| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
King’s College London, Cardiovascular Division, London, UK
1Correspondence: King’s College London School of Medicine, New Medical School Bldg., Bessemer Rd., London SE5 9PJ, UK. E-mail: ajay.shah{at}kcl.ac.uk
ABSTRACT
Angiotensin (ANG) II (AngII) and aldosterone contribute to the development of interstitial cardiac fibrosis. We investigated the potential role of a Nox2-containing NADPH oxidase in aldosterone-induced fibrosis and the involvement of this mechanism in AngII-induced effects. Nox2–/– mice were compared with matched wild-type controls (WT). In WT mice, subcutaneous (s.c.) AngII (1.1 mg/kg/day for 2 wk) significantly increased NADPH oxidase activity, interstitial fibrosis (11.5±1.0% vs. 7.2±0.7%; P<0.05), expression of fibronectin, procollagen I, and connective tissue growth factor mRNA, MMP-2 activity, and NF-kB activation. These effects were all inhibited in Nox2–/– hearts. The mineralocorticoid receptor antagonist spironolactone inhibited AngII-induced increases in NADPH oxidase activity and the increase in interstitial fibrosis. In a model of mineralocorticoid-dependent hypertension involving chronic aldosterone infusion (0.2 mg/kg/day) and a 1% Na Cl diet ("ALDO"), WT animals exhibited increased NADPH oxidase activity, pro-fibrotic gene expression, MMP-2 activity, NF-kB activation, and significant interstitial cardiac fibrosis (12.0±1.7% with ALDO vs. 6.3±0.3% without; P<0.05). These effects were inhibited in Nox2–/– ALDO mice (e.g., fibrosis 6.8±0.8% with ALDO vs. 5.8±1.0% without ALDO; P=NS). These results suggest that aldosterone-dependent activation of a Nox2-containing NADPH oxidase contributes to the profibrotic effect of AngII in the heart as well as the fibrosis seen in mineralocorticoid-dependent hypertension.—Johar, S., Cave, A. C., Narayanapanicker, A., Grieve, D. J., Shah, A. M. Aldosterone mediates angiotensin II-induced interstitial cardiac fibrosis via a Nox2-containing NADPH oxidase.
Key Words: oxidative stress • matrix metalloproteinase • mineralocorticoid receptor
INTERSTITIAL CARDIAC FIBROSIS is an important feature of hypertensive heart disease, contributing to increased ventricular stiffness, diastolic dysfunction and arrhythmia (1)
. Although interstitial fibrosis and cardiomyocyte hypertrophy often coexist, they may to a significant extent be independently regulated processes (2)
. The mechanisms underlying cardiac fibroblast proliferation and collagen deposition in vivo remain incompletely understood, but activation of the renin-angiotensin-aldosterone system (RAAS), inflammation, and the effects of mechanical load per se may be involved.
A large body of evidence implicates RAAS activation in the development of cardiac fibrosis (3
4
5
6)
. ANG II (AngII) is a potent pro-fibrotic factor, while the targeting of RAAS activation with ANG converting enzyme [angiotensin 1-converting enzyme (ACE)] inhibitors or AT1 receptor antagonists attenuates hypertensive cardiac fibrosis (7
8
9)
. The underlying mechanisms involved in the pro-fibrotic effects of AngII remain poorly defined. One important mechanism now recognized to be involved in AngII signaling in many cardiovascular diseases including hypertension and atherosclerosis is the activation of NADPH oxidase, intracellular generation of reactive oxygen species (ROS), and subsequent modulation of redox-sensitive signaling pathways (10
, 11)
. We have previously reported that cardiac hypertrophy occurring in response to subpressor AngII infusion is mediated through activation of a Nox2-NADPH oxidase in the heart (12)
, Nox2 being one of at least three NADPH oxidase isoenzymes expressed in the cardiovasculature. An interesting incidental finding in that study was that AngII-induced interstitial fibrosis was also inhibited in mice lacking Nox2 although the mechanisms involved were not addressed.
The mineralocorticoid receptor (MR) agonist aldosterone has important pathophysiological roles in cardiac disease, and recent studies report beneficial effects of MR antagonists on mortality in heart failure patients (13
, 14)
. Aldosterone has potent pro-fibrotic effects in vitro (15
, 16)
and in vivo (3
, 17)
, and can promote oxidative stress (18)
. There may be complex interactions between the effects of AngII and aldosterone in vivo. For example, AngII may stimulate both systemic (19)
and local aldosterone production (20)
, while aldosterone can amplify AngII effects by increasing AT1 receptor density (21)
and ACE activity (22)
. However, the relationship between AngII and aldosterone with regard to NADPH oxidase activation in the heart and the subsequent impact on interstitial cardiac fibrosis is unknown. In the present study, we investigated (a) the potential role of NADPH oxidase in aldosterone-induced interstitial cardiac fibrosis and (b) the involvement of this mechanism in AngII-induced cardiac fibrosis.
MATERIALS AND METHODS
Studies were undertaken on male Nox2–/– mice (12)
on a C57BL6/J background and matched WT littermate controls (WT). AngII (1.1 mg/kg/day) or vehicle were infused s.c. via osmotic minipumps (Alzet Corp., Cupertino, CA) for 2 wk. Some animals were concurrently treated with the MR antagonist spironolactone (200 mg/kg/day in chow) or the antioxidant N-acetylcysteine (5g/l in drinking water) throughout the duration of AngII or vehicle infusion. As a model of mineralocorticoid-dependent hypertension and cardiac fibrosis, mice underwent unilateral nephrectomy under 2.5% isoflurane anesthesia and were then infused with s.c. aldosterone (0.2 mg/kg/day) together with administration of 1.0% NaCl / 0.3% KCl in their drinking water (ALDO group) (3
, 5)
The control groups for ALDO mice also underwent unilateral nephrectomy and were implanted with minipumps infusing vehicle. Blood pressure was measured by tail-cuff plethysmography (12)
. For analyses of cardiac tissue, animals were sacrificed by an overdose of sodium pentobarbitone. Some tissues were frozen in liquid nitrogen and stored at –80°C for further studies. All experiments were performed in accordance with the Guidance on the Operation of Animals (Scientific Procedures) Act, 1986 (UK). All reagents were obtained from Sigma (Gillingham, UK) unless otherwise specified.
Cardiac fibrosis
Frozen sections (8 µM) of left ventricular (LV) tissue were assessed for interstitial cardiac fibrosis by Masson’s trichrome staining (12)
. Image analysis was performed in a blinded fashion by quantifying the blue pixel content with a digital image analyzer (Openlab 3.0.3, Improvision, Coventry, UK), excluding coronary vessels and perivascular regions (12)
.
Real-time-polymerase chain reaction (RT-PCR)
Quantification of mRNA expression of procollagen I 
1 (COL11), fibronectin, transforming growth factor ß1 (TGFß1), connective tissue growth factor (CTGF) and Nox2 was performed using the Applied Biosystems 7000 sequence detection system with SYBR Green. Briefly, RNA was reverse-transcribed from total RNA extracted from LV tissue with the Qiagen RNEasy Fibrous Tissue Kit. MLV reverse transcriptase (Promega, Southhampton, UK) was used for cDNA synthesis. SYBR Green reactions were carried out in 96-well plates to a final vol of 25 µl. All samples were tested in triplicate, and data were expressed in arbitrary units. GADPH mRNA was used for normalization. Results were analyzed by use of the standard curve method. Primer sequences were as follows (all 5'-3'): GAPDH forward primer CGTGCCGCCTGGAGAA, reverse primer CCCTCAGATGCCTGCTTCAC; COL11 forward primer CCTCAGGGTATTGCTGGACAAC, reverse primer TTGATCCAGAAGGACCTTGTTTG; fibronectin forward primer CCGGTGGCTGTCAGTCAGA, reverse primer CCGTTCCCACTGCTGATTTATC; TGFß1 forward primer GACCCTGCCCCTATATTTGGA, reverse primer GCGCCCGGGTTGTGT; CTGF forward primer TGACCCCTGCGACCCACA, reverse primer TACACCGACCCACCGAAGACACAG; Nox2 forward primer ACTCCTTGGGTCAGCACTGG, reverse primer GTTCCTGTCCAGTTGTCTTCG.
NF-kB immunohistochemistry
LV cryosections (8 µm) were fixed in 50% methanol and 50% acetone at –20°C. Endogenous peroxidase activity was blocked by immersion in 0.3% H2O2 and nonspecific binding of primary antibody (Ab) was blocked by incubation with 4% rabbit serum (Vector Laboratories, Peterborough, UK). Sections were incubated with a 1:100 dilution of rabbit polyclonal antibody against the p65 subunit of NF-kB (Chemicon International, Temecula, CA) for 90 min at room temperature. The secondary Ab was coupled to a streptavidin-biotin complex (avidin-biotin complex Elite Kit, Vector Laboratories) and applied to slides. Diaminobenzidine (3,3'-diaminobenzidine) was used to visualize the final reaction product. Slides were subsequently counterstained with eosin. Nonspecific rabbit IgG was used as a negative control.
NADPH oxidase assay
NADPH oxidase assays on total LV protein homogenate (100 µg) were performed in a 96-well plate luminometer (Lucy 1, Rosys Anthos, Wals, Austria) in the presence of NADPH (300 µmol/l) and dark-adapted lucigenin (5 µmol/l), as described (12)
. Chemiluminescence was measured at 37°C for 20 min. All measurements were made in triplicate. Some experiments were performed in the presence of a flavoprotein inhibitor diphenyleneiodonium (DPI, 10 µmol/l), a NOS inhibitor N
-nitro-L-arginine methyl ester hydrochloride (L-NAME, 100 µmol/l), a mitochondrial inhibitor rotenone (20 µmol/l), or a superoxide scavenger Tiron (20 mmol/l).
Gelatin zymography
LV tissue was homogenized in extraction buffer (10 mmol/l cacodylic acid, 0.15 mol/l NaCl, 20 mmol/l ZnCl2, 1.5 mmol/l NaN3, 0.01% Triton X-100, pH 5.0). Gelatin was used as a substrate and added to a standard 7.5% polyacrylamide gel mix to achieve a final concentration of 2 mg/ml. Samples (50 µg) were directly loaded onto gels under nonreducing conditions. After electrophoresis, the gels were agitated twice in 2.5% Triton X-100 for 30 min and incubated for 16h in incubation buffer (0.05 mol/l Tris-HCl, 5 mmol/L CaCl2, 0.05 mol/l NaCl, 0.05% Brij-35, pH 7.6). After incubation, gels were stained in 0.1% Coomassie blue R-250 for 30 min and destained in 10% acetic acid and 40% methanol in water. Bands were visualized as clear areas of lysis against a blue background and quantified by densitometry. Purified MMP-2 and supernatant from 3T3 cell culture were used as positive controls.
Statistics
At least 6 animals per group were studied for each protocol. Values are expressed as mean ± SEM. Data were analyzed by one-way ANOVA for comparisons among multiple groups or by a two-tailed Student’s t test as appropriate. P< 0.05 was considered significant. Student-Newman-Keuls’ test was used for posthoc analysis as appropriate.
RESULTS
Effect of AngII infusion on NADPH oxidase activity and fibrosis
AngII infusion for 2 wk significantly increased systolic blood pressure from 108.0 ± 5.7 mmHg to 167.1 ± 8.3 mmHg in WT mice and caused a similar increase from 113.1 ± 5.5 mmHg to 151.4 ± 5.9 mmHg in Nox2–/– mice (Table 1
). Body weights were similar in WT and Nox2–/– and the increases in blood pressure were associated with similar rises in heart/body wt ratio in both groups (Table 1)
.
|
AngII increased NADPH oxidase activity in WT hearts by 77.2 ± 15.5% (P<0.05; Fig. 1
A). This was associated with a significant increase in the amount of interstitial cardiac fibrosis compared to vehicle-treated animals (from 7.2±0.7% to 11.5±1.0%; P<0.05; Fig. 1B
). In contrast, there was no significant AngII-induced increase in oxidase activity in Nox2–/– hearts (an increase of 8.7±10.3% compared with control, P=NS; Fig. 1A
). The AngII-induced increase in interstitial fibrosis was also completely inhibited in Nox2–/– mice (Fig. 1B
). The increase in NADPH oxidase activity induced by AngII in WT hearts was not associated with a significant increase in Nox2 mRNA expression quantified by RT-PCR (1.0±0.1 arbitrary units in vehicle-treated WT vs. 1.3±0.3 arbitrary units in AngII-infused WT; P=NS; n=6 per group). Figure 2
shows representative sections of hearts from AngII- and vehicle-treated WT and Nox2–/– mice stained with Masson’s trichrome for fibrosis.
|
|
To confirm that the effects of AngII were indeed attributable to ROS generation, additional cohorts of mice (n
6 per group) were treated with N-acetylcysteine concurrent with AngII or vehicle infusion. In N-acetylcysteine-treated mice, the effect of AngII on interstitial cardiac fibrosis was significantly inhibited (7.1±1.0% with N-acetylcysteine vs. 11.5±1.0% without N-acetylcysteine; Fig. 1B
). N-acetylcysteine did not affect either baseline systolic blood pressure (108.6±5.3 mmHg) or the pressor effect of AngII (148.4±8.7 mmHg).
Role of Nox2 in AngII-induced up-regulation of pro-fibrotic genes, MMP activity, and NF-
B activation
To investigate mechanisms by which Nox2 may be involved in driving these changes in interstitial fibrosis, we investigated the expression of pro-fibrotic genes. In keeping with the histological data, expression of COL11 mRNA increased by 3.0 ± 0.7 fold (P<0.05) in AngII-treated WT mice but was not significantly changed in Nox2–/– mice (+1.4±0.3 fold; P=NS; Fig. 1C
). Expression of fibronectin increased by 2.9 ± 0.6 fold (P<0.05) in AngII-treated WT mice but not in Nox2–/– mice (+1.2±0.1-fold; P=NS; Fig. 1D
). The concentration of TGFß1 mRNA was not significantly different after AngII either in WT or Nox2–/– mice (Fig. 1E
). However, CTGF mRNA (a profibrotic factor, which has been implicated in AngII-induced fibrosis in the vasculature (23)
and heart (24)
, was significantly increased by 4.9 ± 1.3 fold (P<0.05) in WT hearts after AngII infusion, whereas no significant increase was found in Nox2–/– hearts (Fig. 1F
).
Matrix metalloproteinases (MMPs) are important in regulating extracellular matrix turnover and their activity can be modulated by AngII (25)
and ROS (26)
. In hearts from AngII-treated WT mice, there was a significant increase in MMP-2 activity (from 0.9±0.1 to 1.4±0.2 arbitrary units [AU]; P<0.05) whereas this was inhibited in Nox2–/– mice (Fig. 3
). We also investigated the activation of NF-kB, a redox-sensitive transcription factor known to be an important regulator of fibrosis (27
28
29
30)
. Immunohistochemistry for the p65 subunit of NF-kB, as a marker for its activation, showed a marked increase in staining in AngII-treated WT hearts compared to vehicle-treated controls (Fig. 4
). In contrast, there was no evidence of NF-B activation in AngII-treated Nox2–/– mice (Fig. 4)
.
|
|
Effects of spironolactone on Nox2 oxidase activation in AngII-treated WT mice
Treatment with the MR antagonist spironolactone did not affect the pressor response to AngII (Table 1)
. The increase in heart/body wt ratio in AngII-infused mice was reduced by 
50% by concurrent therapy with spironolactone (Table 1)
.
During treatment with spironolactone, the AngII-induced increase in myocardial NADPH oxidase activity was inhibited (Fig. 5
A). Spironolactone also inhibited the AngII-induced increase in interstitial cardiac fibrosis (Fig. 5B
). Consistent with this antifibrotic effect, AngII-induced increases in the expression of COL11 and fibronectin were also attenuated (Fig. 5C, D
; cf. Fig. 1C, D
).
|
Role of Nox2 in ALDO-treated mice
The above results suggested that MR activation may contribute to the effects of AngII infusion on myocardial NADPH oxidase. To directly investigate the role of Nox2 in MR-dependent fibrosis, we studied ALDO treatment in WT and Nox2–/– mice. After 4 wk treatment, systolic blood pressure in ALDO mice had increased to a similar extent in WT and Nox2–/– groups (Table 1)
. There were also similar increases in heart/body wt ratio in WT and Nox2–/– ALDO mice (Table 1)
.
Myocardial NAPDH oxidase activity was significantly increased after 2 wk in WT ALDO mice (Fig. 6
A). In contrast, ALDO had no effect on myocardial NAPDH oxidase activity in Nox2–/– mice. Interstitial cardiac fibrosis was also significantly increased by ALDO in WT mice at the 4 wk time point but this effect was inhibited in Nox2–/– mice (Fig. 6B
). Representative heart sections stained for interstitial fibrosis are shown in Fig. 7
. In keeping with these observations, COL11 and fibronectin mRNA levels increased significantly after ALDO in WT mice, whereas no increases were observed in Nox2–/– mice (Fig. 6C, D
). There was a non-significant 2.3 ± 0.8-fold increase in CTGF mRNA in ALDO-infused WT mice.
|
|
Figure 8
shows that NF-B activation, as assessed by immunohistochemistry for the p65 subunit, was markedly increased after ALDO in WT mice whereas no such changes were found in Nox2–/– mice. Consistent with the data in AngII-infused mice, MMP-2 activity assessed by zymography was also significantly increased by ALDO in WT mice, whereas no change was found in the Nox2–/– mice (Fig. 9
).
|
|
DISCUSSION
The mechanisms underlying the development of interstitial cardiac fibrosis in the context of hypertensive heart disease remain incompletely understood. Activation of the RAAS has been found to be involved in many previous studies but the underlying pathways through which it signals increased fibrosis remain unclear. The current study provides significant new information regarding these questions. First, we show that critical events in the interstitial cardiac fibrosis induced by AngII are the Nox2-NADPH oxidase-dependent up-regulation of profibrotic genes, activation of the transcription factor NF-B, and MMP-2 activation. Secondly, we demonstrate that MR activation contributes significantly to AngII-induced myocardial NADPH oxidase activation and interstitial fibrosis in vivo, since these effects are inhibited by the MR antagonist spironolactone. Thirdly, we show that Nox2-NADPH oxidase is also pivotally involved in the development of interstitial cardiac fibrosis and activation of NF-kB and MMP-2 in a model of MR-dependent hypertension in vivo. Taken together, these results suggest a central role for Nox2-NADPH oxidase activation in the cardiac fibrosis that accompanies RAAS activation.
AngII is known to cause cardiac fibrosis in vivo (3
, 5)
and in vitro (31
, 32)
, acting via the AT1 receptor. It has been appreciated for several years that the induction of oxidative stress by AngII may be an important signaling mechanism (33)
. More recently, NADPH oxidase enzymes have been found to be important sources of ROS in the cardiovascular system and AngII has been shown to be a potent activator of these enzymes (12
, 34
35
36
37)
. At least 5 different isoforms of the enzyme (termed Noxs) are described (38)
, of which the main isoforms expressed in the heart are Nox2 and Nox4 (39)
. Our previous studies showed that AngII specifically activates Nox2 in the heart (12
, 39)
. In particular, we reported that cardiac hypertrophy induced by short-term subpressor AngII infusion was inhibited in Nox2–/– mice (12)
. The current data indicate that Nox2 also plays a critical role in AngII-induced cardiac fibrosis. Nox2–/– mice had no evidence of excess interstitial cardiac fibrosis in response to AngII in conjunction with complete failure to increase myocardial NADPH oxidase activity. Furthermore, the pro-fibrotic effects of AngII in WT mice were inhibited by the antioxidant N-acetylcysteine, consistent with a role for ROS in this process. AngII-induced activation of Nox2 oxidase involves posttranslational modification of oxidase regulatory subunits (such as p47phox and rac) but may also be associated with increased expression of Nox2 (10
, 36)
. In the current study, we found no significant increase in Nox2 expression suggesting that posttranslational modifications may be the major mechanism of activation in this setting. An interesting question is to identify the Nox2-expressing cells that are involved in the fibrosis induced by AngII or ALDO. These could include fibroblasts, cardiomyocytes, inflammatory cells, or endothelial cells, all of which express Nox2 (10
, 38)
. The specificity of available antibodies was unfortunately inadequate to provide a clear answer to this question (unpublished data) and other approaches such as the use of tissue-specific gene-modified mice may be a better way of addressing this important point.
We also found in the current study that the activity of MMP-2, a key regulator of extracellular matrix turnover, was increased by AngII in a Nox2-dependent manner. A potential mechanism by which deletion of Nox2 may affect this process is by affecting the translocation of the redox-sensitive transcription factor NF-B, which is known to be implicated in AngII-induced remodeling as well as being involved in the up-regulation of MMP-2 expression and activity (40)
. In keeping with this, we found that there was an increased expression of activated NF-B in the myocardium of WT mice infused with AngII, whereas both NF-B and MMP-2 activation were inhibited in the hearts of Nox2–/– mice. It should be noted that the relationship among NF-B and MMP-2 activation and AngII-induced interstitial fibrosis in this study was circumstantial. Nevertheless, a similar relationship between increased NF-B and MMP-2 activation and increased fibrosis has been reported in other models, such as mice deficient in the natriuretic peptide receptor A (41)
, while it has also been shown that MMP inhibition reduces interstitial fibrosis in a rat model of ischemic cardiomyopathy (42)
.
There can be a complex interplay between aldosterone and AngII in many disease states where RAAS activation is implicated, as discussed previously. The potential interactions between aldosterone and AngII with respect to the pro-oxidative effects of AngII are much less well understood. Recently, it was reported that in cultured rat vascular smooth muscle cells, the acute activation of mitogen activated protein kinases (MAPKs) by AngII was potentiated by aldosterone (43)
. These authors also found that the effects of AngII per se could be partially inhibited by an MR antagonist and that they involved ROS; however, the enzymatic source of the ROS was not identified. In the rat heart, AngII-induced cardiac injury could be attenuated by MR antagonists but the potential role of ROS was not addressed (44)
. Sun et al. (18)
found that aldosterone induced significant oxidative stress in the rat heart and reported that immunohistochemically-assessed Nox2 expression was increased, but interactions between AngII and aldosterone were not addressed in that study nor was direct evidence for an involvement of NADPH oxidase provided. More recently, two studies reported evidence for an aldosterone-induced activation of NADPH oxidase in macrophages (45)
and vascular smooth muscle cells (46)
. Furthermore, in DOCA-salt hypertension, it has been shown that vascular superoxide production and NADPH oxidase activity are increased through a mechanism that may involve increased endothelin-1 generation (47
, 48)
. In the current study, we provide the first evidence that MR activation is involved in AngII-induced myocardial NADPH oxidase activation and subsequent interstitial cardiac fibrosis in vivo. Thus, we found that spironolactone inhibited both the increase in NADPH oxidase activity and the profibrotic effects of AngII in the heart. Furthermore, aldosterone itself caused NADPH oxidase activation and increased interstitial cardiac fibrosis in the ALDO model in the present study, with these effects also being inhibited in Nox2–/– mice. These data, therefore, support a key role for the Nox2-NADPH oxidase in the interstitial cardiac fibrosis induced not only by AngII but also aldosterone. The current results are in line with a recent study reporting that MR antagonists may inhibit AngII-induced NADPH oxidase activity in the vasculature (46)
and suggest that this may be a more general type of interaction between these two hormones. Interestingly, recent studies have reported an essential role for NADPH oxidase also in hepatic (49)
and pulmonary fibrosis (50)
suggesting a relatively widespread role for this enzyme in fibrosis.
It is known that cardiomyocyte hypertrophy and interstitial fibrosis may be independently regulated processes and do not necessarily parallel each other in conditions such as hypertensive heart disease (2)
. Likewise, interstitial cardiac fibrosis is not related in a simple manner to cardiac load (as indexed by blood pressure), especially in situations where there is significant RAAS activation. In keeping with this, the current study found a significant dissociation between interstitial fibrosis, blood pressure and cardiac hypertrophy. We found that AngII induced a similar pressor and hypertrophic response in both WT and Nox2–/– animals whereas fibrosis was inhibited in the latter group. This is in line with previous work from our laboratory and others indicating that the Nox2-NADPH oxidase is critical in the cardiac hypertrophic response to subpressor AngII, but that pressure overload induces hypertrophy even in Nox2–/– mice (12
, 39
, 51)
. Similarly, the inhibition of AngII-induced fibrosis by spironolactone or N-acetylcysteine in the current study was independent of blood pressure. Spironolactone almost completely inhibited fibrosis but only inhibited hypertrophy by 50%. We also found that the elevations in blood pressure and heart/body wt ratio in the ALDO protocol were similar between WT and Nox2–/– animals but that fibrosis was inhibited in the latter group. Furthermore, the pro-fibrotic effect of aldosterone was as marked as that of AngII but the increase in blood pressure with ALDO was much lower. Taken together, these results support a Nox2-mediated regulation of interstitial cardiac fibrosis, which is independent of effects on blood pressure or cardiac hypertrophy. The precise consequences of Nox2-dependent changes in interstitial fibrosis (e.g., alterations in diastolic properties, contractile function or arrhythmia) require further study. It should be noted that not only the total amount of fibrosis but also the structure, cross-linking and arrangement of collagen bundles within the myocardium can have profound consequences for cardiac function. In this regard, it would be of interest in future studies to address these aspects in detail (e.g., with electron microscopic studies).
The findings of the current study could potentially be of relevance to clinical heart disease and its treatment. Recent clinical trials in patients with impaired cardiac function post-MI [the EPHESUS study (14)
] and in chronic heart failure patients [the RALES study (13)
] demonstrated that MR antagonists significantly improved cardiac remodeling and reduced mortality, consistent with an important pathophysiological role for aldosterone in these conditions. The MR antagonist spironolactone was also shown to improve forearm vascular endothelial function in patients with heart failure (52)
, a setting in which previous studies implicated a role for increased oxidative stress (53)
. However, the effects of MR antagonists in clinical hypertensive heart disease have not been addressed in detail. The current data indicate a key role for MR-dependent activation of a Nox2-NADPH oxidase in interstitial cardiac fibrosis induced by either AngII or aldosterone. The Nox2-NADPH oxidase in the heart could potentially represent a useful therapeutic target for modulating interstitial fibrosis.
ACKNOWLEDGMENTS
S.J. was supported by a British Heart Foundation (BHF) Clinical Ph.D. Fellowship. A.M.S. holds the BHF Chair of Cardiology at King’s College London.
Received for publication August 11, 2005. Accepted for publication February 16, 2006.
REFERENCES
B and its proinflammatory mediator cascade in the infarcted rat heart. Biochem. Biophys. Res. Commun. 321,879-885[CrossRef][Medline]This article has been cited by other articles:
|
|
 |
|
  A.C. Montezano, G.E. Callera, A. Yogi, Y. He, R.C. Tostes, G. He, E.L. Schiffrin, and R.M. Touyz Aldosterone and Angiotensin II Synergistically Stimulate Migration in Vascular Smooth Muscle Cells Through c-Src-Regulated Redox-Sensitive RhoA Pathways Arterioscler. Thromb. Vasc. Biol., August 1, 2008; 28(8): 1511 - 1518. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Graf, T. Hucko, and P. Stawowy Cardiac Benefits of Mineralocorticoid Receptor Inhibition in Renal Failure Hypertension, August 1, 2008; 52(2): 209 - 210. [Full Text] [PDF]
|
|
|
|
 |
|
 G. Lastra, A. Whaley-Connell, C. Manrique, J. Habibi, A. A. Gutweiler, L. Appesh, M. R. Hayden, Y. Wei, C. Ferrario, and J. R. Sowers Low-dose spironolactone reduces reactive oxygen species generation and improves insulin-stimulated glucose transport in skeletal muscle in the TG(mRen2)27 rat Am J Physiol Endocrinol Metab, July 1, 2008; 295(1): E110 - E116. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. C. Connell, S. M. MacKenzie, E. M. Freel, R. Fraser, and E. Davies A Lifetime of Aldosterone Excess: Long-Term Consequences of Altered Regulation of Aldosterone Production for Cardiovascular Function Endocr. Rev., April 1, 2008; 29(2): 133 - 154. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. J. Brown Aldosterone and Vascular Inflammation Hypertension, February 1, 2008; 51(2): 161 - 167. [Full Text] [PDF]
|
|
|
|
 |
|
 G.-X. Zhang, X.-M. Lu, S. Kimura, and A. Nishiyama Role of mitochondria in angiotensin II-induced reactive oxygen species and mitogen-activated protein kinase activation Cardiovasc Res, November 1, 2007; 76(2): 204 - 212. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. P. Brandes Avoiding Vicious Circles: Mineralocorticoid Receptor Antagonism Prevents Vascular Oxidative Stress Early After Myocardial Infarction Hypertension, November 1, 2007; 50(5): 842 - 843. [Full Text] [PDF]
|
|
|
|
 |
|
 Y. C. Chan and P. S. Leung Angiotensin II Type 1 Receptor-Dependent Nuclear Factor-{kappa}B Activation-Mediated Proinflammatory Actions in a Rat Model of Obstructive Acute Pancreatitis J. Pharmacol. Exp. Ther., October 1, 2007; 323(1): 10 - 18. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Rickard, J. W. Funder, J. Morgan, P. J. Fuller, and M. J. Young Does Glucocorticoid Receptor Blockade Exacerbate Tissue Damage after Mineralocorticoid/Salt Administration? Endocrinology, October 1, 2007; 148(10): 4829 - 4835. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Cooper, A. Whaley-Connell, J. Habibi, Y. Wei, G. Lastra, C. Manrique, S. Stas, and J. R. Sowers Renin-angiotensin-aldosterone system and oxidative stress in cardiovascular insulin resistance Am J Physiol Heart Circ Physiol, October 1, 2007; 293(4): H2009 - H2023. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Sachse and G. Wolf Angiotensin II Induced Reactive Oxygen Species and the Kidney J. Am. Soc. Nephrol., September 1, 2007; 18(9): 2439 - 2446. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Xu, O. A. Carretero, C.-X. Lin, M. A. Cavasin, E. G. Shesely, J. J. Yang, T. L. Reudelhuber, and X.-P. Yang Role of cardiac overexpression of ANG II in the regulation of cardiac function and remodeling postmyocardial infarction Am J Physiol Heart Circ Physiol, September 1, 2007; 293(3): H1900 - H1907. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Stas, A. Whaley-Connell, J. Habibi, L. Appesh, M. R. Hayden, P. R. Karuparthi, M. Qazi, E. M. Morris, S. A. Cooper, C. D. Link, et al. Mineralocorticoid Receptor Blockade Attenuates Chronic Overexpression of the Renin-Angiotensin-Aldosterone System Stimulation of Reduced Nicotinamide Adenine Dinucleotide Phosphate Oxidase and Cardiac Remodeling Endocrinology, August 1, 2007; 148(8): 3773 - 3780. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Seddon, Y. H Looi, and A. M Shah Oxidative stress and redox signalling in cardiac hypertrophy and heart failure Heart, August 1, 2007; 93(8): 903 - 907. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wang, J. Zhang, L.-Q. Jiang, G. Spinetti, G. Pintus, R. Monticone, F. D. Kolodgie, R. Virmani, and E. G. Lakatta Proinflammatory Profile Within the Grossly Normal Aged Human Aortic Wall Hypertension, July 1, 2007; 50(1): 219 - 227. [Abstract] [Full Text] [PDF]
|
|
