT AAGCTTG 3') and control siRNA (sense sequence: 5'GATCCGGCGCGCTTTGTAGGATTCGTTCAAGAGACGAATCCTACAAAGCGCGCCTTTTTTAAGCTTG3') were generated by ligating the annealed oligos into retroviral vector pSIREN-RetroQ.

Retroviral infection
Stable expression of GFP, GRK2CT-GFP, G{alpha}iG203A, GRK2NT-GFP, p115RhoGEFRGS-GFP, arrestin2-GFP, and arrestin3-GFP was achieved by retroviral infection as described previously (15) . Briefly, retrovirus for the expression of each was produced by cotransfecting GP2–293 cells with pVSV-G Vector [encoding the pantropic (VSV-G) envelope protein] and either pLNCX2-GFP, pLNCX2-GRK2CT-GFP, pLNCX2-GRK2NT-GFP, pLNCX2-G{alpha}iG203A, pLNCX2-p115RhoGEFRGS-GFP, pLNCX2-arrestin2-GFP, or pLNCX2-arrestin3-GFP. Retrovirus for arrestin2/3 siRNA or control siRNA was generated by cotransfecting GP2–293 cells with pVSV-G Vector and either pSIREN-arrestin2/3 siRNA or pSIREN-control siRNA. Forty-eight hours after transfection, supernatants were harvested and used to infect human ASM cultures, with effective virus concentrations established by immunoblot analysis. Cultures were selected to homogeneity with 250 µg/ml G418 as described previously (15) , except for cultures expressing arrestin2/3 an control siRNAs, which were selected with 0.5 µg/ml puromycin. Expression of GRK2NT-GFP in ASM cells could inhibit thrombin, histamine, and U46619-stimulated phosphoinositide hydrolysis by 50–70%; expression of p115RhoGEFRGS-GFP could ablate SRF-Luc activity in cells cotransfected with constitutively active G{alpha}13 (G{alpha}13Q226L); and expression of arrestin 2/3 siRNA resulted in a 50–60% knockdown of arrestin2/3 protein levels, assessed by immunoblotting (data not shown).

Data analysis
Data are presented as mean ± SE. Statistically significant differences among groups were assessed by ANOVA, and Tukey posthoc tests for specific pair-wise differences, or t test where appropriate, with values of P < 0.05 sufficient to reject the null hypothesis.

RESULTS

Gq/11 but not Gi/o nor G12/13 mediates the cooperative effect of thrombin with EGF
Having previously established that Gß{gamma} mediates the cooperative mitogenic signaling of EGF and thrombin, we set out to identify the heterotrimeric G protein(s) involved in this mechanism. In ASM, thrombin activatesprotease-activated receptors (22) , GPCRs that can couple to multiple G-proteins including Gi/o, Gq/11, and G12/13. We previously demonstrated that pertussis toxin fails to appreciably inhibit the effect of thrombin on EGF stimulated p70S6K activation or ASM growth (15) , suggesting that Gi/o is not required for thrombin’s effects. To examine the potential roles of Gq/11 and G12/13, we generated pLNCX2-based constructs encoding RGS-like proteins GRK2-NT (19) and p115RhoGEFRGS (20) as GFP chimeras, to selectively inhibit Gq/11 and G12/13, respectively. Retrovirus was generated to infect ASM cultures in order to obtain stable lines as described in Materials and Methods. Fig. 1 shows the expression levels of the GFP-, GRK2NT-GFP-, and p115RhoGEFRGS-GFP-infected cells by direct fluorescence microscopy visualization (A–D) and flow cytometry (E). Profiles of EGF- and thrombin-stimulated Akt and p70S6K phosphorylation were subsequently analyzed in these cells. As shown in Fig. 2 , expression of GRK2NT-GFP caused a significant inhibition of p70S6K and Akt phosphorylation induced by combined EGF and thrombin stimulation at the 4 h but not the 30 min time point, whereas p115RhoGEFRGS-GFP expression did not inhibit Akt and p70S6K phosphorylation at 4 h by combined EGF and thrombin stimulation.


Figure 1
View larger version (45K):
[in this window]
[in a new window]
  		Figure 1. Stable expression of GFP, GRK2NT-GFP, and p115RhoGEF-GFP in ASM by retroviral infection. Retrovirus for GFP, GRK2NT-GFP, and p115RhoGEFRGS-GFP, generated by transfecting GP2–293 cells with the respective constructs as described in Materials and Methods, were used to infect ASM cultures of third-passage. Images were taken 1 wk after the selection with 250 µg/ml G418. Right panels of each set of the images represent Hoffman modulation light field images. A) Autofluorescence of noninfected ASM cells; (B–D) GFP-, GRK2NT-GFP- and p115RhoGEFRGS-GFP-infected cells, respectively. E) Flow cytometry analysis of GFP fluorescence in GFP- (left), GRK2NT-GFP- (middle), and p115RhoGEFRGS-GFP- (right) infected cells. The dotted lines represent the cellular autofluorescence in noninfected cells. Bolded numbers represent the percentage of infected cells with GFP fluorescence greater than maximal autofluorescence.


Figure 2
View larger version (28K):
[in this window]
[in a new window]
  		Figure 2. Effects of GRK2NT-GFP and p115RhoGEFRGS-GFP expression, and Rho kinase inhibition on p70S6K, Akt phosphorylation, and ASM [3H]-thymidine incorporation stimulated by EGF and thrombin. ASM cells infected with GFP or GRK2NT-GFP (A, C, D, F) or GFP or p115RhoGEFRGS-GFP (B, C, D, F) were grown to near confluence in 6-well plates and growth arrested before stimulation with 10 ng/ml of EGF (E), 1 U/ml of thrombin (T) or both EGF and thrombin (E+T) for 30 min or 4 h. Efficacy of GRK2NT-GFP in inhibiting Gq/11-dependent signaling in ASM cells was demonstrated in separate experiments in GRK2NT-GFP expression significantly inhibited thrombin, histamine, and U46619-stimulated phosphoinositide hydrolysis; whereas expression of p115RhoGEFRGS-GFP could ablate SRF-Luc activity in cells cotransfected with constitutively active G{alpha}13 (G{alpha}13Q226L) (data not shown). E) Cells were pretreated with Rho kinase inhibitor Y27623 (10 µM) for 30 min prior to stimulation. The blot shown is representative of four independent experiments; Y27632 pretreatment did not significantly inhibit agonist-stimulated pT389p70S6K (causing a 2±18% decrease in EGF-stimulated values, and 1±12% and 11±9% increases in thrombin- and E+T- stimulated values, respectively) nor pS473Akt levels (7±12% decrease in EGF-stimulated values, and 7±17% and 26 ±30% increases in thrombin- and E+T-stimulated values, respectively; all P >0.05, n=4). Reactions were terminated and the cells were lysed as described in Materials and Methods. Samples were subjected to 7.5% SDS-PAGE and levels of phospho-p70S6K (T389), phospho-Akt (S473), and Akt were assessed by immunoblotting. Representative blots (A, B, and E) and graphs depicting mean ± SE values of quantified phosphoprotein bands (C and D, n =5–7) are presented. Raw values for the 30 min EGF-stimulated condition for each experiment were set to a value of 1.0, and all other values normalized accordingly. F) Depicts [3H]-thymidine incorporation stimulated by EGF, thrombin, or both EGF and thrombin in GFP-, GRK2NT-GFP-, or p115RhoGEFRGS-GFP-expressing lines (mean ±SE values, n =7 paired observations for GFP vs. GRK2NT-GFP, and n =4 paired observations for GFP vs. p115 RhoGEFRGS-GFP). *P <0.05, GFP vs. GRK2NT-GFP or p115 RhoGEFRGS-GFP group value for the indicated stimulatory condition.

Previous studies have reported that thrombin can stimulate vascular smooth muscle DNA synthesis in a Rho/Rho kinase-dependent manner (23) and synergistic ASM proliferation induced by combined LPA and EGF treatment involves a Rho-dependent pathway (24) . Of note, Gq/11 in addition to G12/13 has the potential to activate Rho/Rho kinase (25 , 26) . We therefore examined the effect of inhibiting Rho kinase (with Y27632) or Rho (with C3 exoenzyme) on thrombin-mediated effects on Akt and p70S6K phosphorylation. Pretreatment of ASM cultures with C3 exoenzyme (not shown) or with Y27632 (Fig. 2E ) failed to inhibit the thrombin-induced augmentation of both Akt and p70S6K phosphorylation by EGF at 4h, and also failed to inhibit the cooperative effect of thrombin on EGF-stimulated [3H]-thymidine incorporation (data not shown). These findings suggest a lack of requirement for Rho or Rho kinase in mediating the cooperative mitogenic signaling by EGF and thrombin.

Consistent with the dependence on Gq/11 on the signaling events analyzed above, and the asserted role of p70S6K in mediating the potentiating effect of thrombin on EGF-stimulated ASM growth, GRK2NT-GFP (but not p115RhoGEFRGS-GFP) expression reversed the augmentation of EGF-stimulated [3H]-thymidine incorporation by thrombin (Fig. 2F ).

Collectively, the data demonstrate that Gq/11 is the principal G protein required for mediating the cooperative effects of thrombin on EGF-stimulated Akt/p70S6K phosphorylation and [3H]-thymidine incorporation.

Histamine and U46619 augment EGF-induced p70S6K and Akt phosphorylation
We previously demonstrated the ability of numerous GPCR agonists to augment EGF-induced late-phase p70S6K activity in association with their ability to increase EGF-stimulated ASM proliferation (6) . To determine whether other GPCR agonists effect a regulation of late-phase EGF-stimulated p70S6K and Akt phosphorylation similar to that caused by thrombin, ASM cultures were treated with EGF plus either histamine or U46619 (a stable analog of thromboxane A2) for 6 h, the time point corresponding to maximal cooperative activation of p70S6K by these agents (6) . Similar to the phosphorylation profile mediated by thrombin treatment, histamine and U46619 significantly increased EGF stimulation of p70S6K T389 and Akt S473 phosphorylation at the late-phase but not the early (30 min) time point. Thus, the data demonstrate that histamine and U46619 exert a qualitatively similar cooperative effect to that induced by thrombin in the induction of late-phase p70S6K and Akt phosphorylation.

Gß{gamma} and Gq/11 play a role in mediating the cooperative effects of histamine and U46619 with EGF
Next, experiments were undertaken to determine whether histamine and U46619, like thrombin, use a Gß{gamma}- and Gq/11-dependent mechanism to promote cooperative activation of PI3K/Akt/p70S6K. The C-terminus of G protein-coupled receptor kinase 2 (GRK2CT) and the G203A mutant of G{alpha}i1 (G{alpha}iG203A) (27) were previously used as effective Gß{gamma} sequestrants to implicate a role for Gß{gamma} in thrombin regulation of PI3K/Akt/p70S6K (15) . Retrovirus for GFP, GRK2CT-GFP, and G{alpha}iG203A were generated and used to infect human ASM cultures in order to obtain stable lines [see Materials and Methods and (15) ]. As shown in Fig. 4 A, the cooperative effects of both histamine and U46619 on EGF-induced phosphorylation of p70S6K and Akt were still observed at 6 h in GFP-expressing (control) cells. However, the effects were significantly inhibited in both GRK2CT-GFP- and G{alpha}iG203A-expressing cells (Fig. 4A, B ).


Figure 4
View larger version (18K):
[in this window]
[in a new window]
  		Figure 4. Effects of GRK2CT-GFP, G{alpha}iG203A, and GRK2NT-GFP expression on cooperative stimulation of Akt and p70S6K phosphorylation by EGF and histamine or U46619 in ASM cells. ASM cells expressing (A) GFP, GRK2CT-GFP, G{alpha}iG203A, or GRK2NT-GFP by retroviral infection were grown to near confluence in 6-well plates and growth-arrested before being stimulated with 10 ng/ml of EGF (E), 10 µM histamine (H) or both EGF and histamine (E+H), or 100 nM U46619 (U) or both EGF and U46619 (E+U) for 6 h. Immunoblots were generated as described in Materials and Methods. Blots shown (A) are representative results obtained in six separate sets of lines derived from distinct donors and graphs depicting mean ± SE of quantified phosphoprotein bands (B) are presented. C) [3H]-thymidine incorporation stimulated by EGF, histamine, or both EGF and histamine, U46619 or both EGF and U46619 in GFP-, GRK2CT-GFP-, G{alpha}iG203A-GFP-, or GRK2NT-GFP-expressing lines (mean±SE, n=5–6). *P < 0.05, GFP vs. GRK2CT-GFP, G{alpha}iG203A or GRK2NT-GFP group value for the indicated stimulatory condition.

To examine the potential role of Gq/11, GRK2NT-GFP was stably expressed in ASM cultures as described in Materials and Methods. As shown in Fig. 4A , expression of GRK2NT-GFP significantly inhibited the cooperative effects of histamine and U46619 on EGF-induced p70S6K and Akt phosphorylation at 6 h. As was the case with thrombin-dependent regulation [Fig. 2C and (15) ], neither pertussis toxin pretreatment nor expression of p115RhoGEFRGS-GFP affected the cooperative phosphorylation of p70S6K or Akt by either histamine or U46619 (data not shown).

In addition, expression of GRK2CT-GFP, G{alpha}iG203A, or GRK2NT-GFP could attenuate the cooperative effects of histamine or U46619 on EGF-stimulated ASM growth as measured by [3H]-thymidine incorporation (Fig. 4C ), whereas pretreatment with pertussis toxin, Y27632, C3 exoenzyme, or stable expression of p115RhoGEFRGS-GFP had no effects (data not shown). Collectively, these data suggest that histamine and U46619 use a similar mechanism to that of thrombin in augmenting EGF-stimulated ASM growth by promoting a late-phase PI3K and p70S6K activity via a Gq/11-derived Gß{gamma}-dependent pathway.

Src and arrestins are not required for the cooperative effects
A recent study by Goel et al. (28) reported that rapid activation of PI3K/Akt by thrombin is mediated via an arrestin2- and Src-dependent pathway in Chinese hamster embryonic fibroblast cell line IIC9. Src has also been implicated in activation of p70S6K in certain cell types, and both Src and arrestins have been shown to be involved in numerous forms of crosstalk between GPCRs and mitogenic signaling pathways (29 , 30) . We therefore investigated the possible role of arrestins and Src in our system. However, we failed to discern a role for Src in mediating increased p70S6K phosphorylation, as pretreatment with the Src inhibitor PP1 had but a minimal effect on basal, EGF-, and thrombin-stimulated T389 phosphorylation, with the cooperative effect of combined EGF and thrombin stimulation essentially unaffected (data not shown). Src inhibition also had no effect on cooperative signaling promoted by histamine or U46619 (data not shown). Of note, pretreatment of ASM cells with PP1 was able to inhibit mitogen-stimulated growth [(31) and data not shown].

In addition, we failed to discern a role for either arrestin2 or arrestin3 in mediating the cooperative effects on PI3K/Akt/p70S6K activity as neither overexpression of arrestin2 or arrestin3, nor arrestin knockdown using siRNA by retroviral infection influenced the profile of thrombin-, histamine-, or U46619-dependent modulation of EGF-stimulated Akt or p70S6K phosphorylation (data not shown).

DISCUSSION

Increased ASM mass is recognized as a principal feature of airway remodeling that is characteristic of chronic asthma and contributes to both fixed airflow obstruction and exaggerated response to contractile agents. Given the limitations of in vivo models capable of examining this phenomenon, limited insight exists into the mechanisms mediating ASM hyperplasia and hypertrophy. However, it is appreciated that levels of both growth factors (14) and GPCR agonists (9 10 11 12 13) can be elevated in the asthmatic airway and that various combinations of growth factors and GPCRs agonists can synergistically stimulate the proliferation of ASM cells in culture (6 7 8) . Our initial studies characterizing the mitogenic signaling associated with GPCR-mediated augmentation of EGF-stimulated ASM growth demonstrated an association with prolonged, increased activation of p70S6K, and not of p42/p44 MAPK (6) . Our more recent study demonstrated that thrombin, which activates protease-activated receptors in ASM (22) , augments EGF-stimulated PI3K and p70S6K activity, as well as thymidine incorporation, via a mechanism dependent on Gß{gamma} subunits. GPCR-mediated regulation of p70S6K activity involved specific regulation of T389 phosphorylation, as specific inhibition of p42/p44 and the associated phosphorylation of the proline-directed residues S421/T424 did not affect p70S6K activity or the cooperative effect on ASM DNA synthesis (15) .

The present study offers two major findings. First, Gq/11 is identified as the principal heterotrimeric G protein mediating the cooperative effects of thrombin on EGF-induced late-phase PI3K/p70S6K activation and growth in ASM in a Gß{gamma}-dependent manner. The finding that Gq/11, but not Gi/o is the principal G protein responsible for the mechanism is rather intriguing as Gi/o tends to be the most abundantly expressed heterotrimeric G protein in non-neuronal cells including human ASM (Penn, unpublished observations) and is therefore the most likely source of Gß{gamma}. Of note, however, is a previous study by Panettieri et al. (32) that demonstrated pertussis toxin pretreatment of human ASM inhibits thrombin-stimulated PI hydrolysis by only 10%. Second, we demonstrate that two other GPCRs, namely the Gq/11-coupled H1 histamine receptor, and the T Prostanoid (TP, or TXA2) receptors, which can couple to Gq/11, Gi/o and G12/13 [reviewed in (33) ], also exhibit similar cooperative mitogenic effects with EGF via a similar mechanism. Thus, the cooperative mitogenic signaling by GPCRs and EGF appears to be a robust phenomenon that employs the fundamental mechanism of Gq/11-derived Gß{gamma} subunits promoting late-phase PI3K and p70S6K activity.

Two recent studies by Goel et al. examining IIC9 cells demonstrated that: 1) thrombin induces an acute (Gi/o-, Gq/11-, arrestin2-, and Src-dependent) and sustained (arrestin2-independent) activation of PI3K/Akt; and 2) only the sustained, arrestin2-independent pathway is important for cell cycle progression (28 , 34) . Our data from ASM cells similarly point to an arrestin-independent mechanism mediating effects of thrombin (and other GPCRs) on late-phase PI3K/Akt activation and further demonstrate it being independent of Src and primarily dependent on Gq/11. Although Gi/o may be important for the acute activation of PI3K/Akt by thrombin, this activity does not appear critical for the cooperative mitogenic effects of RTKs and GPCRs in ASM. Inhibitory effects of pertussis toxin on thrombin-stimulated ASM growth may be mediated through inhibition of the p42/p44 MAPK pathway, which we have previously demonstrated to be dissociated from the cooperative effect of thrombin on EGF-stimulated thymidine incorporation (15) .

Arrestins and Src have been implicated in the activation of p42/p44 MAPK in multiple cell types. In COS-7, HEK293, or Rat-1 fibroblasts, GPCRs, through an ill-defined process requiring Gß{gamma}, were found to phosphorylate RTKs via activation of Src (35 36 37 38) . In PC12 pheochromocytoma cells, GPCRs preferentially utilize focal adhesion complexes as scaffolds to activate focal adhesion kinases, which can activate Src and induce Ras-dependent p42/p44 MAPK activation independent of RTKs (36) . Arrestin2 can serve as an adaptor protein utilized by GPCRs to recruit Src and activate p42/p44 MAPK (29) . In guinea-pig ASM, c-Src was found to activate p42/p44 MAPK in a pertussis toxin-dependent manner (39 , 40) . More recently, Src has been shown to play an essential role in the growth and motility of human ASM (31) . Despite the roles arrestins and Src play in the activation of p42/p44 MAPK pathway, our findings suggest they are not involved in the cooperative mitogenic signaling by GPCRs and RTKs in ASM.

Consistent with our findings, Gosens et al. (8) demonstrated that the augmented growth of bovine ASM cells induced by PDGF and methacholine was mediated through m3- (Gq/11-coupled) and not the m2- (Gi/o-coupled) muscarinic acetylcholine receptors. This finding further supports the notion that Gq/11 but not Gi/o is important in mediating the cooperative effects of GPCRs and RTKs on mitogenic signaling in ASM cells.

Although both the expressed Gß{gamma} sequestrants (GRK2CT-GFP, G{alpha}iG203A) and a Gq/11 RGS (GRK2NT-GFP) could attenuate Akt/p70S6K phosphorylation and thymidine incorporation by combined EGF and GPCR stimulation, a residual cooperativity was still observed in each end point. The lack of complete inhibition might be explained by a failure to express each construct to sufficiently high levels or in 100% of cells. An alternative and perhaps more likely explanation is that another mechanism(s) contributes to the effect on cell growth. Numerous pathways, many of which cannot be readily excluded, are activated by GPCRs and have the potential to crosstalk with RTK-mediated signaling. For example, numerous calcium-dependent signaling events elicited by GPCRs might interact with cytoplasmic or nuclear signals derived from RTKs. Yet inhibiting these GPCR-specific signals tends to be problematic, as ASM cells do not tolerate sustained absence or chelation of calcium (Penn, unpublished observations), and most approaches for inhibiting calcium-sensitive kinases lack specificity. Thus, although the mechanism we put forth herein appears to be an important, if not principal, mediator of GPCR effects on EGF-stimulated ASM growth, we cannot exclude a role for other mechanisms.

In summary, the current study delineates a novel pathway by which GPCRs crosstalk with mitogenic signals from RTKs to enhance the proliferation of a primary cell type. The findings herein suggest not only a fundamental mechanism mediating cell proliferation but also a possible explanation of the increased ASM mass observed in asthmatic subjects, with the hope that selective targeting of GPCR-derived signals will be able to address this component of the disease.


Figure 3
View larger version (21K):
[in this window]
[in a new window]
  		Figure 3. Effects of histamine and U46619 on EGF-induced p70S6K and Akt phosphorylation in ASM cells. Naive ASM cells were grown to near confluence in 6-well plates and growth-arrested before stimulation with 10 ng/ml of EGF (E), 10 µM histamine (H), or both EGF and histamine (E+H), 100 nM U46619 (U) or both EGF and U46619 (E+U) for 30 min or 6 h. Immunoblots were generated as described in Materials and Methods. Representative blots (A) and graphs depicting mean ± SE values of quantified phosphoprotein bands (B, n =6) are presented. Raw values for the 6 h EGF-stimulated condition for each experiment were set to a value of 1.0, and all other values normalized accordingly. *P < 0.05, value for EGF-stimulation condition compared with the E+H or E+U stimulation condition.

ACKNOWLEDGMENTS

This study was supported by National Institutes of Health grants HL65338, HL58506, and HL67663. We thank Al Gilman for supplying pQE6G{alpha}iG203A. and Phil Wedegaertner for supplying p115RhoGEFRGS.

Received for publication December 20, 2005. Accepted for publication March 14, 2006.

REFERENCES

  1. Penn, R. B., Benovic, J. L. (1998) Regulation of G protein-coupled receptors. Conn, P. M. eds. Handbook of Physiology ,125-164 Oxford University Press
  2. Yarden, Y., Ullrich, A. (1988) Growth factor receptor tyrosine kinases. Annu. Rev. Biochem. 57,443-478[CrossRef][Medline]
  3. Young, D., Waitches, G., Birchmeier, C., Fasano, O., Wigler, M. (1986) Isolation and characterization of a new cellular oncogene encoding a protein with multiple potential transmembrane domains. Cell 45,711-719[CrossRef][Medline]
  4. Dhanasekaran, N., Heasley, L. E., Johnson, G. L. (1995) G protein-coupled receptor systems involved in cell growth and oncogenesis. Endocr. Rev. 16,259-270[Abstract/Free Full Text]
  5. van Biesen, T., Luttrell, L. M., Hawes, B. E., Lefkowitz, R. J. (1996) Mitogenic signaling via G-protein coupled receptors. Endocr. Rev. 17,698-714[Abstract/Free Full Text]
  6. Krymskaya, V. P., Orsini, M. J., Eszterhas, A., Benovic, J. L., Panettieri, R. A., Penn, R. B. (2000) Potentiation of human airway smooth muscle proliferation by Receptor Tyrosine Kinase and G protein-coupled receptor activation. Am. J. Respir. Cell Mol. Biol. 23,546-554[Abstract/Free Full Text]
  7. Ediger, T. L., Toews, M. L. (2000) Synergistic stimulation of airway smooth muscle cell mitogenesis. J. Pharmacol. Exp. Ther. 294,1076-1082[Abstract/Free Full Text]
  8. Gosens, R., Nelemans, S. A., Grootte Bromhaar, M. M., McKay, S., Zaagsma, J., Meurs, H. (2003) Muscarinic M3-receptors mediate cholinergic synergism of mitogenesis in airway smooth muscle. Am. J. Respir. Cell Mol. Biol. 28,257-262[Abstract/Free Full Text]
  9. Sofia, M., Mormile, M., Faraone, S., Alifano, M., Zofra, S., Romano, L., Carratu, L. (1993) Increased endothelin-like immunoreactive material on bronchoalveolar lavage fluid from patients with bronchial asthma and patients with interstitial lung disease. Respiration 60,89-95[Medline]
  10. Panettieri, R. A. (1994) Airway smooth muscle cell growth and proliferation. Raeburn, D. Giembycz, M. A. eds. Airway Smooth Muscle: Development, Regulation, and Contractility ,41-68 Birkhauser Verlag Basel.
  11. Zehr, B. B., Casale, T. B., Wood, D., Floerchinger, C., Richerson, H. B., Hunninghake, G. W. (1989) Use of segmental airway lavage to obtain relevant mediators from the lungs of asthmatic and control subjects. Chest 95,1059-1063[CrossRef][Medline]
  12. Casale, T. B., Wood, D., Richerson, H. B., Trapp, S., Metzger, W. J., Zavala, D., Hunninghake, G. W. (1987) Elevated bronchoalveolar lavage fluid histamine levels in allergic asthmatics are associated with methacholine bronchial hyperresponsiveness. J. Clin. Invest. 79,1197-1203[Medline]
  13. Ackerman, V., Carpi, S., Bellini, A., Vassalli, G., Marini, M., Mattoli, S. (1995) Constitutive expression of endothelin in bronchial epithelial cells of patients with symptomatic and asymptomatic asthma and modulation by histamine and interleukin-1. J. Allergy Clin. Immunol. 96,618-627[CrossRef][Medline]
  14. Vignola, A. M., Chanez, P., Chiappara, G., Merendino, A., Pace, E., Rizzo, A., la Rocca, A. M., Bellia, V., Bonsignore, G., Bousquet, J. (1997) Transforming growth factor-beta expression in mucosal biopsies in asthma and chronic bronchitis. Am. J. Respir. Crit. Care Med. 156,591-599[Abstract/Free Full Text]
  15. Billington, C. K., Kong, K. C., Bhattacharyya, R., Wedegaertner, P. B., Panettieri, R. A., Chan, T. O., Penn, R. B. (2005) Cooperative regulation of p70S6 kinase by receptor tyrosine kinases and G protein-coupled receptors augments airway smooth muscle growth. Biochemistry 44,14595-14605[CrossRef][Medline]
  16. Panettieri, R. A., Murray, R. K., DePalo, L. R., Yadvish, P. A., Kotlikoff, M. I. (1989) A human smooth muscle cell line that retains physiological responsiveness. Am. J. Physiol. 256,C329-C335(Cell Physiol. 25)[Medline]
  17. Murray, R. K., Fleischmann, B. K., Kotlikoff, M. I. (1993) Receptor-activated Ca2+ influx in human airway smooth muscle: use of Ca2+ imaging and perforated patch-clamp techniques. Am. J. Physiol. 264,C485-C490(Cell Physiol. 33)[Medline]
  18. Carman, C. V., Barak, L. S., Chen, C., Liu-Chen, L., Onorato, J. J., Kennedy, S. P., Caron, M. C., Benovic, J. L. (2000) Mutational analysis of Gbg and phospholipid interaction with G protein-coupled receptor kinase 2. J. Biol. Chem. 275,10443-10452[Abstract/Free Full Text]
  19. Carman, C. V., Parent, J. L., Day, P. W., Pronin, A. N., Sternweis, P. M., Wedegaertner, P. B., Gilman, A. G., Benovic, J. L., Kozasa, T. (1999) Selective regulation of Gq/11alpha by an RGS domain in the G protein-coupled receptor kinase GRK2. J. Biol. Chem. 274,34483-34492[Abstract/Free Full Text]
  20. Bhattacharyya, R., Wedegaertner, P. B. (2003) Characterization of G alpha 13-dependent plasma membrane recruitment of p115RhoGEF. Biochem. J. 371,709-720[CrossRef][Medline]
  21. Penn, R. B., Pascual, R. M., Kim, Y.-M., Mundell, S. J., Krymskaya, V. P., Panettieri, R. A., Jr, Benovic, J. L. (2001) Arrestin specificity for G protein-coupled receptors in human airway smooth muscle. J. Biol. Chem. 276,32648-32656[Abstract/Free Full Text]
  22. Hauck, R. W., Schulz, C., Schomig, A., Hoffman, R. K., Panettieri, R. A., Jr (1999) alpha-Thrombin stimulates contraction of human bronchial rings by activation of protease-activated receptors. Am. J. Physiol. 277,L22-L9[Medline]
  23. Seasholtz, T. M., Majumdar, M., Kaplan, D. D., Brown, J. H. (1999) Rho and Rho kinase mediate thrombin-stimulated vascular smooth muscle cell DNA synthesis and migration. Circ. Res. 84,1186-1193[Abstract/Free Full Text]
  24. Ediger, T. L., Schulte, N. A., Murphy, T. J., Toews, M. L. (2003) Transcription factor activation and mitogenic synergism in airway smooth muscle cells. Eur. Respir. J. 21,759-769[Abstract/Free Full Text]
  25. Lutz, S., Freichel-Blomquist, A., Yang, Y., Rumenapp, U., Jakobs, K. H., Schmidt, M., Wieland, T. (2005) The guanine nucleotide exchange factor p63RhoGEF, a specific link between Gq/11-coupled receptor signaling and RhoA. J. Biol. Chem. 280,11134-11139[Abstract/Free Full Text]
  26. Hirshman, C. A., Emala, C. W. (1999) Actin reorganization in airway smooth muscle cells involves Gq and Gi-2 activation of Rho. Am. J. Physiol. 277,L653-L61[Medline]
  27. Ueda, N., Iniguez-Lluhi, J. A., Lee, E., Smrcka, A. V., Robishaw, J. D., Gilman, A. G. (1994) G protein beta gamma subunits. Simplified purification and properties of novel isoforms. J. Biol. Chem. 269,4388-4395[Abstract/Free Full Text]
  28. Goel, R., Phillips-Mason, P. J., Raben, D. M., Baldassare, J. J. (2002) alpha-Thrombin induces rapid and sustained Akt phosphorylation by beta-arrestin1-dependent and -independent mechanisms, and only the sustained Akt phosphorylation is essential for G1 phase progression. J. Biol. Chem. 277,18640-18648[Abstract/Free Full Text]
  29. Luttrell, L. M., Ferguson, S. S., Daaka, Y., Miller, W. E., Maudsley, S., Della Rocca, G. J., Lin, F., Kawakatsu, H., Owada, K., Luttrell, D. K., et al (1999) Beta-arrestin-dependent formation of beta2 adrenergic receptor-Src protein kinase complexes. Science 283,655-661[Abstract/Free Full Text]
  30. Luttrell, L. M., Della Rocca, G. J., van Biesen, T., Luttrell, D. K., Lefkowitz, R. J. (1997) Gß{gamma} subunits mediate Src-dependent phosphorylation of the epidermal growth factor receptor. A scaffold for G protein-coupled receptor-mediated Ras activation. J. Biol. Chem. 272,4637-4644[Abstract/Free Full Text]
  31. Krymskaya, V. P., Goncharova, E. A., Ammit, A. J., Lim, P. N., Goncharov, D. A., Eszterhas, A., Panettieri, R. A., Jr (2005) Src is necessary and sufficient for human airway smooth muscle cell proliferation and migration. FASEB J 19,428-430[Abstract/Free Full Text]
  32. Panettieri, R. A., Hall, I. P., Maki, C. S., Murray, R. K. (1995) Alpha-thrombin increases cytoslic calcium and induces human airway smooth muscle cell proliferation. Am. J. Respir. Cell Mol. Biol. 13,205-216[Abstract]
  33. Billington, C. K., Penn, R. B. (2003) Signaling and regulation of G protein-coupled receptors in airway smooth muscle. Respir. Res. 4,2[CrossRef][Medline]
  34. Goel, R., Phillips-Mason, P. J., Gardner, A., Raben, D. M., Baldassare, J. J. (2004) Alpha-thrombin-mediated phosphatidylinositol 3-kinase activation through release of Gbetagamma dimers from Galphaq and Galphai2. J. Biol. Chem. 279,6701-6710[Abstract/Free Full Text]
  35. Linseman, D. A., Benjamin, C. W., Jones, D. A. (1995) Convergence of angiotensin II and platelet-derived growth factor receptor signaling cascades in vascular smooth muscle cells. J. Biol. Chem. 270,12563-12568[Abstract/Free Full Text]
  36. Della Rocca, G. J., Maudsley, S., Daaka, Y., Lefkowitz, R. J., Luttrell, L. M. (1999) Pleiotropic coupling of G protein-coupled receptors to the mitogen- activated protein kinase cascade. Role of focal adhesions and receptor tyrosine kinases. J. Biol. Chem. 274,13978-13984[Abstract/Free Full Text]
  37. Herrlich, A., Daub, H., Knebel, A., Herrlich, P., Ullrich, A., Schultz, G., Gudermann, T. (1998) Ligand-independent activation of platelet-derived growth factor receptor is a necessary intermediate in lysophosphatidic, acid- stimulated mitogenic activity in L cells. Proc. Natl. Acad. Sci. USA 95,8985-8990[Abstract/Free Full Text]
  38. Daub, H., Weiss, F. U., Wallasch, C., Ullrich, A. (1996) Role of transactivation of the EGF receptor in signalling by G-protein-coupled receptors. Nature 379,557-560[CrossRef][Medline]
  39. Rakhit, S., Conway, A. M., Tate, R., Bower, T., Pyne, N. J., Pyne, S. (1999) Sphingosine 1-phosphate stimulation of the p42/p44 mitogen-activated protein kinase pathway in airway smooth muscle. Role of endothelial differentiation gene 1, c-Src tyrosine kinase and phosphoinositide 3-kinase. Biochem. J. 338,643-9[CrossRef][Medline]
  40. Conway, A. M., Rakhit, S., Pyne, S., Pyne, N. J. (1999) Platelet-derived-growth-factor stimulation of the p42/p44 mitogen- activated protein kinase pathway in airway smooth muscle: role of pertussis-toxin-sensitive G-proteins, c-Src tyrosine kinases and phosphoinositide 3-kinase. Biochem. J. 337,171-177[CrossRef][Medline]



This article has been cited by other articles:


Home page
 Am. J. Respir. Cell Mol. Bio.Home page
A. M. Misior, D. A. Deshpande, M. J. Loza, R. M. Pascual, J. D. Hipp, and R. B. Penn
Glucocorticoid- and Protein Kinase A-Dependent Transcriptome Regulation in Airway Smooth Muscle
Am. J. Respir. Cell Mol. Biol., July 1, 2009; 41(1): 24 - 39.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
A. M. Misior, H. Yan, R. M. Pascual, D. A. Deshpande, R. A. Panettieri, and R. B. Penn
Mitogenic Effects of Cytokines on Smooth Muscle Are Critically Dependent on Protein Kinase A and Are Unmasked by Steroids and Cyclooxygenase Inhibitors
Mol. Pharmacol., February 1, 2008; 73(2): 566 - 574.
[Abstract] [Full Text] [PDF]

Home page
 Proc Am Thorac SocHome page
R. B. Penn and J. L. Benovic
Regulation of Heterotrimeric G Protein Signaling in Airway Smooth Muscle
Proceedings of the ATS, January 1, 2008; 5(1): 47 - 57.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. Gosens, G. Dueck, E. Rector, R. O. Nunes, W. T. Gerthoffer, H. Unruh, J. Zaagsma, H. Meurs, and A. J. Halayko
Cooperative regulation of GSK-3 by muscarinic and PDGF receptors is associated with airway myocyte proliferation
Am J Physiol Lung Cell Mol Physiol, November 1, 2007; 293(5): L1348 - L1358.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.05-5622fjev1
20/9/1558    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kong, K. C.
Right arrow Articles by Penn, R. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kong, K. C.
Right arrow Articles by Penn, R. B.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS