FASEB J. Pierce now sold as Thermo Scientific
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moon, S.-K.
Right arrow Articles by Kim, C.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moon, S.-K.
Right arrow Articles by Kim, C.-H.
(The FASEB Journal. 2006;20:1387-1395.)
© 2006 FASEB

Reactive oxygen species mediates disialoganglioside GD3-induced inhibition of ERK1/2 and matrix metalloproteinase-9 expression in vascular smooth muscle cells

Sung-Kwon Moon1, Sung-Koo Kang and Cheorl-Ho Kim2

Molecular and Cellular Glycobiology Unit, Department of Biological Sciences, SungKyunKwan University, Jangan-Gu, Suwon City, Kyunggi-Do, Korea

2Correspondence: Molecular and Cellular Glycobiology Unit, Department of Biological Science, Sungkyunkwan University, Chunchun-Dong 300, Jangan-Gu, Suwon City, Kyunggi-Do 440–746, Korea. E-mail: chkimbio{at}daum.net


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Sialic acid containing glycosphingolipids (gangliosides) are thought to play important roles in the function of various biological phenomena such as atherosclerosis. We have previously shown that the overexpression of the disialoganglioside (GD3) synthase gene effectively suppresses cell proliferation, cell cycle progression, and MMP-9 expression in vascular smooth muscle cells (VSMC). However, the issue of how the overexpression of GD3 synthase gene results in the inhibition of cellular responses in VSMC remains unclear. The findings herein demonstrate that overexpression of the GD3 synthase gene suppresses VSMC responses through the generation of reactive oxygen species (ROS). Superoxide and hydrogen peroxide were generated at increased levels in GD3 synthase gene transfectants in comparison with empty vector (EV) -transfected VSMC. This phenomenon was blocked by antioxidants such as N-acetyl-L-cysteine (NAC) and pyrrolidine dithiocarbamate (PDTC). Increased ROS generation was associated with a decreased endogenous antioxidant activity, increased lipid peroxidation, and mitochondrial DNA damage. Further studies revealed that the blockade of ROS function with antioxidants reversed the effect of GD3 synthase gene overexpression on VSMC proliferation and cell cycle regulation in response to platelet-derived growth factor (PDGF). In addition, we found that treatment with antioxidants reversed the decreased matrix metalloproteinase-9 (MMP-9) expression in response to TNF-{alpha} as determined by zymography and immunoblot in GD3 synthase gene transfectants. This recovery effect was characterized by the up-regulation of MMP-9 promoter activity, which was transcriptionally regulated at NF-{kappa}B and activation protein-1 (activating protein (AP) -1) sites in the MMP-9 promoter. These findings suggest that ROS may play a role in GD3 synthase gene-mediated VSMC phenotypic changes that may contribute to plaque instability in atherosclerosis.—Moon, S.-K., Kang, S.-K., Kim, C.-H. Reactive oxygen species mediates disialoganglioside GD3-induced inhibition of ERK1/2 and matrix metalloproteinase-9 expression in vascular smooth muscle cells.


Key Words: atherosclerosis • GD3 synthase gene • PDTC • NAC • cell cycle


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
THE PROLIFERATION OF VASCULAR smooth muscle cells (VSMC) is a key event in the development of advanced lesions that are associated with atherosclerosis (1) . The abnormal growth of VSMC also plays an important role in vascular diseases, including atherosclerosis and restenosis after angioplasty (1) . In advanced atherosclerotic lesions, VSMC are prone to apoptosis and release proteolytic enzymes such as matrix metalloproteinases (MMP), which may contribute to plaque instability. It is widely believed that PDGF stimulates the proliferation of vascular smooth muscle cells (2 ,3) . PDGF induces the activation of extracellular signal-regulated kinase 1/2 (ERK1/2), a key transducer of extracellular signals that promote cell growth and movement, and which are critical for the initiation and progression of vascular lesions (4 , 5) . In VSMC, transit through G1 of the cell cycle and entry into the S phase requires the binding and activation of cyclin/CDK complexes, a process in which cyclin D1/CDK4 and cyclin E/CDK2 play major roles (6 , 7) . In addition, on the basis of in-depth reports from several laboratories, it has been concluded that the basal levels of MMP-9 are usually low and that its expression can be induced by treatment of vascular smooth muscle cells with tumor necrosis factor {alpha} (TNF-{alpha}) (8 9 10) . Recent results have demonstrated that ERK1/2 mediates TNF-{alpha}-induced matrix metalloproteinase-9 expression in vascular smooth muscle cells via the regulation of NF-{kappa}B and AP-1 (9 ,11) .

Reactive oxygen species (ROS) are key components for the integration of VSMC signaling events. ROS are usually generated in response to diverse external stimuli, such as TNF-{alpha}, TGF-ß, PDGF, epidermal growth factor (EGF) (12) , and lipid second messengers, e.g., lysophosphadic acid (13) and lactosylceramide (14) . At low concentrations ROS may play the role of potent stimuli for the activation of VSMC signaling and mitogenesis (15) . However, by the generation of large amounts (beyond physiological) of ROS, they may induce increased lipid peroxidation, DNA damage, and mitochondrial dysfunction (16 , 17) . ROS represents the species that are thought to be important in atherosclerosis, and include superoxide (O2–), hydrogen peroxide (H2O2), and hydroxyl radicals (heme oxygenase–). Superoxides are the early molecular species of ROS generated as a consequence of the interaction of cells with external stimuli that are, in turn, converted to hydrogen peroxide by superoxide dismutase (SOD). H2O2, while relatively inactive, can be reduced to the highly reactive hydroxyl radical (OH·) by a metal ion through the Fenton reaction (18 , 19) .

Gangliosides are a subfamily of glycosphingolipids (GSLs) that are distinguished by the presence of several sialic acid residues. Gangliosides and GSLs participate in the regulation of various cellular functions, including cell growth, differentiation, adhesion, and modulators of signal transduction (20 21 22) . Glycosphingolipids have emerged as cell death effectors because of their role in apoptosis signaling (23) . Disialoganglioside GD3 has been specifically identified as a lipid death effector due to its ability to interact and recruit mitochondria to apoptotic pathways (24 25 26 27 28) . The study provided evidence to show that GD3 mediates the FAS- and ceramide-induced apoptosis of lymphoid and myeloid tumor cells (29 , 30) . In the past few years, increased levels of GD3 have been found to be associated with proliferative diseases, such as atherosclerosis (31 , 32) . A recent study suggested that exogenously supplied GD3 has a dual role in modulating VSMC proliferation and apoptosis (33) . Results from our group demonstrated that overexpression of the GD3 synthase gene effectively suppresses cell proliferation, cell cycle progression, and MMP-9 expression in VSMC (34) .

However, the issue of how GD3 synthase gene overexpression results in the inhibition of cell proliferation, cell cycle progression and MMP-9 expression on VSMC remains unclear. Data from this investigation suggest that the GD3 synthase gene represents a physiological modulator of VSMC responses that may contribute to plaque instability in atherosclerosis.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Materials
PDGF-BB and TNF-{alpha} was obtained from R&D Systems (Minneapolis, MN, USA). Polyclonal antibodies to cyclin E and CDK2, were obtained from New England Biolabs (Beverly, MA, USA). The polyclonal MMP-9 antibody (Ab) was obtained from Chemicon (Temecula, CA, USA).

Cell cultures and [3H]thymidine incorporation
Mouse aortic smooth muscle cells were obtained from young (4-month-old) male rat aortas by enzymatic digestion, as described previously in detail (17) . Cells were grown in Dulbecco’s modified eagle’s medium (DMEM), Gibco BRL, San Diego, CA, USA) supplemented with 10% (v/v) heat-inactivated FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin. Cells at 80% to 90% confluence were made quiescent by incubation for 72 h in DMEM containing 0.1% FBS. For [3H]thymidine-uptake experiments, SMC cells were incubated for an additional 24 h and labeled with [methyl-3H]thymidine (New England Nuclear) at 1 µCi/ml during the last 24 h of this period. The incorporated [3H]thymidine was extracted with 0.2 M NaOH and measured by liquid scintillation counter as described previously (17 , 33) .

Plasmid construction and cell transfection
To obtain the full-length cDNA of GD3 synthase, first-strand cDNA synthesis was performed with a SuperScriptTM preamplification kit (Gibco BRL, Life Technologies) according to the manufacturer’s instructions, using 5 µg of total RNA from human adult brains (Clontech, PaloAlto, CA, USA). The full-length cDNA was obtained by polymerase chain reaction (PCR), with first-strand cDNA as a template using a 5' primer containing a HindIII site, 5'-CTAAGCTTATGGCTGTACTG GCGTGGAAGTTCCCGCGG-3' and a 3' primer containing a XhoI site, 5'-ATCTCGAG TCCTAGGAAGTGGGCTGGAGTGAGGTATCTTC-3'. PCR was performed as follows: 94°C for 60 s, 35 cycle of 94°C for 60 s, 55°C for 40 s, 72°C for 90 s, and 72°C for 10 min. The PCR product (1.1 kb) was cloned into pT7Blue(R) T-vector (Novagen, Inc., Madison, WI, USA) and determined by DNA sequencing. The inserted fragment (1.1 kb) was cut out by digestion with HindIII and XhoI, then inserted into the corresponding sites of pcDNA3 (Clonetech), which was designated pcDNA3-GD3. VSMC were transfected with pcDNA3-GD3 or pcDNA3 (no insert) in 100 mM dishes using the Superfect reagent (Qiagen, Valencia, CA, USA). The resulting colonies were selected based on their resistance to G418. The expression of GD3 synthase was confirmed by RT-polymerase chain reaction and immunoblot analysis using a monoclonal antibody against GD3 (Sigma, St. Louis, MO, USA).

RT-PCR
Two micrograms of total RNA from each sample were treated with DNase I (Promega, Madison, WI, USA), reverse-transcribed using Superscript reverse transcriptase (Promega), and the PCR-amplified quantitatively for GD3 synthase gene expression with a Taqman Sequence Detection Assay (PE Biosystems, Foster City, CA, USA). In this assay, we used primers (5'-GAGCATGTGGTATGACGGGGA-3' and 5'-CCTCAAAGATGGCTCTGTTCCTGT-3') to detect the specific GD3 synthase gene PCR product as it accumulates during PCR at an annealing temperature of 60°C. Similarly, the same RNA samples were PCR-amplified for ß-actin, and GD3 synthase gene expression was normalized to ß-actin.

Measurement of superoxide production in intact cells
Lucigenin, an acridylium compound (Sigma) that emits light on reduction and interaction with O2–, was used to measure the level of O2– production (34) . Cultured VSMC were harvested and the superoxide in intact cell suspensions was determined as described previously using dark-adapted lucigenin (500 µM) in a balanced salt solution (34) . The viability of the suspended cells as determined by the trypan blue exclusion principle was >90%. Ganglioside solutions (dissolved in Me2SO) were added to the cells to achieve a final concentration of Me2SO that was equal to 0.01%. Moreover, the vehicle (0.01% Me2SO) served as a control in most experiments.

Intracellular generation of H2O2. and SOD activity
The fluorogenic substrate 2',7'-DCF diacetate (DCFDA, Molecular Probes; Eugene, OR, USA) is a cell-permeable dye that is oxidized to 2',7'-DCF by H2O2 and can therefore be used to monitor the intracellular generation of H2O2 (17) . The medium for SMC grown in 96-well plates was replaced with Hanks’ solution containing 10 µM DCFDA for 30 min. The generation of H2O2 was measured using a CytoFlor fluorescence plate reader (485–530 nm, PerSeptive Biosystems; Foster City, CA, USA) (17) . Cells in each well were counted using a Coulter Counter, and H2O2 release was normalized to cells per well in each experiment. Total and SOD2 activity were determined by the inhibition of xanthine/xanthine oxidase-induced cytochrome c reduction, as described previously (17) . To determine SOD2 activity, lysates were treated with 5 mM KCN to inactivate SOD1 before performing assays.

GSH concentrations and lipid peroxidation assay
GSH levels were measured according to manufacturer’s instructions (Calbiochem, San Diego, CA, USA). Cayman’s GSH assay kit utilizes a carefully optimized enzymatic recycling method, using GSH reductase, for the quantification of GSH. The sulfhydryl group of GSH reacts with DTNB (5,5'-dithiobis-2-nitrobenzoic acid, Ellman’s reagent) and produces a yellow-colored 5-thio-2-nitrobenzoic acid (TNB). The mixed disulfide, GSTNB (between GSH and TNB), that is concomitantly produced is reduced by GSH reductase to recycle the GSH and produce more TNB. The rate of TNB production is directly proportional to this recycling reaction, which in turn is directly proportional to the concentration of GSH in the sample. GSH concentrations were determined from appropriately treated cell lysates based on their absorbance at 400 nm, in comparison with a GSH standard curve. For analysis of GSSG concentration, the supernatant was derivatized with 2-vinylpyridine before analysis. Malondialdehyde (MDA) is an end product derived from the peroxidation of polyunsaturated fatty acids and related esters, which is converted to a chromophore when treated with N-methyl-2-phenylindole (17) using a lipid peroxidation assay kit (Calbiochem).

Quantitative PCR assay for mitochondrial DNA damage
Detection of DNA damage by quantitative PCR relies on the premise that any DNA template containing an oxidative lesion (such as strand breaks, base modifications, and/or apurinic sites) will arrest a thermostable polymerase (18) . The DNA extraction and PCR conditions were performed as described previously (16) by using primers designed to amplify the entire mouse mitochondrial genome. Amplifications were corrected for mitochondrial copy number by simultaneously amplifying an 80-bp mitochondrial fragment, as well as by DNA slot-blot analysis. The reagent conditions for the mouse QPCR for the 16,059-bp mitochondrial DNA product (primers used: sense5'CCCAGCTACTACCATCATTCAAGTAG-3'; antisense 5'-GAGAGATTTTATGGGTGTAATGCGGTG-3') and the 80-bp fragment (primers used: sense 5'-GCAAATCCATATTCATCCTTCTCAAC-3', antisense 5'-GAGAGATTTTATGGGTGTAATGCGGTG-3') were 1x XL buffer II (Perkin-Elmer-Cetus, Norwalk, CT, USA), 1.1 mM Mg(OAc)2, 0.1 mg/ml BSA, 0.6 µM primers, and 2 µCi [32P]dATP. Each QPCR was initiated with a 75°C hot start addition of 1 U of rTth polymerase (Perkin-Elmer-Cetus). The PCR consisted of 24 cycles of 94°C for 15 s and 67°C for 12 min for the large fragment and 18 cycles of 94°C for 15 s and 65°C for 1 min for the short fragment.

Immunoblotting, immunoprecipitation, and immune complex kinase assays
Growth-arrested VSMCs were treated with 10% FBS for the specified periods at 37°C, and immonoblotting was performed as described previously (17 ,33) . Cell lysates were prepared with ice-cold lysis buffer (containing, in mM/l, HEPES [pH 7.5] 50, NaCl 150, EDTA 1, EGTA 2.5, DTT 1, ß-glycerophosphate 10, NaF 1, Na3VO4 0.1, and phenylmethylsulfonyl fluoride 0.1 and 10% glycerol, 0.1% Tween-20, 10 µg/ml of leupeptin, and 2 µg /ml of aprotinin) and sonicated at 4°C (microultrasonic cell disrupter from KONTES, Vineland, NJ, USA; 30% power, twice for 10 s each time). Lysates were clarified by centrifugation at 10,000 g for 5 min, and the supernatants were precipitated by treatment with protein A-Sepharose beads precoated with saturated amounts of the indicated antibodies at 4°C for 2 h. When monoclonal antibodies were used, protein A-Sepharose was pretreated with rabbit antimouse immunoglobulin G (Jackson ImmunoResearch Laboratories, West Grove, PA, USA). The immunoprecipitated proteins on the beads were washed 4 times with 1 ml of lysis buffer and twice with a kinase buffer (containing, in mM/l, HEPES 50, MgCl2 10, DTT 1, ß-glycerophosphate 10, NaF 1, and sodium orthovanadate 0.1). The final pellet was resuspended in 25 µl of kinase buffer containing 5 µg of histone H1 (Life Technologies, Inc., Carlsbad, CA, USA), 20 µM/l ATP, and 5 µCi of [{gamma}32P]ATP (4500 µCi/mmol; ICN, Plainview, NY, USA) and incubated for 20 min at 30°C with occasional mixing. The migration of histone H1 or glutathione S-transferase (GST)-pRb was determined by Coomassie blue staining. Phosphorylated pRb and histone H1 were visualized.

Zymography
Conditioned medium and cell lysates were electrophoresed in a polyacrylamide gel containing 1 mg/ml of gelatin. Proteolysis was detected as a white zone in a dark blue field, as described previously (33) .

MMP-9 promoter activity
A 0.7 kb segment at the 5'-flanking region of the human MMP-9 gene was amplified by PCR using specific primers from the human MMP-9 gene (accession no. D10051):5'-ACATTTGCCCGAGCTCCTGAAG (forward/SacI) and 5'AGGGGCTGCCAGAAGCTTATGGT (reverse/HindIII). The pGL2-Basic vector containing a polyadenylation signal upstream from the luciferase gene was used to construct expression vectors by subcloning PCR-amplified DNA of MMP-9 promoter into the SacI/HindIII site of the pGL2-Basic vector. The MMP-9 promoter luciferase was tested for luciferase activity using the luciferase assay system (Promega). Firefly luciferase activities were standardized for ß-galactosidase activity.

Nuclear extracts and electrophoretic mobility shift assay (EMSA)
Nuclear extracts were prepared essentially as described previously (9 , 11 , 33) . The nuclear extract (2 µg) was preincubated at 4°C for 30 min with a 100-fold excess of an unlabeled oligonucleotide spanning the –79 MMP-9 cis element of interest. The sequences were as follows: AP-1, CTGACCCCTGAGTCAGCACTT; NF-{kappa}B, CAGTGGAATTCCCCAGCC. After this time, the reaction mixture was incubated at 4°C for 20 min in a buffer (25 mM HEPES buffer pH 7.9, 0.5 mM EDTA, 0.5 mM DTT, 0.05 M NaCl and 2.5% glycerol) with 2 µg of poly dI/dC and 5 fmol (2x104 cpm) of a Klenow end-labeled (32P-ATP) 30-mer oligonucleotide, which spans the DNA binding site in the MMP-9 promoter. The reaction mixture was electrophoresed at 4°C in a 6% polyacrylamide gel using a TBE (89 mM Tris, 89 mM boric acid and 1 mM EDTA) running buffer. The gel was rinsed with water, dried and exposed to X-ray film overnight.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Effect of ganglioside GD3 on ROS generation
To explore the effects of GD3 synthase gene overexpression on ROS generation, assays were conducted for superoxide and hydrogen peroxide production. GD3 overexpression stimulated the level of superoxide generation by ~3-fold as compared with both parental and EV-transfected VSMC after a 24 h culture (Table 1 ). To determine whether GD3 synthase gene overexpression stimulates intracellular H2O2 production, cells were next incubated with DCF-DA, a peroxide-sensitive dye that is incorporated into the cells. GD3 caused a 1.8-fold increase in DCF-DA fluorescence compared with that for both parental and EV-transfected VSMC. The preincubation of cells with the antioxidants PDTC and NAC completely abrogated GD3-induced superoxide and hydrogen peroxide generation (Table 1) .


View this table:
[in this window]
[in a new window]
  		Table 1. Changes in SOD activity, GSH, GSSG, malondialdehyde, mitochondrial DNA damage, superoxide, and hydrogen peroxide production and in GD3 synthase gene transfectantsa

Impaired antioxidant defenses in GD3 synthase transfectant cells
The GD3-associated differences in ROS generation in VSMC might result in the preferential accumulation of oxidative damage in GD3 synthase transfectant cells, an effect that would be amplified if antioxidant defenses were unable to compensate. We therefore measured the activity of ROS scavenging systems in VSMC. SOD1 and SOD2 protein levels were decreased in comparison with both parental and EV-transfected VSMC (Fig. 1 ). Total SOD activity, as measured by the inhibition of xanthine oxidase-induced ROS generation, was decreased by 50% in GD3 synthase transfectant cells (Table 1) . The reduction in activity of SOD2 (manganese SOD), the mitochondrial isoform of SOD, was also decreased by 53% in these cells (Table 1) , demonstrating that this system does not compensate in response to acute elevations in ROS generation.


Figure 1
View larger version (9K):
[in this window]
[in a new window]
  		Figure 1. Western blot analysis of SOD in GD3 synthase gene transfectants. Western blot analysis was performed with antibodies specific for coppper/zinc-dependent SOD (SOD1; left) and manganese SOD (SOD2; right). Results from a representative experiment involving the SOD2 protein were normalized to GAPDH expression.

Glutathione (GSH) serves as an additional means to buffer intracellularly generated ROS (35) . GSH can accept electrons from peroxides and hydroxyl radicals derived from superoxide and, in the process, is converted to its oxidized disulfide form GSSG. We measured the concentration of GSH and GSSG as indexes of the activity of this protective pathway. Both GSH and GSSG concentrations were markedly decreased in GD3 synthase transfectant cells (Table 1) , indicating a global reduction in GSH levels associated with ganglioside GD3.

Overexpression of GD3 synthase gene induces lipid peroxidation and mitochondrial DNA damage
Our observation of GD3-associated changes in ROS production and antioxidant defenses in GD3 synthase transfectant cells led us to consider whether, in GD3 synthase transfectant cells, oxidative damage might accumulate at a greater rate than both parental and EV-transfected VSMC. To test this hypothesis, we measured different cellular indexes of oxidative damage. Intracellular MDA was measured as a marker of peroxidative damage to membrane lipids based on the putative role of lipid peroxidation products in atherogenesis (36) . MDA levels were increased 1.8-fold in GD3 synthase transfectant cells compared with those from both parental and EV-transfected VSMC (Table 1) .

Using a sensitive PCR-based assay, previous reports demonstrated that ROS-induced mitochondrial DNA damage is correlated with cellular dysfunction in VSMC (16) , and have shown that mitochondrial DNA damage precedes and probably accelerates atherogenesis in a mouse model of atherosclerosis (37) . We used this PCR-based assay, which relies on the inhibition of polymerase activity by oxidatively modified DNA, to measure the amount of mitochondrial DNA damage in parental, EV-transfected cells and GD3 synthase transfectant cells. Mitochondrial DNA amplification was decreased by 34% in GD3 synthase transfectant cells (Table 1) , demonstrating the increased mitochondrial DNA damage incurred by ganglioside GD3.

Effects of antioxidants on decreased cell proliferation in GD3 synthase transfectant cells
We previously reported that overexpression of the GD3 synthase gene inhibited PDGF-mediated DNA synthesis, ERK1/2 phosphorylation and cell cycle associated proteins, cyclin E and CDK2 (34) . Because our data showed that ROS generation may play important roles in GD3 synthase gene transfectants (Table 1 and Fig. 1 ), we hypothesized that the suppressed VSMC proliferation may be related to concomitant production of ROS. To test this, the effects of antioxidants on cell proliferation were then examined by adding the antioxidants, PDTC or NAC, to GD3 transfectants in a culture medium. The suppressed cell proliferation after GD3 synthase gene transfection was strongly reversed in the presence of both antioxidants (Fig. 2 A). The phosphorylation levels of ERK1/2 were also reversed after the addition of antioxidants for 24 h (Fig. 2B ). In the EV transfectants, the addition of antioxidants reduced cell proliferation and ERK1/2 phosphorylation following PDGF treatment (Fig. 2A,B ). The blockade of ROS with antioxidants consistently reversed the suppressed cell cycle-associated proteins, including cyclin E and CDK2, in GD3 synthase transfectants (Fig. 3 A, B). These results suggest that ROS plays important roles in suppressed VSMC proliferation in GD3 synthase gene transfectants.


Figure 2
View larger version (19K):
[in this window]
[in a new window]
  		Figure 2. Reversal of decreased cell proliferation by antioxidants. A) The indicated cell lines were incubated in serum free medium for 24 h, treated with or without PDGF (10 ng/ml) in the presence or absence of antioxidants, NAC (10 mM) and PDTC (10 µM) for 24 h, and labeled with [methyl-3H] thymidine during the last 24 h of this period. Thymidine incorporation was assessed by scintillation counting of the precipitated DNA. Similar results were observed in 3 independent experiments. B) Cell lysates from the indicated cell lines were examined by immunoblot analysis with antiphospho ERK1/2 Ab. The results were normalized to anti-ERK1/2 Ab expression.


Figure 3
View larger version (16K):
[in this window]
[in a new window]
  		Figure 3. Effects of antioxidants on G1 cell cycle-associated proteins in GD3 synthase gene transfectants. A) Cell lysates from the indicated cell lines were stimulated with PDGF (10 ng/ml) in the presence or absence of NAC (10 mM) and PDTC (10 µM), and an immunoblot analysis was performed with antibodies specific for cyclin E and CDK2. The results were normalized to GAPDH expression. B) The cell lines were stimulated with PDGF (10 ng/ml) for 24 h in the presence or absence of NAC (10 mM) and PDTC (10 µM), then harvested. Total cell lysates were then immunoprecipitated with anti-CDK2 Ab. The kinase reaction was performed using histone H1 as substrate.

Effects of antioxidants on suppressed TNF-{alpha}-induced MMP-9 expression in GD3 synthase transfectant cells
Our earlier results demonstrated that GD3 overexpression inhibited TNF-{alpha}-induced MMP-9 expression (34) and that ROS are important in the repression of VSMC proliferation in GD3 synthase transfectant cells (Table 1 , Figs. 2 , 3 ). We therefore investigated the role of ROS in TNF-{alpha}-induced MMP-9 expression in GD3 synthase transfectant cells. The cells were stimulated with TNF-{alpha} in the absence or presence of PDTC or NAC, as described above, and conditioned media were collected after 24 h for gelatin zymography. Treatment of the cells with PDTC or NAC significantly reversed the suppressed TNF-{alpha}-stimulated MMP-9 induction in GD3 synthase transfectant cells (Fig. 4 A). In EV transfectants, the addition of antioxidants decreased TNF-{alpha}-stimulated MMP-9 induction (Fig. 4A ). Similar results were found in cell lysates and by immunoblot analysis (Fig. 4A ). These results suggest that ROS plays an important role in repressed TNF-{alpha}-stimulated MMP-9 induction in GD3 synthase transfectant cells.


Figure 4
View larger version (24K):
[in this window]
[in a new window]
  		Figure 4. Effects of antioxidants on TNF-{alpha}-induced MMP-9 expression in GD3 synthase gene transfectants. A) Vector control cells (EV) and cells stably expressing GD3 synthase gene (GD3) were grown to 70% confluence in DMEM supplemented with 10% FBS and the medium was changed to serum-free medium. Each cell line was stimulated with TNF-{alpha} (100 ng/ml) in the presence or absence of NAC (10 mM) and PDTC (10 µM), and the culture supernatants and cell lysates were the analyzed zymographically for the MMP activities. Similarly, an immunoblot analysis was performed with antibodies specific for MMP-9. The results were normalized to GAPDH expression. B) Vector control cells (EV) and cells stably expressing GD3 synthase gene (GD3) were transiently transfected with MMP-9-pGL2, which contains 710 bp of 5'-promoter of the MMP-9 gene and then cultured with TNF-{alpha} (100 ng/ml) in the presence or absence of NAC (10 mM) and PDTC (10 µM), and luciferase activity was determined after 24 h as described in Materials and Methods. The results from representative experiments were normalized to ß-galactosidase activity.

Antioxidants reversed suppressed TNF-{alpha}-induced MMP-9 promoter activity by increasing the NF-{kappa}B and AP-1 binding activities in GD3 synthase transfectant cells
Finally, to determine whether antioxidants restore the inhibitory effect of GD3 on TNF-{alpha}-stimulated MMP-9 induction, EV transfectants and GD3 synthase transfectant cells were treated with antioxidants. Treatment of GD3 synthase transfectant cells with antioxidants rescued the suppressed TNF-{alpha}-stimulated MMP-9 activity (Fig. 4B ). However, EV transfectant cells, when treated with antioxidants, showed a decreased TNF-{alpha}-stimulated MMP-9 activity (Fig. 4B ). Our previous studies showed that TNF-{alpha} induces MMP-9 expression through the NF-{kappa}B and AP-1 cis-elements in VSMC (9 ,11 ,34) . To determine whether the reversed effect of antioxidants on suppressed MMP-9 expression in GD3 synthase transfectant cells was mediated through these two types of motifs, EMSA was performed with the nuclear extracts of EV transfectant and GD3 transfectant cells after treatment with TNF-{alpha}. In EMSA, the nuclear extracts were incubated with a radiolabeled double-strand oligonucleotide probe with the consensus sequence for NF-{kappa}B and the AP-1 biding site, respectively, and electrophoresed in a 5% nondenaturing polyacrylamide gel. An oligonucleotide derived from the MMP-9 promoter sequence spanning this motif was specifically bound with NF derived from the treatment of TNF-{alpha} with EV transfectants (Fig. 5 A, B). Nuclear extracts from EV transfectants treated with TNF-{alpha} showed an increased binding to the NF-{kappa}B and AP-1 motifs (Fig. 5A, B ). These increased NF-{kappa}B and AP-1 binding activities were effectively suppressed in EV transfectants after treatment with antioxidants (Fig. 6 A, B). Moreover, the introduction of a GD3 synthase gene showed decreased effects on NF-{kappa}B and AP-1 binding activities (Fig. 5A, B ). The antioxidant treatment had the reverse effect on the decreased NF-{kappa}B and AP-1 binding activities in GD3 synthase transfectants. These data suggest that ROS mediates the suppressed MMP-9 expression in GD3 synthase transfectants, at least in part, by decreasing the DNA binding of transcription factors NF-{kappa}B and AP-1.


Figure 5
View larger version (23K):
[in this window]
[in a new window]
  		Figure 5. Effects of antioxidants on NF-{kappa}B and AP-1 binding activities in the TNF-{alpha}-mediated stimulation of MMP-9 expression. After serum starvation, the indicated cell lines were incubated with TNF-{alpha} (100 ng/ml) for 24 h in the presence or absence of NAC (10 mM) and PDTC (10 µM). After incubation, nuclear extracts from the cells were analyzed by EMSA for activated NF-{kappa}B and AP-1 using radiolabeled oligonucleotide probes, respectively.


Figure 6
View larger version (36K):
[in this window]
[in a new window]
  		Figure 6. Schematic diagram illustrating molecular mechanism of GD3-mediated apoptotic signaling pathway in VSMC phenotypic changes. The disialoganglioside GD3 synthase gene suppresses VSMC responses through the generation of ROS. GD3 increases superoxide and hydrogen peroxide levels by reducing the antioxidant defense system in VSMC. GD3 also increases levels of the lipid peroxidation product MDA and the amounts of mitochondrial DNA damage. Finally, ROS mediates GD3-induced suppressed cell proliferation, cell cycle progress, and MMP-9 expression in VSMC, and treatment with antioxidants reversed the decreased MMP-9 expression in response to TNF-{alpha}. ROS mediates GD3-mediated MMP-9 inhibition in coordination with their regulation of transcriptional MMP-9 promoter activity and transcription factors NF-{kappa}B and AP-1 binding activity. Therefore, ROS plays a key role in GD3 synthase-mediated VSMC phenotypic changes that contribute to plaque instability in atherosclerosis.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Glycosphingolipids are characteristic components of plasma membranes, which have been considered to be mainly structural lipids. However, glycosphingoliphids have increasingly been recognized as signaling intermediates involved in the regulation of multiple cellular functions: cell proliferation, differentiation, and apoptosis (20 21 22) . GD3 is a disialoganglioside that is enriched in human aortic smooth muscle cells. In previous studies, several groups have reported an accumulation of gangliosides in atherosclerosis vessels (31 , 32) . It has been shown that the addition of exogenous gangliosides to a culture medium inhibits cellular growth via the suppression of tyrosine phosphorylation of several growth factor receptors (20 , 38) . In particular, gangliosides, GM1, GM2, and GM3 inhibit the tyrosine phosphorylation of the PDGF ß-receptor as well as of other early intracellular events, which leads to a reduction in the proliferative effects of PDGF-BB in VSMC (39) . On the other hand, studies suggest that GM1 and GM2 induce VSMC proliferation via the ERK1/2 pathway (40) . Studies from several laboratories have shown that GD3 is able to induce cell proliferation as well as apoptosis (33 , 34) . A recent study by our group showed that GD3 synthase gene overexpression effectively suppresses cell proliferation, cell cycle progression, and MMP-9 expression in VSMC (34) . However, the issue of how the overexpression of the GD3 synthase gene results in the suppressed VSMC responses is unclear. In the present study we attempted to explain the mechanisms by which GD3 inhibits VSMC responses.

To examine the role of GD3 in PDGF-mediated VSMC, we obtained a stable cell line expressing the GD3 synthase gene. Our demonstration that both superoxide and hydrogen peroxide production are increased in GD3 synthase transfectants was not altogether surprising, given the previous association between ROS and GD3 in other cell lines (24 ,41 ,42) . These findings suggest that the association of GD3 with the VSMC surface is critical for the production of superoxide and hydrogen peroxide. This phenotypic change could be abrogated by preincubation of the cells with the antioxidants NAC and PDTC (Table 1) . This is indicated because the GD3 synthase gene-induced ROS generation is attenuated by antioxidants. Our study demonstrated that GD3 are dependently associated with ROS generation in GD3 synthase transfectants.

Our studies indicate that GD3 exerts a decrease in the level of endogenous antioxidants such as SOD1, SOD2, reduced GSH and GSSG, suggesting that increased ROS production may be caused by impaired antioxidant defenses. Recent reports have focused on GD3-induced mitochondrial damage by using purified mitochondria, and all have concluded that GD3 can directly target mitochondria inducing the loss of mitochondrial transmembrane potential (24 , 25) . A previous study reported that the exposure of vascular cells to ROS in vitro, which results in preferential mitochondrial DNA damage, is a very sensitive marker for ROS-mediated cellular effects (16 , 18) . Consistent with this, our data also suggest that GD3 induced miotochondrial DNA damage using a PCR-based assay. Consistent with the significance of the ROS generation caused by GD3, our work clearly showed an accumulation in oxidative damage, as measured by mitochondrial DNA damage and the accumulation of the lipid peroxidation product MDA.

Several studies have identified cell proliferation pathways that are involved in the regulation of ROS generation in VSMC (13 , 43 44) . In an earlier study it was demonstrated that lactosylceramide, a ubiquitous glycosphingolipid, induced the expression of adhesion molecules, ROS generation, all of which were reversible by antioxidant intervention in HUVEC (45) . Because our recent experiments showed that GD3 synthase gene overexpression effectively suppresses cell proliferation and cell cycle progression in VSMC (34) , we hypothesized that VSMC responses may be related to the concomitant production of ROS in GD3 synthase transfectants. The effects of antioxidants on VSMC proliferation and cell cycle-associated proteins were confirmed by adding the antioxidants NAC and PDTC. Our results demonstrated that a blockade of ROS with antioxidants reversed decreased DNA synthesis, ERK phosphorylation, and cell cycle-associated proteins in GD3 synthase-expressing VSMC. These data provide evidence to show that ROS are the important mediators of GD3-induced repressed VSMC proliferation. Collectively, these lines of evidence provide strong support for the hypothesis that GD3 recruits ROS to induce suppressed cell proliferation in cultured GD3 synthase transfectants.

Recently, the action of MMP has emerged as an important component of the natural history of atherosclerosis (4 , 46) , and of the vascular response to injury (1 , 4 , 46) . ROS are known to activate MMP and decrease fibrillar collagen synthesis in cardiac fibroblasts (47) . Moreover, a recent study has shown that antioxidant NAC inhibits MMP-9 activity in macrophage-derived foam cells (48) . Our results indicated that antioxidants inhibited the TNF-{alpha}-induced MMP-9 expression in VSMC. These results are consistent with previous findings indicating that the antioxidant NAC inhibits MMP-9 induction in human bladder cancer cells and macrophage-derived foam cells (48 , 49) . Moreover, antioxidants rescued the suppressed TNF-{alpha}-induced MMP-9 expression in GD3 synthase transfectant cells (Fig. 4A, B ), suggesting that ROS may be involved in GD3-mediated MMP-9 inhibition. Previous studies have shown that GD3 is involved in the regulation of NF-{kappa}B-dependent survival pathway in hepatocytes (50) . We have previously shown that the AP-1 and NF-{kappa}B motifs in the MMP-9 promoter are associated with transcriptional MMP-9 down-regulation in response to the GD3 synthase gene in VSMC (9 , 11 , 34) . Our present results demonstrate that, in GD3 synthase transfectants, these decreased AP-1 and NF-{kappa}B activities can be recovered by adding antioxidants. Our findings demonstrate the ability of GD3 to suppress transcription factor AP-1 and NF-{kappa}B activities via ROS generation in VSMC. These data suggest that ROS may be involved in the inhibition of GD3-mediated MMP-9 expression by suppressing AP-1 and NF-{kappa}B activities in VSMC. To our knowledge, this is the first study to show the involvement of ROS generation during suppressed MMP-9 expression induced by a ganglioside GD3 in VSMC.

In summary, we have shown that ganglioside GD3 increases superoxide and hydrogen peroxide levels by reducing the antioxidant defense system in VSMC, as illustrated in Fig. 6 . GD3 also increases the levels of the lipid peroxidation product MDA and the amounts of mitochondrial DNA damage. In addition, our results suggest that ROS mediates GD3-induced suppressed cell proliferation, cell cycle progress, and MMP-9 expression in VSMC. Furthermore, ROS mediates GD3-mediated MMP-9 inhibition in coordination with their regulation of transcriptional MMP-9 promoter activity and the transcription factors NF-{kappa}B and AP-1 binding activity. These findings provide a functional link between ROS produced by ganglioside GD3 and VSMC responses. Finally, we conclude that the GD3-mediated inhibition of VSMC responses may contribute to plaque instability in atherosclerosis.


   ACKNOWLEDGMENTS
 
This work was in part supported by the Korea Research Foundation (KRF-2004–041-C00383), Korea (C.H.K.).


   FOOTNOTES
 
1 Present address: Division of Food and Biotechnology, Chungju National University, Chungju, Chungbuk 380-702, Korea.

Received for publication July 19, 2005. Accepted for publication January 6, 2006.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Ross, R. (1993) The pathogenesis of atherosclerosis: a perspective for the 1990s. Nature 362,801-809[CrossRef][Medline]
  2. Ahn, H. Y., Hadizadeh, K. R., Seul, C., Yun, Y. P., Vetter, H., Sachinidis, A. (1999) Epigallocathechin-3 gallate selectively inhibits the PDGF-BB-induced intracellular signaling transduction pathway in vascular smooth muscle cells and inhibits transformation of sis-transfected NIH 3T3 fibroblasts and human glioblastoma cells (A172). Mol. Biol. Cell 10,1093-1104[Abstract/Free Full Text]
  3. Akishita, M., Ito, M., Lehtonen, J. Y., Daviet, L., Dzau, V. J., Horiuchi, M. (1999) Expression of the AT2 receptor developmentally programs extracellular signal-regulated kinase activity and influences fetal vascular growth. J. Clin. Invest. 103,63-71[Medline]
  4. Ross, R. (1999) Atherosclerosis-an inflammatory disease. N. Engl. J. Med. 340,115-126[Free Full Text]
  5. Mulvany, M .J., Aalkjaer, C. (1990) Structure and function of small arteries. Physiol. Rev. 70,921-961[Abstract/Free Full Text]
  6. Sherr, C. J. (1994) G1 phase progression: cycling on cue. Cell 79,551-555[CrossRef][Medline]
  7. Sherr, C. J. (1996) Cancer cell cycles. Science 274,1672-1677[Abstract/Free Full Text]
  8. Galis, Z. S., Muszynski, M., Sukhova, G. K., Simon-Morrissey, E., Unemori, E. N., Lark, W. W., Amento, E., Libby, P. (1994) Cytokine-stimulated human vascular smooth muscle cells synthesize a complement of enzymes required for extracellular matrix digestion. Circ. Res. 75,181-189[Abstract/Free Full Text]
  9. Moon, S. K., Cho, G. O., Jung, S. Y., Gal, S. W., Kwon, T. K., Lee, Y. C., Madamanchi, N. R., Kim, C. H. (2003) Quercetin exerts multiple inhibitory effects on vascular smooth muscle cells: role of ERK1/2, cell-cycle regulation, and matrix metalloproteinase-9. Biochem. Biophys. Res. Commun. 301,1069-1078[CrossRef][Medline]
  10. Cho, A., Graves, J., Reidy, M. A. (2000) Mitogen-activated protein kinases mediate matrix metalloproteinase-9 expression in vascular smooth muscle cells. Arterioscler. Thromb. Vasc. Biol. 20,2527-2532[Abstract/Free Full Text]
  11. Moon, S. K., Cha, B. Y., Kim, C. H. (2004) ERK1/2 mediates TNF-alpha-induced matrix metalloproteinase-9 expression in human vascular smooth muscle cells via the regulation of NF-kappaB and AP-1: involvement of the ras dependent pathway. J. Cell. Physiol. 198,417-427[CrossRef][Medline]
  12. Schreck, R., Baeuerle, P. A. (1991) A role for oxygen radicals as second messengers. Trends Cell Biol. 1,39-42[CrossRef][Medline]
  13. Sundaresan, M., Yu, Z. X., Ferrans, V., Irani, K., Finkel, T. (1995) Requirement for generation of H2O2 for platelet-derived growth factor signal transduction. Science 270,296-299[Abstract/Free Full Text]
  14. Bhunia, A. K., Han, H., Snowden, A., Chatterjee, S. (1997) Redox-regulated signaling by lactosylceramide in the proliferation of human aortic smooth muscle cells. J. Biol. Chem. 272,15642-15649[Abstract/Free Full Text]
  15. McCord, J. M. (1993) Human disease, free radicals, and the oxidant/antioxidant balance. Clin. Biochem. 26,351-357[CrossRef][Medline]
  16. Ballinger, S. W, Patterson, C., Yan, C. N., Doan, R., Burow, D. L., Young, C. G., Yakes, F. M., Van Houten, B., Ballinger, C. A., Freeman, B. A., Runge, M. S. (2000) Hydrogen peroxide- and peroxynitrite-induced mitochondrial DNA damage and dysfunction in vascular endothelial and smooth muscle cells. Circ. Res. 86,960-966[Abstract/Free Full Text]
  17. Moon, S. K., Thompson, L. J., Madamanchi, N., Ballinger, S., Papaconstantinou, J., Horaist, C., Runge, M. S., Patterson, C. (2001) Aging, oxidative responses, and proliferative capacity in cultured mouse aortic smooth muscle cells. Am. J. Physiol. 280,H2779-H2788
  18. Yakes, F. M., Van Houten, B. (1997) Mitochondrial DNA damage is more extensive and persists longer than nuclear DNA damage in human cells following oxidative stress. Proc. Natl. Acad. Sci. U. S. A. 94,514-519[Abstract/Free Full Text]
  19. Breen, A. P., Murphy, J. A. (1995) Reactions of oxyl radicals with DNA. Free Radical Biol. Med. 18,1033-1077[CrossRef][Medline]
  20. Hakomori, S., Igarashi, Y. (1993) Reactions of oxyl radicals with DNA. Adv. Lipid Res. 25,147-162[Medline]
  21. Chatterjee, S. (1998) Sphingolipids in atherosclerosis and vascular biology. Arterioscler. Thromb. Vasc. Biol. 18,1523-1533[Abstract/Free Full Text]
  22. Pukel, C. S., Lloyd, K. O., Travassos, L. R., Dippold, W. G., Oettgen, H. F., Old, L. J. (1982) GD3, a prominent ganglioside of human melanoma. Detection and characterisation by mouse monoclonal antibody. J. Exp. Med. 155,1133-1147[Abstract/Free Full Text]
  23. Fernández-Checa, J. C. (2003) Redox regulation and signaling lipids in mitochondrial apoptosis. Biochem. Biophys. Res. Commun. 304,471-479[CrossRef][Medline]
  24. García-Ruiz, C., Colell, A., Paris, R., Fernández-Checa, J. C. (2000) Direct interaction of GD3 ganglioside with mitochondria generates reactive oxygen species followed by mitochondrial permeability transition, cytochrome c release, and caspase activation. FASEB J. 14,847-858[Abstract/Free Full Text]
  25. Rippo, M. R., Malisan, F., Ravagnan, L., Tomassini, B., Condo, I., Costantini, P., Susin, S. A., Ruffini, A., Todaro, M., Kroemer, G., Testi, R. (2000) GD3 ganglioside directly targets mitochondria in a bcl-2-controlled fashion. FASEB J. 14,2047-2054[Abstract/Free Full Text]
  26. García-Ruiz, C., Colell, A., Morales, A., Calvo, M., Enrich, C., Fernández-Checa, J. C. (2002) Trafficking of ganglioside GD3 to mitochondria by tumor necrosis factor-alpha. J. Biol. Chem. 277,36443-36448[Abstract/Free Full Text]
  27. Colell, A., García-Ruiz, C., Lluis, J. M., Coll, O., Marí, M., Fernández-Checa, J. C. (2003) Cholesterol impairs the adenine nucleotide translocator-mediated mitochondrial permeability transition through altered membrane fluidity. J. Biol. Chem. 278,33928-33935[Abstract/Free Full Text]
  28. García-Ruiz, C., Morales, A., Ballesta, A., Rodés, J., Kaplowitz, N., Fernández-Checa, J. C. (1994) Effect of chronic ethanol feeding on glutathione and functional integrity of mitochondria in periportal and perivenous rat hepatocytes. J. Clin. Invest. 94,193-201[Medline]
  29. Shan, X., Jones, D. P., Hashmi, M., Anders, M. W. (1993) Selective depletion of mitochondrial glutathione concentrations by (R,S)-3-hydroxy-4-pentenoate potentiates oxidative cell death. Chem. Res. Toxicol. 6,75-81[CrossRef][Medline]
  30. García-Ruiz, C., Colell, A., Mari, M., Morales, A., Calvo, M., Enrich, C., Fernández-Checa, J. C. (2003) Defective TNF-alpha-mediated hepatocellular apoptosis and liver damage in acidic sphingomyelinase knockout mice. J. Clin. Invest. 111,197-208[CrossRef][Medline]
  31. Mukhin, D., Chao, F. F., Kruth, H. S. (1995) Glycosphingolipid accumulation in the aortic wall is another feature of human atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 15,1607-1615[Abstract/Free Full Text]
  32. Chatterjee, S., Dey, S., Shi, W. Y., Thomas, K., Hutchins, G. M. (1997) Accumulation of glycosphingolipids in human atherosclerotic plaque and unaffected aorta tissues. Glycobiology 7,57-65[Abstract/Free Full Text]
  33. Bhunia, A. K., Schwarzmann, G., Chatterjee, S. (2002) GD3 recruits reactive oxygen species to induce cell proliferation and apoptosis in human aortic smooth muscle cells. J. Biol. Chem. 277,16396-16402[Abstract/Free Full Text]
  34. Moon, S. K., Kim, H. M., Lee, Y. C., Kim, C. H. (2004) Disialoganglioside (GD3) synthase gene expression suppresses vascular smooth muscle cell responses via inhibition of ERK1/2 phosphorylation, cell cycle progression, and matrix metalloproteinase-9 expression. J. Biol. Chem. 279,33063-33070[Abstract/Free Full Text]
  35. Wolin, M. S. (2000) Interactions of oxidants with vascular signaling systems. Arterioscler. Thromb. Vasc. Biol. 20,1430-1442[Abstract/Free Full Text]
  36. Holvoet, P., Perez, G., Zhao, Z., Brouwers, E., Bernar, H., Collen, D. (1995) Malondialdehyde-modified low density lipoproteins in patients with atherosclerotic disease. J. Clin. Invest. 95,2611-2619[Medline]
  37. Ballinger, S. W., Patterson, C., Knight-Lozano, C. A., Burow, D. L., Conklin, C. A., Hu, Z., Reuf, J., Horaist, C., Lebovitz, R., Hunter, G. C., McIntyre, K., Runge, M. S. (2002) Mitochondrial integrity and function in atherogenesis. Circulation 106,544-549[Abstract/Free Full Text]
  38. Hakomori, S., Igarashi, Y. (1995) Functional role of glycosphingolipids in cell recognition and signaling. J. Biochem. (Tokyo) 118,1091-1103[Abstract/Free Full Text]
  39. Sachinidis, A., Kraus, R., Seul, C., Meyer zu Brickwedde, M. K., Schulte, K., Ko, Y., Hoppe, J., Vetter, H. (1996) Gangliosides GM1, GM2 and GM3 inhibit the platelet-derived growth factor-induced signalling transduction pathway in vascular smooth muscle cells by different mechanisms. Eur. J. Cell Biol. 71,79-88[Medline]
  40. Gouni-Berthold, I., Seul, C., Ko, Y., Hescheler, J., Sachinidis, A. (2001) Gangliosides GM1 and GM2 induce vascular smooth muscle cell proliferation via extracellular signal-regulated kinase 1/2 pathway. Hypertension 38,1030-1037[Abstract/Free Full Text]
  41. Garcia-Ruiz, C., Colell, A., Mari, M., Morales, A., Fernandez-Checa, J. C. (1997) Direct effect of ceramide on the mitochondrial electron transport chain leads to generation of reactive oxygen species. Role of mitochondrial glutathione. J. Biol. Chem. 272,11369-11377[Abstract/Free Full Text]
  42. De Maria, R., Lenti, L., Malisan, F., d’Agostino, F., Tomassini, B., Zeuner, A., Rippo, M. R., Testi, R. (1997) Requirement for GD3 ganglioside in CD95- and ceramide-induced apoptosis. Science 277,1652-1655[Abstract/Free Full Text]
  43. Griendling, K. K., Minieri, C. A., Ollerenshaw, J. D., Alexander, R. W. (1994) Angiotensin II stimulates NADH and NADPH oxidase activity in cultured vascular smooth muscle cells. Circ. Res. 74,1141-1148[Abstract/Free Full Text]
  44. Patterson, C., Ruef, J., Madamanchi, N. R., Barry-Lane, P., Hu, Z., Horaist, C., Ballinger, C. A., Bode, C., Runge, M. S. (1999) Stimulation of a vascular smooth muscle cell NAD(P)H oxidase by thrombin. Evidence that p47(phox) may participate in forming this oxidase in vitro and in vivo. J. Biol. Chem. 275,19814-19822
  45. Bhunia, A. K., Arai, T., Bulkley, G., Chatterjee, S. (1998) Lactosylceramide mediates tumor necrosis factor-alpha-induced intercellular adhesion molecule-1 (ICAM-1) expression and the adhesion of neutrophil in human umbilical vein endothelial cells. J. Biol. Chem. 273,34349-34357[Abstract/Free Full Text]
  46. Newby, A. C., Zaltsman, A. B. (2000) Molecular mechanisms in intimal hyperplasia. J. Pathol. 190,300-309[CrossRef][Medline]
  47. Siwik, D. A., Pagano, P. J., Colucci, W. S. (2001) Oxidative stress regulates collagen synthesis and matrix metalloproteinase activity in cardiac fibroblasts. Am. J. Physiol. 280,C53-C60
  48. Galis, Z. S., Asanuma, K., Godin, D., Meng, X. (1998) N-acetyl-cysteine decreases the matrix-degrading capacity of macrophage-derived foam cells: new target for antioxidant therapy?. Circulation 97,2445-2453[Abstract/Free Full Text]
  49. Kawakami, S., Kageyama, Y., Fujii, Y., Kihara, K., Oshima, H. (2001) Inhibitory effect of N-acetylcysteine on invasion and MMP-9 production of T24 human bladder cancer cells. Anticancer Res. 21,213-219[Medline]
  50. Colell, A., Garcia-Ruiz, C., Roman, J., Ballesta, A., Fernandez-Checa, J. C. (2001) Ganglioside GD3 enhances apoptosis by suppressing the nuclear factor-kappa B-dependent survival pathway. FASEB J. 15,1068-1070[Free Full Text]



This article has been cited by other articles:


Home page
 CarcinogenesisHome page
D. W. Chan, V. W.S. Liu, G. S.W. Tsao, K.-M. Yao, T. Furukawa, K. K.L. Chan, and H. Y.S. Ngan
Loss of MKP3 mediated by oxidative stress enhances tumorigenicity and chemoresistance of ovarian cancer cells
Carcinogenesis, September 1, 2008; 29(9): 1742 - 1750.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Moon, S.-K.
Right arrow Articles by Kim, C.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Moon, S.-K.
Right arrow Articles by Kim, C.-H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS