|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
-secretase cleavage of APP and Notch by HIF-1 and hypoxia
,1
,1



,
,2
,
,2
* Laboratory of Molecular and Cellular Neuroscience, School of Life Sciences, and Institute for Biomedical Research, Xiamen University, Xiamen, China;
National Laboratory of Medical Genetics of China, Xiang-Ya Hospital, Central South University, Changsha, China; and
Center for Neuroscience and Aging, Burnham Institute for Medical Research, La Jolla, California, USA
2Correspondence: Z. Z., National Laboratory of Medical Genetics of China, Xiang-Ya Hospital, Central South University, Changsha 410078, Hunan, China. E-mail: benzz@burnham.org; and H. X., Laboratory of Molecular and Cellular Neuroscience, School of Life Sciences, Xiamen University, Xiamen 361005, China. E-mail: xuh{at}burnham.org
ABSTRACT
The proteolytic cleavage of Alzheimer ß-amyloid precursor protein (APP) and signaling receptor Notch is mediated by the PS/
-secretase complex, which consists of presenilins, nicastrin, APH-1, and PEN-2. Although the four components are known to coordinately regulate each other at the protein level, information regarding their transcription regulation is scarce. Here we characterized the 5'-flanking region of the human APH-1A gene and identified a 271-bp fragment containing the transcription initiation site for the promoter activity. Sequence analysis, mutagenesis, and gel shift studies revealed a binding of AP4 and HIF-1 to the promoter, which affects the promoter activity. Activation of HIF-1 by short-term NiCl2 treatments (a condition of chemical hypoxia) dramatically increased APH-1A mRNA and protein expression, accompanied by increased secretion of Aß and decreased APP CTFs formation, indicative of an increase in
-secretase activity. NiCl2 treatments had little effect on APP and the other three components of the
-secretase complex. The cellular concentration of Notch intracellular domain (NICD) was also increased by the hypoxic treatment. Our results demonstrate that APH-1A expression and the
-secretase mediated Aß and Notch NICD generation are regulated by HIF-1, and the specific control of APH-1A expression may imply physiological functions uniquely assigned to APH-1A.Wang, R., Zhang, Y-w., Zhang, X., Liu, R., Zhang, X., Hong, S., Xia, K., Xia, J., Zhang, Z., Xu, H. Transcriptional regulation of APH-1A and increased
-secretase cleavage of APP and Notch by HIF-1 and hypoxia.
Key Words: Alzheimers disease AP4 promoter
ß-AMYLOIDS (Aß), the major components of senile plaques that accumulate in the brain of Alzheimers disease (AD) patients, are small peptides derived from ß-amyloid precursor protein (APP). APP can be sequentially cleaved by ß-secretase (BACE1) and PS/
-secretase complex to generate heterogeneous Aß species, mostly Aß40 and the more deleterious Aß42, which are generally believed to cause Alzheimers disease. Alternatively, APP can be cleaved by
-secretase to generate the nonamyloidogenic soluble APP
(1
, 2)
. Due to the importance of Aß generation in AD pathogenesis, regulation of PS/
-secretase function/activity has become an extensive target of scrutiny. Besides APP, the PS/
-secretase complex has been found to cleave a number of functionally important proteins such as Notch (3
, 4)
, E-cadherin (5)
, ErbB4 (6)
, CD44 (7)
, etc., suggesting the involvement of PS/
-secretase in a broad range of biological activities.
The PS/
-secretase is a high molecular weight complex that consists of at least four components: presenilin (PS), nicastrin (Nct), anterior pharynx-defective-1 (APH-1), and presenilin enhancer-2 (PEN-2) (8
9
10)
. PS is generally believed to be the catalytic component of the PS/
-secretase complex. Nascent PS undergoes endoproteolytic cleavage to generate an amino-terminal fragment (NTF) and a carboxyl-terminal fragment (CTF) to form functional PS heterodimer (11)
. Type I transmembrane glycoprotein Nct is the first identified protein cofactor of PS (12
, 13)
. APH-1 and PEN-2 were identified through genetic screening in Caenorhabditis elegans (14
, 15)
. Recent studies have demonstrated that the four components of PS/
-secretase regulate each other in a coordinate way; down-regulation/deficiency of a given component typically results in a decrease in the concentration and impaired trafficking/maturation of other components, hence leading to inactivation of the enzymatic activity (8
9
10
, 16
17
18
19)
.
While no other homologue exists for Nct and PEN-2, PS and APH-1 possess two homologs in mammals, namely presenilin 1 (PS1) and presenilin 2 (PS2) (20
21
22)
and APH-1A and APH-1B. Murines have a third APH-1 homologue as APH-1C (14
, 15
, 17)
. PS1 or PS2 each has several spliced transcripts (23
, 24)
. APH-1A has two spliced isoforms, a long form (APH-1AL) and a short form (APH-1AS) (14
, 15
, 17)
. Recently a novel human APH-1B splice variant lacking exon 4 was also found (25)
. The existence of PS and APH-1 homologs/isoforms suggests that PS/
-secretase is heterogeneous and that various PS/
-secretase complexes might be associated with different functional specificity (26)
. Thus, knowledge regarding the regulation of PS/
-secretase components, including regulation at transcriptional levels, is important for dissecting the physiological functions of different PS/
-secretase complexes. Several studies have identified promoter regions of presenilins, showing that transcription of PS1 may be regulated by the cyclic AMP-response element-binding protein (CREB) (27)
, Ets factors, Sp1 (28)
, and/or possibly HIF-1
(29)
. Recently we identified the promoter region of PEN-2 and demonstrated that PEN-2 may be regulated by CREB (30)
. In the present study, we identify and characterize the promoter region of APH-1A. Furthermore, we demonstrate that transcription factor AP4 and HIF-1 play a significant role in regulating APH-1A gene expression.
MATERIALS AND METHODS
Cell culture
HeLa cells were cultured in Dulbeccos modified Eagles medium (DMEM) containing 10% FBS. HeLa cells stably expressing human APP Swedish mutation construct (HeLa-APP Swe) were cultured in DMEM supplemented with 10% FBS and 200 µg/ml G418. Primary rat neuronal cultures were derived from the cerebral cortices of embryonic day 1719 Sprague-Dawley rat embryos and cultured in serum-free NeurobasalTM-A Medium (Invitrogen, Carlsbad, CA) with B-27 supplement (Invitrogen) (31)
. All cells were maintained at 37°C in an incubator containing 5% CO2.
Cloning of APH-1A promoter, construction of luciferase reporter plasmids and site-directed mutagenesis
Polymerase chain reaction (PCR) was performed to amplify the 5'-flanking regions of the APH-1A gene using human peripheral blood lymphocyte genomic DNA as templates. The primers used to generate different promoter deletion plasmids were as follows: forward (with KpnI site), 5' GGGGTACCTCATTCACTCTAATATACAACCCCTC 3', 5' GGGGTACCGAATTTATGGCGGGGGTGGGGTG 3', 5' GGGGTACCAGCAGCTCTAGCCCATTTCCTCTC 3', 5' GGGGTACCTTCAAACAGGATCTACCCCCTC 3', 5' GGGGTACCCGAAAGG AAACAGCGACGGAAG 3', 5' GGGGTACCAGCCACTCCCAGGACGAAGTCA AG 3' and 5' GGGGTACCAGGCGACTACAACTCCCAGCAG 3'; reverse (with BglII site), 5' GAAGATCTTGACCAGGACAGGCAAATGGGAG 3', 5' GAAGATCTGGGAGTCCGCGTGGGGTGGCAAC 3' and 5' GAAGATCTGTCCGC GCCACTTCCTCTAC 3'. The resulting PCR-amplified fragments were cloned into the multicloning sites upstream of luciferase reporter gene in the pGL3-enhancer expression vector (Promega, Madison, WI). Site-directed mutations were integrated into the APH-1A promoter fragments by overlapping PCR and the mutated fragments were then cloned into vectors. To generate these mutants, two end primers, 5' GGGGTACCAGCCACTCCCAGGACGAAGTCAAG 3' and 5' GAAGATCTGGGAGTCCGCGTGGGGTGGCAAC 3', were used in combination with various primers with mutations: AP1 (m1), 5' GGGGTACCAGCCACTCCCAGGACGAAGTACAGGCCTCGGAAG 3'; AP1 (m2), 5' GTCTGGGGGGTACATTGCACCG 3', and its reverse complementary sequence (RCS); HIF-1 (m3), 5' GCACCGCGCCCCTCATGG 3', and its RCS; AP4 (m4), 5' CTACAACTCCTAGCAGGTCGAG 3', and its RCS; AP4 (m5), 5' CAGGTCGAGTAGTTCCGCC CGC 3', and its RCS; and AP4 (m6), 5' CGGACTC CCTAGCTGGCG 3', and its RCS. Mutations are shown in boldface, italicized type.
Transient transfection and reporter gene assays
Transient transfections were carried out using Lipofectamine 2000 (Invitrogen) following the manufacturers instructions. To normalize the different transfection efficiencies of various luciferase constructs, the phRL-SV40 plasmid containing Renilla Luciferase gene was cotransfected into the cells in a molar ratio of 1: 50 (phRL-SV40:pGL3). Cells were harvested 24 h (pGL3-Enhancer chimeric plasmids) or 48 h (pGL3-Basic chimeric plasmids) after transfection and lysed with passive lysis buffer (Promega). Firefly luciferase activities and Renilla luciferase activities were measured sequentially using Dual-luciferase reporter assay system (Promega) and a Luminometer (Beckman, Fullerton, CA).
5'-RACE
Total RNA was extracted from healthy human liver with Trizol reagent (Invitrogen). 5' rapid amplification of cDNA ends (5'-RACE) was performed using BD SMART TM RACE cDNA Amplification Kit(BD Bioscience, San Jose, CA) following the manufacturers suggested procedures. To amplify the 5' untranslated region of APH-1A, two gene-specific primers were used: GSP-APH-1A-1, 5' GACGAAAGTG CAGCCGAAAAACACCGCAG 3' and GSP-APH-1A-2, 5' CAGCTGGGGAGTCCG CGTGGGGTGGCAAC 3'. The PCR products were cloned into pGEM T vector (Promega) and sequenced with primer SP6.
EMSA
EMSA was carried out essentially the same as described previously (30)
. Briefly, oligonucleotides were synthesized and annealed with their respective complements to generate double-stranded probes, which include AP4wt (where wt is wild-type), containing a putative AP4 binding site corresponding to the APH-1A promoter from bp 105 to bp 83 (5' TAC AAC TCC CAG CAG GTC GAG CA 3'); AP4mut with a C
T mutation (5' TAC AAC TCC TAG CAG GTC GAG CA 3'); HIF-1wt containing a putative HIF-1 binding site corresponding to the APH-1A promoter region bp + 100 to + 122 (5' CCG CGC CCC TCG TGG GGT CGC GT 3'); HIF-1mut with a G
A mutation (5' CCG CGC CCC TCA TGG GGT CGC GT 3'); AP4 consensus sequence as described in reference 32 (5' CAC CCG GTC AGC TGG CCT ACA CC 3'); HIF-1 consensus sequence as described in reference 33 (5' ACC GGC CCT ACG TGC TGT CTC AC 3); and SP1 consensus sequence (Promega) (5' ATT CGA TCG GGG CGG GGC GAG C 3'). Double-stranded AP4 wt and HIF-1wt were end-labeled with [
-32P]ATP, incubated with nuclear extract from HeLa cells and analyzed by nondenaturing PAGE and autoradiography. For the HIF-1 binding study, HeLa cells were treated with NiCl2 (1 mM) for 20 h before harvest for nuclear extracts. 32P-labeled AP4 consensus sequence and HIF-1 consensus sequence incubated with HeLa nuclear extracts were used as positive control, respectively. For the competition assay, HeLa nuclear extracts were incubated with 1.75 pmol (50x excess) of unlabeled competition oligonucleotides for 10 min prior to adding 35 fmol labeled probes.
Northern blot hybridization
HeLa-APP Swe cells were treated with 1 mM NiCl2 for indicated times, and total RNA was then extracted using Trizol reagent. RNAs were run on formaldehyde gels and transferred to nylon membranes. For Northern blot hybridization, the full-length of APH-1A was used as the probe. The probe for GAPDH has been reported previously (30)
. Probes were 32P-labeled using a random primed DNA labeling kit (Roche Molecular Biochemicals, Indianapolis, IN) and hybridized to Northern blots.
Immunoblot and antibodies
Cell lysates were analyzed by Tris-glycine SDS-PAGE, and proteins were detected by Western blot by using different antibodies as indicated. Rabbit anti-APH-1A polyclonal antibody (pAb) and anti-PEN-2 pAb were from ZYMED. Rabbit anti-PS1 NTF antibody (Ab) Ab14, anti-nicastrin Ab SP716, anti-APP Ab 369, and anti-BACE1 Ab 690 were developed in our lab (16
, 18
, 19)
. Mouse anti-HIF-1
Ab was from Novus Biologicals (Littleton, CO). Mouse anti-
-tubulin Ab was from (Sigma, St. Louis, MO). Monoclonal antibodies 6E10 and 4G8 (Signet Laboratories, Dedham, MA) that recognize amino acid 117 and 1724 of human Aß peptide, respectively, were used to detect soluble APP
and Aß. For assaying Notch, HeLa-APP Swe cells were transiently transfected with Notch
E-myc construct. After NiCl2 treatment, the cell lysates were run on gel and immunoblotted with mouse anti-myc Ab 9E10 to visualize Notch and its intracellular domain (NICD).
RESULTS
Promoter analysis of the APH-1A gene
To determine the transcription initiation site of the human APH-1A gene, 5'-RACE was performed. Two gene-specific primers were used in PCR amplification, producing two fragments of
180 and 260 bp, respectively (data not shown). The two PCR products were cloned into pGEM T vector and sequenced. The results indicated that the transcription initiation site of the APH-1A gene is located 211 bp upstream of the translation start codon ATG (Fig. 1
A). We assigned the transcription initiation site as + 1 for numbering.
|
To study the transcriptional regulation of APH-1A, we PCR-amplified 15 fragments with different length of the 5' flanking region of the APH-1A gene and subcloned them individually into a promoterless luciferase plasmid, pGL3-Enhancer (Fig. 1B
). These constructed plasmids were transfected into HeLa cells (Fig. 1C
) and rat cortical neurons (Fig. 1D
). The luciferase activity driven by different APH-1A fragments was assayed using a dual luciferase system and normalized to cotransfected Renilla luciferase activity. The luciferase activity in cells transfected with the luciferase gene driven by an SV40 promoter was used as a positive control and defined as 100% for the normalization purpose, whereas the luciferase activity in cells transfected with empty pGL3-Enhancer was used as a negative control. As shown in Fig. 1C and D
, the results from HeLa cells and rat cortical neurons were similar. The levels of luciferase gene expression driven by the longest APH-1A gene 5'-flanking region, the 926 bp fragment, was
20% of the positive control in HeLa cells and 26% in rat cortical neurons. Different deletions from both ends of the 926 bp fragment either increased or decreased luciferase activity, suggesting that both cis-acting regulatory regions and trans-acting regulatory regions exist between bp 746 to bp + 180. Luciferase activity driven by the 271 bp fragment was
127 and 79% of the positive control in HeLa cells and in rat cortical neurons, respectively, suggesting the sequence from bp 233 to bp + 38 containing the transcription initiation site possesses a basic promoter apparatus.
The APH-1A gene promoter contains AP4 and HIF-1 binding sites
The sequence shown in Fig. 1A
covers the 5'-flanking region of the human APH-1A gene, as well as a partial protein-encoding region. To identify potential transcription factor binding sites on the APH-1A promoter region, we first analyzed this sequence using MatInspector2.2 software (Genomatrix, Munich, Germany). We focused our analysis on the region with basic promoter activities. Prediction analysis revealed that this region possesses two AP1 consensuses, three AP4 consensuses, and one HIF-1 consensus (Fig. 1A
).
To define the potential transcription factor for the APH-1A promoter, we mutated these potential transcriptional factor binding sites individually. The mutated fragments were cloned into pGL3-Enhancer luciferase reporter vector, followed by promoter activity analysis. Mutations of the two AP1 sites had little effect on the promoter activity (Fig. 2
). Mutation of the HIF-1 site resulted in a dramatic decrease of the luciferase activity (54% of the WT) control). Furthermore, mutation of an AP4 site (m4) significantly reduced the luciferase activity to 20% of the control, whereas mutations of the other two AP4 sites (m5 and m6) dramatically increased the luciferase activity (Fig. 2)
. These results suggest that HIF-1 and AP4 are potential transcriptional factors regulating APH-1A transcription.
|
To further investigate the binding of AP4 and HIF-1 to the promoter region, we performed gel shift assays. For AP4, a double-stranded oligonucleotide sequence corresponding to the APH-1A promoter region from bp 105 to bp 83 was synthesized and labeled as the probe. As shown in Fig. 3
A (lane 3), a protein-DNA complex was detected after incubation of the probe with HeLa nuclear extracts. As a positive control, a classic AP4 binding oligoncleotide probe (see Materials and Methods) was also shown to form a protein-DNA complex that migrated at the same position of APH-1A AP4 probe-protein complex (Fig. 3A
, lane 2). Notably, the APH-1A AP4 probe was able to form the protein-DNA complex even more effectively than the classic AP4 consensus probe. The complex formation between APH-1A AP4 probeprotein was dramatically inhibited by competitive binding of the AP4 consensus (Fig. 3A
, lane 4) and APH-1A AP4 probe (Fig. 3A
, lane 5). In contrast, the APH-1A AP4 probeprotein complex formation was not affected by competition from an SP1 consensus probe (Fig. 3A
, lane 7). The competitive binding with an AP4 mutant observed in Fig. 3A
(lane 6) is likely due to a nonconservative mutation of the AP4 probe. Together, these results indicate that the identified AP4 binding element could form a complex with nuclear AP4 protein in vitro.
|
Initial studies showed that incubation of the HIF-1 probes with HeLa nuclear extracts failed to produce any binding (data not shown). However, when HeLa cells were treated with 1 mM NiCl2 for 20 h (a condition of chemical hypoxia) and the nuclear extracts were incubated with the HIF-1 probes, a probeprotein complex was detected for both the probe corresponding to the APH-1A promoter region from bp + 100 to bp + 122 (Fig. 3B
, lane 3) and a HIF-1 consensus probe (Fig. 3B
, lane 2). Competitive binding with unlabeled HIF-1 consensus (Fig. 3B
, lane 4) and APH-1A HIF-1 probe (Fig. 3B
, lane 5) significantly inhibited the complex formation between APH-1A HIF-1 probe and nuclear proteins. Competitive binding with mutated APH-1A HIF-1 probe and SP1 probe had little effect on the formation of probe-protein complex (Fig. 3B
, lanes 6, 7). These results indicate that the APH-1A HIF-1 binding element could form a complex with nuclear HIF-1 protein in vitro, when HIF-1 concentration is increased under NiCl2 treatment.
HIF-1 regulates APH-1A expression and hypoxic treatments increase
-secretase mediated Aß and NICD formation
In addition to a lack of any known reagents that can regulate AP4 activity, the perplexing observation that mutations at different AP4 sites had opposite effects on promoter activity has hindered our pursuit of AP4 regulation of APH-1A transcription. Hence, we focused on studying the roles of HIF-1 in APH-1A expression. HIF-1 has two subunits as HIF-1
and HIF-1ß. The concentration of HIF-1
is found to be low under physiological conditions but increases dramatically under hypoxia. Increased HIF-1
binds HIF-1ß to form functional HIF-1 heterodimers, consequently regulating a series of gene expression events. Some metals such as nickel and cobalt increase HIF-1
levels and promote HIF-1-dependent transcription, mimicking hypoxic effects (34
, 35)
. Having shown that HIF-1 binds to APH-1A promoter region under NiCl2 treatment in vitro, we further investigated whether HIF-1 regulates the expression of APH-1A in vivo. The APH-1A mRNA was found to significantly increase (up to 2.5-fold) upon NiCl2 treatments in a time-dependent pattern in HeLa cells (Fig. 4
). The transcription of GAPDH, a known HIF-1 responsive gene (36)
, also increased correspondingly (Fig. 4)
.
|
It has been well known that chronic chemical hypoxic conditions render dramatic stress to cells (34
, 35)
. We indeed observed a significant slowdown on cell metabolism after 8 h NiCl2 treatment associated with a small proportion of cell death after 20 h treatments (by propidium iodide staining and MTT assays; data not shown). To study the effect of HIF-1 on protein expression, we treated HeLa cells stably expressing a mutant form of human APP with NiCl2 for short periods (2 and 4 h) to induce HIF-1 with minimal stress effects. We found that the NiCl2 treatment significantly resulted in an increased HIF-1
level (Fig. 5
A) and a concomitant increase of APH-1A. The levels of APP, as well as the other three
-secretase components, PEN-2, PS1 (its NTF), and nicastrin, remained unchanged. Interestingly, we found that Aß secretion was significantly increased upon 2 or 4 h treatment, accompanied with decreased APP CTFs and increased sAPP
(Fig. 5B
), indicative of increased
-secretase activity, which was presumably a result of increased APH-1A concentration. In addition, we also found that the short-term NiCl2 treatments increased the steady-state levels of Notch NICD (Fig. 5B
).
|
DISCUSSION
It has previously been shown that the transcription of ß-secretase gene BACE1 is regulated by SP1 (37)
. Among the four
-secretase components, however, only the promoters of PEN-2 and PSs have been studied so far. Recently, we characterized the promoter region of PEN-2 and demonstrated that PEN-2 expression is regulated by CREB; activation of CREB by forskolin significantly stimulated the transcription and translation of PEN-2 (30)
. Pastorcic and Das (28)
showed that Ets factors were involved in regulation of PS1 and that Ets factors were differentially utilized in human neuroblastoma SH-SY5Y and SK-N-SH cells. Mitsuda et al. (27)
identified a CREB binding site on the PS1 promoter region and showed that both PS1 transcription and translation were up-regulated in SK-N-SH cells on CREB activation by NMDA. In addition, there are potential HIF binding sites on PS1/PS2 promoter regions. The hypoxia treatment potentiated PS1 gene expression in interleukin-1ß and Aß42 treated human neural cells (29)
, implying that HIF-1 may be involved in stress-mediated PS transcriptional regulation. However, in our experiments, the PS1 concentration was not affected by increased HIF-1 activity on NiCl2 treatment (Fig. 5A
). This discrepancy may be attributed to the use of different cell types and the ways of activating HIF-1.
We chose nickel treatment as a means of hypoxia throughout our studies because more significant effects on APH-1 expression were observed when using NiCl2 than low oxygen hypoxic treatment. Nickel is recognized as a human carcinogen and possible mechanisms underlying the carcinogenic actions of nickel include oxidative stress, genomic DNA damage, epigenetic effects, and gene expression regulation by activation of certain transcription factors such as HIF-1 (34
, 35
, 38)
. Upon short-term treatment (
4 h) with NiCl2 to mimic hypoxia while minimizing other harmful effects to cells, APH-1A concentration was dramatically increased in response to increased HIF-1 concentration. Interestingly, the secretion of Aß was significantly increased accompanied by reduced APP CTFs, and the steady-state levels of Notch NICD was also increased. All of the observations imply an increased
-secretase activity. Several previous studies reporting increased gene expression downstream of Notch signaling in response to hypoxia provided indirect evidence indicative of regulation by HIF-1/hypoxia of
-secretase activity (39
, 40)
. Although it is suggested that the
-secretase activity requires precise stoichiometric interaction among all four components, the levels of the other three
-secretase components were found to be unaffected by the nickel treatments. Furthermore, the secretion of sAPP
, which is regarded as a competitive pathway to that for Aß (1)
, was indeed also increased.
While no explicit explanations for these perplexing results can be provided at present, we reason the following speculations: First, APH-1 may indeed be the limiting factor for
-secretase activity and increased APH-1 concentration alone may be sufficient to elevate the
-secretase activity. Second, hypoxia has been known to affect membrane potential via mediating ion channels (41)
, hence nickel treatments or chemical hypoxia could change the intracellular/intramembranous microenvironments, rendering the substrates more susceptible to the
-secretase. Additionally, based on our recent findings that activation of protein kinase A by forskolin or MAPK by insulin/insulin-like growth factor-1 promotes secretion of both Aß and sAPP
(or the trafficking of APP/Aß-containing vesicles from the trans-Golgi network) (30
, 42
, 43)
, we could envision a similar stimulation by yet-unknown mechanisms involving HIF-1 activation. A possibility of increased Notch trafficking to the plasma membrane by hypoxia could also exist to account for our observation of increased Notch cleavage. The formation of NICD has been thought to occur mainly at the plasma membranea site where
-secretase was known to be highly active (44
45
46)
. It has recently been reported that hypoxia promotes the Rab11-mediated trafficking of the
6ß4 integrin (47)
. This work, together with our previous finding that Rab11 is a key trafficking factor for the estrogen-stimulated APP secretion (48)
, provided indirect but reasonable support to the trafficking hypothesis.
While each of the identified components of the
-secretase is essential for its activity, little is known about the biology of nicastrin, APH-1, and PEN-2, and the nature of their involvement in APP/Notch processing. Further, numerous reports have assigned additional physiological functions to PS, including calcium homeostasis, skeletal development, neurite outgrowth, apoptosis, synaptic plasticity, and tumorigenesis (49
50
51
52)
. In addition, although mice individually lacking PS1 (53)
, nicastrin (54
, 55)
, or APH-1A (17)
are embryonically lethal, these knockout models exhibit similar but distinguishable patterning defects at early embryonic stages. In the present study, HIF-1 activation promoted APH-1 expression differently from the expression of other
-secretase components. Consequently, the HIF-1/hypoxia-stimulated APH-1A expression regulates the
-secretase cleavage and/or trafficking of APP and Notch. These results suggest that additional physiological functions may be uniquely assigned to APH-1A through the specific control of APH-1A expression.
ACKNOWLEDGMENTS
We thank Zonglei Zhang, Jie Ling, and Fang Cai for technical assistance. This work was supported in part by National Institutes of Health grants (RO1 NS046673 to H.X., RO1 AG024895 to H.X., and RO1 DC006497 to Z.Z.), grants from the Alzheimers Association (to H.X. and Z.Z.), American Health Assistance Foundation (to H.X.) and funds from the National Natural Science Foundation of China (No. 30572077 and 30370737), Chinas 973 Project (2002BA711A0708) and 863 Project (2001CB510302). Y.-w. Z. is the recipient of National Institutes of Health training grant F32 AG024895.
FOOTNOTES
1 These authors contributed equally to this work. ![]()
Received for publication January 26, 2006. Accepted for publication February 14, 2006.
REFERENCES
-Secretase is a membrane protein complex comprised of presenilin, nicastrin, aph-1, and pen-2. Proc. Natl. Acad. Sci. U. S. A. 100,6382-6387
-secretase complex, by CREB. Mol. Cell. Biol. 26,1347-1354This article has been cited by other articles:
![]() |
Y. Liu, Y.-w. Zhang, X. Wang, H. Zhang, X. You, F.-F. Liao, and H. Xu Intracellular Trafficking of Presenilin 1 Is Regulated by {beta}-Amyloid Precursor Protein and Phospholipase D1 J. Biol. Chem., May 1, 2009; 284(18): 12145 - 12152. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Llovera, M. de Tullio, L. G. Alonso, M. A. Leissring, S. B. Kaufman, A. E. Roher, G. de Prat Gay, L. Morelli, and E. M. Castano The Catalytic Domain of Insulin-degrading Enzyme Forms a Denaturant-resistant Complex with Amyloid {beta} Peptide: IMPLICATIONS FOR ALZHEIMER DISEASE PATHOGENESIS J. Biol. Chem., June 20, 2008; 283(25): 17039 - 17048. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Makino, R. Uenishi, K. Okamoto, T. Isoe, O. Hosono, H. Tanaka, A. Kanopka, L. Poellinger, M. Haneda, and C. Morimoto Transcriptional Up-regulation of Inhibitory PAS Domain Protein Gene Expression by Hypoxia-inducible Factor 1 (HIF-1): A NEGATIVE FEEDBACK REGULATORY CIRCUIT IN HIF-1-MEDIATED SIGNALING IN HYPOXIC CELLS J. Biol. Chem., May 11, 2007; 282(19): 14073 - 14082. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, K. Zhou, R. Wang, J. Cui, S. A. Lipton, F.-F. Liao, H. Xu, and Y.-w. Zhang Hypoxia-inducible Factor 1{alpha} (HIF-1{alpha})-mediated Hypoxia Increases BACE1 Expression and beta-Amyloid Generation J. Biol. Chem., April 13, 2007; 282(15): 10873 - 10880. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |