FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published as doi: 10.1096/fj.05-5338fje.
This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.05-5338fjev1
20/8/1224    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Guha, M.
Right arrow Articles by Bandyopadhyay, U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Guha, M.
Right arrow Articles by Bandyopadhyay, U.
(The FASEB Journal. 2006;20:1224-1226.)
© 2006 FASEB

Apoptosis in liver during malaria: role of oxidative stress and implication of mitochondrial pathway

Mithu Guha, Sanjay Kumar, Vinay Choubey, Pallab Maity and Uday Bandyopadhyay1

Division of Drug Target Discovery and Development, Central Drug Research Institute, Chatter Manzil Palace, Mahatma Gandhi Marg, Uttar Pradesh, India

1Correspondence: Division of Drug Target Discovery and Development, Central Drug Research Institute, Chatter Manzil Palace, Mahatma Gandhi Marg, Lucknow-226001, Uttar Pradesh, India. E-mail: ubandyo_1964{at}yahoo.com

ABSTRACT

Hepatic dysfunction is a common clinical complication in malaria, although its pathogenesis remains largely unknown. Using a variety of in vivo and ex vivo approaches, we have shown for the first time that malarial infection induces hepatic apoptosis through augmentation of oxidative stress. Apoptosis in hepatocyte has been confirmed by terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin-nick-end labeling assay (TUNEL) and caspase-3 activation. Gene expression analysis using RT-PCR indicates the significant down-regulation of Bcl-2 and up-regulation of Bax expression in liver of malaria infected mice suggesting the involvement of mitochondrial pathway of apoptosis. The levels of Fas expression and caspase-8 activity in infected liver were same as that of uninfected control mice indicating death receptor (Fas) pathway did not contribute to liver apoptosis during malarial infection. Moreover, evidence has been presented by confocal microscopy to show the translocation of Bax from cytosol to mitochondria in apoptotic hepatocyte, resulting in opening of permeability transition pores, which in turn decreases mitochondrial membrane potential and induces cytochrome c release into cytosol. Malarial infection induces the generation of hydroxyl radical (·OH) in liver, which may be responsible for the induction of oxidative stress and apoptosis as administration of ·OH specific antioxidant as well as spin trap, alpha-phenyl-tert-butyl-nitrone in malaria-infected mice significantly inhibits the development of oxidative stress as well as induction of apoptosis. Thus, results suggest the implication of oxidative stress induced-mitochondrial pathway of apoptosis in the pathophysiology of hepatic dysfunction in malaria.—Guha, M., Kumar, S., Choubey, V., Maity, P., Bandyopadhyay, U. Apoptosis in liver during malaria: Role of oxidative stress and implication of mitochondrial pathway.


Key Words: malaria • Plasmodium yoelii • apoptosis • oxidative stress

MALARIA IS ONE of the most devastating diseases of the world, particularly in tropical countries (1 , 2) . Annually, around 300–500 million of people get affected with this disease worldwide and of them ~1–3 million die (3) . Despite significant progress in the treatment of malaria, this disease has staged a huge comeback in large areas of the world, due to the development of drug-resistant parasites (1 , 2) . Malarial infection develops serious systemic complications such as hematological abnormalities (4 , 5) , splenomegaly and hepatitis (6) . There is strong evidence of hepatic dysfunction in malarial infection (6) . The histopathological changes occurring in the liver of malaria patients include heapatocyte necrosis, cholestasis, bile stasis, granulomatous lesions and malarial nodules (7 , 8) . It is assumed that pathological changes in liver during malarial infection contribute significantly in the development of hepatic dysfunction and other systemic complications (6) . However, the pathogenesis underlying the hepatic damage and associated dysfunction are largely unknown.

The role of oxidative stress during malarial infection needs clear illumination, as some have demonstrated a protective role while other suggested relation with malarial pathophysiology and complication (9) . However, recent reports suggest that generation of reactive oxygen species (ROS) and associated oxidative stress play crucial role in the development of systemic complications in malaria (9) . Malarial infection decreases the levels of antioxidant enzymes and other antioxidants such as catalase, glutathione (GSH) peroxidase, superoxide dismutase, albumin, GSH, ascorbate and plasma tocopherol (10) . Plasmodium infection in mice increases the activity of xanthine oxidase and lipid peroxide content in liver, indicating development of hepatic oxidative stress in malaria (11) . However, there is no clear idea on the identity of the reactive species of ROS family involved in the development of oxidative stress.

ROS, in addition to imparting oxidative insult by damaging structural and functional components of cellular systems, is also able to induce apoptosis (12 , 13) . Apoptosis, the programmed death of cells is linked intimately with both physiology as well as pathology in variety of cellular systems (14) . Apoptosis may be either caspase dependent or caspase independent (15) . The caspase-dependent apoptosis is mainly mediated through two distinct pathways, viz., the death receptor pathway (extrinsic) and the mitochondrial pathway (intrinsic). The death receptor pathway is comprising Fas (CD95/Apo-1) and TRAIL (Apo-2) and this pathway is activated when ligands specific for either Fas or TRAIL bind to their respective receptors, resulting in activation of caspase-8, which finally activates caspase-3 (16) . On the other hand mitochondrial pathway of apoptosis is initiated by the down-regulation of antiapoptotic proteins (such as, Bcl-2, BclxL) and/or up-regulation of pro-apoptotic proteins (such as, Bax, Bad, Bid), resulting in opening of mitochondrial permeability transition pores and release of apoptosis inducing proteins (cytochrome c, apoptosis inducing factor etc.) from mitochondria (14 , 17 , 18) . Evidence of hepatocyte apoptosis especially during oxidative stress is common in different infectious and noninfections diseases (12 , 19 , 20) . However, so far studies regarding apoptosis in liver have been overlooked in malarial infection. We aimed to identify the mechanisms underlying hepatic pathology in malaria and the significance of two conventional pathways of cell injury, viz., oxidative stress and apoptosis in this hepatic damage. In the present study, we have shown for the first time that malarial infection induces apoptosis in liver through the development of oxidative stress and ·OH is shown to be the causative agent for oxidative stress. Treatment with ·OH scavengers attenuates hepatic oxidative stress as well as apoptosis. Moreover, our findings implicate the role of the mitochondrial pathway for the induction of apoptosis in liver by oxidative stress during malarial infection.

MATERIALS AND METHODS

MATERIALS
5,5'-Dithio-bis (2-nitrobenzoic acid) (DTNB), GSH, thiobarbituric acid (TBA), trichloro acetic acid (TCA), tetraethoxypropane, dinitrophenylhydrazine, guanidine hydrochloride, trifluoroacetic acid, mitochondria isolation kit, caspase assay kit, Triton X-100, diaminobenzidine, phalloidin-FITC, proteinase K, mannitol, DMSO, alpha-phenyl-tert-butyl-nitrone (PBN), DEVD-pNA, paraformaldehyde, Nonidet P-40 (Nonidet P-40), paraphenylene diamine (PPD), pepstatin A, leupeptin, aprotinin, collagenase type 1, hepatocyte medium, primers for Fas (CD95), Bcl-2 and Bax were all procured from Sigma (St. Louis, MO, USA). TUNEL assay kit was purchased from Promega (USA). Rabbit polyclonal antibody against caspase 3, cytochrome C and Bax were purchased from Santa Cruz Biotechnology (USA). Cy5 labeled goat anti-rabbit IgG was from Amersham Biosciences (UK), HRP coupled anti-rabbit IgG was procured from Santa Cruz Biotechnology (USA). RNeasy kit was purchased from Qiagen (USA) and ready to go RT-PCR beads were from Amersham Pharmasia Biotech Inc (NJ, USA). JC-1 and mitotracker CMXRos red were purchased from Molecular Probe, USA. All other chemicals were of analytical grade purity.

In vivo growth of Plasmodium yoelii
Swiss albino mice (20–25 g) were used for the in vivo studies and study design was done in accordance with the institute animal ethical committee guidelines. Animals were inoculated (ip) with P. yoelii (MDR strain) as described earlier (21) . Percent parasitemia was monitored by preparing thin smear of blood and subsequent Giemsa staining.

Measurement of reduced GSH
GSH content of liver from control and P. yoelii infected mice was determined as described (22 23 24) . Liver was homogenized in 10 ml of 20 mM ice-cold EDTA in a Potter-Elvehjem glass homogenizer for 40 s and centrifuged at 105,000 g for 90 min in a Beckman benchtop ultracentrifuge. One ml aliquot of the supernatant was mixed with equal vol of 10% TCA and protein precipitate was removed by centrifugation. The supernatant was added to equal vol of 0.8 M Tris-Cl, pH 9 containing 20 mM DTNB (5–5'- dithionitrobenzoic acid) to yield the yellow chromophore of TNB (thionitrobenzoic acid) which was measured at 412 nm. GSH was used as standard.

Measurement of lipid peroxidation as an index of oxidative damage
Lipid peroxidation products of the mitochondrial membrane fraction of liver homogenate were determined as thiobarbituric acid reactive substances (TBARS) (22 , 23 , 25) . Liver (1 gm) from control or infected mice was homogenized in ice-cold 0.9% saline in Ultra Turrax T25 homogenizer for 45 s to get 10% homogenate. Subcellular fractionation was performed to get mitochondrial fraction. One ml of this fraction was allowed to react with 2 ml of trichloroaceticacid-thiobarbituric acid-HCl reagent containing 0.01% butylated hydroxytolune, heated in a boiling water bath for 15 min, cooled, and centrifuged, and the supernatant was used for thiobarbituric acid-reactive substances determination at 535 nm using tetraethoxypropane as standard (26) . Mitochondrial membrane fraction was used instead of the whole liver homogenate, as the whole liver homogenate contained several nonlipid thiobarbituric acid sensitive materials (27) .

Measurement of protein carbonyl as an index of oxidative damage
Formation of protein carbonyl was measured as a parameter of protein oxidation (23 , 28) . The liver from control or infected mice was homogenized in 50 mM sodium phosphate buffer, pH 7.4 in Ultra Turrax T25 homogenizer for 1 min. to get 10% homogenate. After centrifugation at 600 g for 10 min, the protein from 0.8 ml of the supernatant was precipitated with 5% tricholoroacetic acid and allowed to react with 0.5 ml of 10 mM 2, 4 dinitrophenylhydrazine for 1 h. After precipitation with 10% trichloroaceticacid, the protein was washed thrice with a mixture of ethanol:ethyl acetate (1:1), dissolved in 0.6 ml of a solution containing 6 M guanidine-HCl in 20 mM potassium phosphate adjusted to pH 2.3 with trifluoroaceticacid, and centrifuged, and the supernatant was used for measurement of carbonyl content at 362 nm.

TUNEL assay for DNA fragmentation
To detect apoptosis, in situ DNA fragmentation using TUNEL assay was performed as described in Promega technical bulletin. Briefly paraffin embedded liver sections from both control and infected animals were deparaffinized and then washed with PBS followed by fixation with 4% paraformaldehyde and permeabilized with proteinase K solution. Tissue sections were next incubated with equilibration buffer, biotinylated nucleotide mix and TdT at 37°C for 60 min. The activity of TdT was terminated by addition of 2 x saline-sodium citrate (0.9% NaCl and sodium citrate). The endogenous peroxidase was blocked by 0.3% H2O2. Tissue sections were then incubated with streptavidin HRP solution for 30 min. followed by incubation with substrate. After mounting in 80% glycerol the slides were observed in a light microscope.

Assay of caspase-3 like activity and caspase-8 activity
To study the activation of caspases, caspase-3 like activity and caspase-8 activity were measured in cytosolic fraction of liver tissues, using commercially available kits and according to manufacturer protocol (Sigma, St. Louis, MO, USA). In brief, cytosolic fraction of liver tissues from both control and infected mice was prepared as described earlier (29) . Protein concentration in cytosolic fraction was estimated as described (30) . Equal amount of cytosolic proteins (50 µg) were used for the assay of caspase activity. Cytosol (10 µl containing 50 µg protein) was mixed in a microtiter plate with assay buffer and caspase specific substrates (Ac-DEVD-pNA for caspase-3 and Ac-IETD-pNA for caspase-8). After 4–16 h incubation at 37°C, the absorbance of pNA released as a result of caspase-3 like activity was measured at 405 nM in a microtiter plate reader. For studying caspase-8 activity, release of pNA was measured in a microtiter plate reader at 405 nM as described in technical bulletin. The absorbance of negative control (assay buffer+substrate) was subtracted from specific values. Mean values of triplicate measurements were presented.

Isolation of hepatocyte
Hepatocytes were isolated from control and infected mice (20–25 gm) by the collagenase perfusion (31) with some modifications. Preperfusion of liver was carried at 37°C with buffer containing, 100 mM HEPES (pH 7.4), 143 mM NaCl and 7 mM KCl, followed by perfusion with buffer containing 0.05% collagenase and 5 mM CaCl2. Following digestion, the liver was dispersed in the perfusion solution and further incubated in the perfusion buffer at 37°C for 5 min. The dispersed cell suspension was then filtered through a nylon mesh and centrifugation (100 g, 3 min, at 25°C) to get cell pellet. The final cell pellet was resuspended in the hepatocyte medium and the viability was then determined by trypan blue exclusion test.

Immunocytochemistry of caspase-3
Hepatocytes isolated from control and infected mice as described earlier, were allowed to adhere on poly lysine coated coverslip and fixed with 4% paraformaldehyde for 10 min at 4°C. Cells were washed three times with PBS and incubated in blocking buffer (PBS containing 0.2% Triton X-100 and 10% BSA) for 30 min at 25°C. Coverslip was incubated with caspase-3 antibody (Ab) (1:200 dilution) in blocking buffer overnight at 4°C. Cells were washed with PBS three times and incubated with secondary HRP conjugated Ab (1:200 dilution) in blocking buffer for two hours at 25°C. After the incubation, cells were again washed three times with PBS and color was developed by chromogenic reaction of peroxidase using 3,3'diaminobenzidine (3,3'-diaminobenzidine) and H2O2. After the development of color, cover slips were mounted on a slide using 80% glycerol and images were acquired by light microscopy.

RT-PCR for apoptosis related proteins
Equal amount of liver (30 mg) from control and infected mice (50–60% parasitemia) were used for RNA isolation using the RNeasy kit (Qiagen). The purity of RNA was checked in 1% agarose gel and quantitated by measuring O.D. at 260 nM. Equal amount of RNA (1 µg) was used for RT-PCR using the following sets of primers (provided in expression kit of Sigma, St Louis, MO, USA): Fas (CD95) (forward primer; 5'MAGAAGGGRAGGAGTACA3', reverse primer; 5'TGCACTTGGTATTCTGGGTC3'), Bcl-2 (forward primer; 5/-CCTGTGGATGACTGAGTACC-3/, reverse primer; 5/-GAGACAGCCAGGAGAAATCA-3/), Bax (forward primer; 5/-GTTTCATCCAGGATCGAGCAG-3/, reverse primer, 5/-CATCTTCTTCCAGATGGT-3/). GAPDH, as control (forward primer; 5/-TGCMTCCTGCACCACCAA-3/, M=A or C, reverse primer; 5/- YGCCTGCTTCACCACCTTC-3/ Y=T or C). RT-PCR was performed using ready to go RT-PCR beads (Amersham Pharmasia) with following PCR program: cDNA synthesis at 42°C for 30 min; 94°C for 2 min for initial denaturation; then 35 cycles of denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min; 72°C for 7 min. The amplified DNA was resolved in 12% polyacrylamide gel and documented.

Confocal microscopy for Bax translocation and cytochrome c release
Hepatocytes (1x106 cells) from control and infected mice were incubated with mitotracker Red CMXRos (250 nM) for 30 min in dark at 37°C to stain mitochondria. After staining, cells were washed twice by PBS and adhered on poly- L- lysine coated coverslips. Cells were fixed on the coverslip by adding 4% paraformaldehyde solution for 5 min, followed by a permeabilization step with 0.2% Nonidet P-40 in PBS containing glycine (0.5%) for 20 min. Cells were blocked in PBS containing 3% BSA for 30 min, then incubated with Bax Ab diluted in blocking buffer (1:100 dilution) at 4°C overnight. Cells were washed with blocking buffer and incubated with Cy5 tagged secondary Ab (1:1000) for 5–6 h at 4°C in dark. The cells were then incubated with phalloidin tagged with FITC (1:1000) for 1 h in dark to stain the actin to visualize the contour of the cell. The cover slips were then mounted on slides using 90% glycerol containing 0.025% PPD as antifade. The images were acquired in confocal microscope at respective excitation and emission. The same protocol was followed to study cytochrome c release, except that the cells were incubated with cytochrome c Ab (1:100), in lieu of Bax Ab.

Measurement of mitochondrial membrane potential ({Delta}{psi}m)
The integrity of the inner mitochondrial membrane may be measured by observing the potential gradient across this membrane. This can be achieved by observing the uptake of the cationic carbocyanine dye JC1 into the matrix. Mitochondria isolated from control and infected mice liver using mitochondria isolation kit (Sigma, St. Louis, MO, USA). Isolated mitochondria were incubated with 2 µl JC1 stain (from stock 1mg/ml) and 950 µl JC1 assay buffer (20 mM MOPS, pH 7.5, containing 110 mM KCl, 10 mM ATP, 10 mM MgCl2, 10 mM sodium succinate, and 1 mM EGTA) for 10 min in dark at 25°C. The fluorescence of each sample (total assay vol. 1ml) was recorded in a Perkin Elmer LS50B spectrofluorometer (excitation 490 nm, slit, 5 nm; emission 590 nm, slit, 7.2 nm) (32) .

In vivo measurement of hydroxyl radical
Hydroxy radical (·OH) generated in liver during malarial infection was measured using dimethyl sulfoxide (DMSO) as ·OH scavenger (23 ,33 34 35) . Briefly, there were three groups of animal having 6 animals in each group. The mice from both control group and infected group (50–60% parasitemia) received 200 µl of 25% DMSO (i.p.). The third group constitutes only infected mice with no dose of DMSO, when parasitemia of mice was 50–60%. After sacrificing the animals, liver was dissected out and 20% homogenate was prepared in triple distilled water from each animal and processed for the extraction of methanesulfinic acid formed by the reaction of ·OH with DMSO. Methanesulfinic acid formed was allowed to react it with Fast Blue BB salt and the intensity of the resulting yellow chromophore was measured at 425 nm using benzene-sulfinic acid as standard.

Effect of hydroxyl radical scavengers and spin trap in vivo on oxidative stress and liver apoptosis during malarial infection
Mice (20–25gm) were injected i.p. with different ·OH specific scavengers such as DMSO (500 mg/kg b.w), mannitol (500 mg/kg b.w) and spin trap such as PBN (300 mg/kg b.w) one hour before P. yoelii infection (1.5x106 parasites/mouse). Parasitemia was monitored everyday and all the above-mentioned scavengers and spin trap were administrated to the respective animals daily at doses previously mentioned. On day four of infection, when parasitemia was 50–60%, all the animals (control, infected and scavengers treated) were sacrificed and liver was excised and proceeded for measuring ·OH generation, lipid peroxidation and apoptosis.

Data analysis
All the data were expressed as mean ± SEM The levels of significance were calculated using unpaired Student’s t test and one way ANOVA as applied. P value less than 0.05 (P<0.05) was taken as statistically significant.

RESULTS

Malarial infection induces oxidative stress in liver
To detect oxidative stress in liver during malarial (P. yoelii) infection, measurement of GSH concentration along with lipid and protein oxidation were carried out as shown in Fig. 1 . Significant decrease in GSH concentration (with respect to control as 100%) was found in malaria-infected mice. The decrease of GSH concentration correlated well with the degree of parasitemia. At 5–10% parasitemia, GSH concentration was found to be decreased by 20%, at 20–30% parasitemia, it decreased by 45% (P<0.01), and at 50–60% parasitemia, the value decreased further by 66% (P<0.001). The degree of parasitemia also directly influenced lipid peroxidation, which attained its maximum (148% increment over 100% control, P<0.001) at the highest level of parasitemia. At 20–30% parasitemia, lipid peroxidation attained a 96% increment (P<0.01) and at 5–10% parasitemia there was only 36% increment over the control value. Formation of protein carbonyl, a measure of protein oxidation also correlated well with the percentage of parasitemia, with the highest 112% increment over the control level (100%) at 50–60% parasitemia (P<0.001).


Figure 1
View larger version (39K):
[in this window]
[in a new window]
 
Figure 1. Evidence for oxidative stress in liver of P. yoelii infected mice. Hepatic GSH concentration, lipid peroxidation and protein carbonyl content were measured at different percent of parasitemia as indicated. Results were presented as percent alteration relative to control value as 100%. Bar represented the mean ± SE. (n=6). (*=P<0.05, **=P<0.01, ***=P<0.001 all vs. control).

Malarial infection induces apoptosis in liver
To investigate whether oxidative stress developed by malarial infection can lead to apoptosis in liver, markers for apoptosis such as in situ DNA fragmentation and caspase-3 like protease activation were studied. No apoptotic DNA fragmentation was observed in the liver of uninfected mice (Fig. 2 A, a) as measured by TUNEL assay, whereas, liver from infected mice showed significant DNA fragmentation (Fig. 2A, b ), suggesting incidence of apoptosis. This apoptotic DNA fragmentation pattern was similar to DNase treated positive control tissue section (Fig. 2A, c ). In cytosol of infected liver (Fig. 2B ), there was clear evidence of 10-fold activation of caspase-3 like proteases compared to uninfected cytosol (P<0.001). Moreover, the activity of caspase-3 like proteases was significantly inhibited when infected cytosol was treated with Ac-DEVD-CHO, a potent inhibitor of caspase-3, indicating the specific assay of caspase-3 like proteases. Furthermore, to demonstrate hepatocyte apoptosis, hepatocytes were isolated and purified from uninfected and infected mice (purity 98%) to detect caspase-3 activation by immunocytochemistry using Ab against caspase-3 (Fig. 2C ). The results indicated the absence of activation of caspase-3 like proteases in hepatocyte isolated from the uninfected mice (Fig. 2C, a ) but the liver of infected mice showed tremendous caspase-3 activation (Fig. 2C, b ). Immunocytochemical analysis further confirmed the activation of caspase-3 and occurrence of apoptosis in hepatocytes as a result of malarial infection.


Figure 2
View larger version (66K):
[in this window]
[in a new window]
 
Figure 2. A) Evidence of in situ apoptotic DNA fragmentation in liver during P. yoelii infection, as detected by TUNEL assay. Control (uninfected) liver (a): there was no typical staining for apoptotic DNA fragmentation. Infected liver (b): profuse staining as indicated by black dots, suggesting incidence of typical apoptotic DNA fragmentation. Arrows indicate TUNEL positive cells. DNase-treated control liver (positive control) (c): DNase degraded DNA strands producing nicks, which were utilized by TdT to label with biotinylated dUTP, detected later on by HRP conjugated streptavidin, represented by black spots. B) Activation of caspase-3 like proteases in the liver of P. yoelii-infected mice. The activity of caspase-3 in the cytosolic fraction (50 µg protein) was measured at different times. Caspase-3 activity was expressed as change of OD at 405 nm due to release of pNA. To check the specificity of caspase-3 assay, Ac-DEVD-CHO, a specific inhibitor was added. The data presented are the mean ± SE (n=6). C) Immunocytochemical detection of activated caspase-3 in isolated hepatocytes. Hepatocytes from control (uninfected) (a) and infected (b) mice were used for immunocytochemistry using caspase-3 antibody (against active caspase-3). No activation of caspase-3 was noted in control hepatocytes, whereas hepatocytes from infected mice clearly showed the activation of caspase-3, indicated by black spots (arrows). D) RT-PCR analysis to follow the expression of Bcl-2, Bax, and Fas. Equal amounts of liver RNA (1 µg) from infected or uninfected (control) mice were used for RT-PCR amplification. The amplified products were checked in 12% polyacrylamide gel. The gel photograph is representative of 3 separate experiments. GAPDH was used as internal (positive) control. E) Histogram representing the densitometric analysis of Bcl-2, Bax, and Fas expression (percent relative to control, where control was considered as 100% expression). The data were calculated from 3 separate experiments, and are presented as mean ± SE. (***P<0.001 vs. control). F) Measurement of caspase-8 activity in control as well as in infected mice liver. Pure caspase-8 was used as positive control. Inhibition of caspase-8 activity by caspase-8 specific inhibitor (IETD-CHO) indicated specific assay for caspase-8. The data presented are mean ± SE. Values are presented as pNA release nmol/mg protein/30 min.

Involvement of the mitochondrial pathway for hepatocyte apoptosis during malaria
After detection of apoptosis, we studied the pathways involved in hepatocyte apoptosis during malarial infection. Contribution of mitochondrial pathway is indicated by the change in the expression of antiapoptotic Bcl-2 and apoptotic Bax protein whereas involvement of death receptor pathway is indicated by change of death receptor expression. RT-PCR analyses showed that P. yoelii infection led to down-regulation of Bcl-2 expression by ~60% compared to the control value taken as 100% (P<0.001) (Fig. 2D and E ). Interestingly, there was also significant up-regulation (150% over control, P<0.001) in the expression of Bax in infected liver (Fig 2D, E ). These data indicated the activation of mitochondrial pathway of apoptosis. To understand whether Fas (CD95) related death receptor pathway had any role in malaria infected hepatocyte apoptosis, RT-PCR analysis using Fas (CD95) specific primer and activation of caspase-8, a common event for death receptor mediated pathway were performed. The results indicated that the level of Fas expression in infected liver was same as that of basal level of expression (taken as 100%) in uninfected control mice (Fig. 2D, E ), indicating death receptor (Fas) pathway did not contribute to liver apoptosis during malarial infection. GAPDH expression in liver of both control and infected mice was analyzed as positive control. Besides Fas, there is other member of death receptors, such as TRAIL (Apo-2), which also participates in apoptosis. All the death receptor pathways mediate apoptosis through caspase-8, activation of which in turn activates caspase-3 (36) . Therefore, caspase-8 activation was measured to see the role of other death receptor besides Fas. The results showed no activation of caspase-8 from basal level in cytosolic fraction of liver from infected mice, compared to control value (Fig. 2F ). The assay system was checked using purified caspase-8 and its inhibitor, provided in the caspase-8 assay kit. These findings ruled out the possibility of involvement of other death receptors in liver apoptosis. Thus, it is clear that mitochondrial pathway, not the death receptor-mediated one is operating in the induction of hepatic apoptosis during malarial infection.

Whether reduction in Bcl-2 to Bax ratio could induce Bax activation and translocation to mitochondria, we studied latter by confocal microscopy using anti-Bax Ab as shown in Fig. 3 B. The result indicated that P. yoelii infection increased the translocation of Bax from cytosol to mitochondria, but this translocation was absent in the case of control hepatocytes (Fig. 3A ). Bax translocation to mitochondria might lead to opening of mitochondrial permeability transition pores (MPTP), which in turn may decrease the mitochondrial membrane potential ({psi}m). The latter was therefore studied in mitochondria isolated from liver of P. yoelii infected mice and compared it with the mitochondria from uninfected mice. The change in {psi}m was investigated using membrane potential sensitive dye, JC1 (5,5',6,6'-tetrachloro-1,1',3,3'- tetraethylbenzimidazolcarbocyanine iodide). In intact healthy mitochondria with higher {psi}m, JC1 would be accumulated in mitochondrial matrix to form J-aggregate, showing intense fluorescence at 590 nm. In mitochondria with open transition pores would be at low {psi}m and the accumulation of JC1 would be less in the matrix, leading to less availability of JC1 to form aggregates, showing weak fluorescence at 590 nm. Figure 4 showed that P. yoelii infection induced opening of permeability transition pores and decreased {psi}m, as evidenced from 50% reduction in fluorescence at 590 nm due to JC1 uptake (P<0.001). As opening of MPTP is considered as the main factor for the release of mitochondrial cytochrome c into cytosol to induce apoptosis, we studied the release of cytochrome c through confocal microscopic analysis using cytochrome c Ab (Fig. 5 ). Fig. 5A showed the distribution of cytochrome c exclusively within the mitochondria of control (uninfected) hepatocytes, while, cytochrome c was found to be distributed profusely in the cytosol of infected hepatocytes (Fig. 5B ) indicating the release of cytochrome c from mitochondria to cytosol.


Figure 3
View larger version (35K):
[in this window]
[in a new window]
 
Figure 3. Translocation of Bax from cytosol to mitochondria. Confocal microscopy of hepatocyte isolated from control and infected mice liver. A) Control hepatocytes, (a) first panel (from left), showing green fluorescence represents contour of cells (stained with phalloidin-FITC), (b) second panel, showing red fluorescence represents distribution of mitochondria within the cell (stained with mitotracker red), (c) third panel, showing blue fluorescence represents distribution of Bax, (d) fourth panel, represents merging of all the previous three pictures showing relative distribution of Bax through the cytoplasm. B) Hepatocyte isolated from infected mice liver. (a) first panel (from left), showing green fluorescence represents contour of hepatocytes from infected mice liver, (b) second panel, shows cellular distribution of mitochondria labeled with mitotracker red, (c) third panel, represents distribution of Bax proteins (blue fluorescence), (d) merged panel (right), shows localization of Bax adja- cent to mitochondria.


Figure 4
View larger version (10K):
[in this window]
[in a new window]
 
Figure 4. Malaria infection reduces the mitochondrial transmembrane potential as measured by JC1 uptake. Equal amount of infected and uninfected liver mitochondria (50 µg) was incubated with 2 µg/ml JC1 in dark for 10 min. After incubation, fluorescence was recorded as described under Materials and Methods. The data presented were mean ± SE. (***P<0.001).


Figure 5
View larger version (28K):
[in this window]
[in a new window]
 
Figure 5. Confocal microscopy to detect cytochrome c release in cytoplasm of infected hepatocyte. A) Control hepatocyte. (a) First panel (from left), showing green fluorescence represents contour of control cells (stained with phalloidin-FITC), (b) second panel, showing red fluorescence represents distribution of mitochondria within the cells (stained with mitotracker red), (c) third panel, showing blue fluorescence represents location of cytochrome c, (d) merged panel, represents merging of all the previous three pictures showing relative distribution of cytochrome c within the mitochondria. B) Hepatocyte isolated from infected mice liver. (a) First panel (from left), showing green fluorescence represents contour of hepatocytes from infected mice liver, (b) second panel, showing red fluorescence represents distribution of mitochondria within cells, (c) third panel, represents distribution of cytochrome c throughout the cytosol (blue fluorescence), (d) merged panel, shows leakage of cytochrome c from mitochondria to cytosol.

Hydroxyl radical (·OH) is a possible cause for oxidative stress and apoptosis
After revealing of oxidative stress in liver during malarial infection and induction of apoptosis, we aimed to investigate which particular member of ROS family is responsible for the observed effects. Fig. 6 A showed that P. yoelii infection significantly increased generation of ·OH (200% over control, which was taken as 100%) in the liver of infected mice (P<0.001). Scavenging of ·OH with the administration of ·OH specific scavengers, such as mannitol and spin trap PBN, significantly inhibited the development of oxidative stress, as evidenced from the decreased formation of lipid peroxidation products (P<0.001, P<0.01) (Fig. 6A ). Furthermore, the data indicated that the generation of ·OH correlated well with the formation of lipid peroxide and the inhibition of ·OH also correlated with the inhibition of lipid peroxidation (Fig. 6A ). Thus ·OH generation may be the cause of oxidative stress. To investigate the possible role of ·OH in apoptosis, the effect of ·OH scavengers were studied especially on caspase-3 protease activation during infection. Results clearly indicated that scavenging of ·OH by DMSO, mannitol and PBN attenuated apoptosis significantly, as evidenced from the decreased activities of caspase-3 like proteases (P<0.001) (Fig. 6B ). In the liver of infected mice, caspase-3 like activity was found to be nearly11-fold (Fig. 6B ) higher than control (P<0.001). Treatment with ·OH scavengers reduced it back to 3-fold over the control value.


Figure 6
View larger version (27K):
[in this window]
[in a new window]
 
Figure 6. A) Measurement of ·OH and lipid peroxidation in presence or absence of scavengers during malarial infection. ·OH scavengers and spin trap were administered i.p. at a dose of DMSO (500 mg/kg b.w), mannitol (500 mg/kg b.w) and spin trap such as PBN (300 mg/kg b.w) as described under Materials and Methods. All the animals (control, infected and scavengers-treated) were sacrificed and liver was excised and proceeded for measuring the generation of ·OH and lipid peroxidation. The data presented were mean ± SE. (n=6). (***P<0.001 vs. control, ###P<0.001, ##P<0.01 vs. infected). B) Measurement of caspase-3 activity in presence or absence of DMSO, mannitol, and PBN. All the animals (control, infected, and scavenger-treated) were sacrificed, and liver was excised and processed for measuring caspase-3 activity. The data presented are mean ± SE (n=6). (***P<0.001 vs. control, ###P<0.001 vs. infected). C) RT-PCR analysis to study the effect of scavengers and spin trap on Bcl-2 and Bax expression. Equal amounts of liver RNA (1 µg) from uninfected- (control), infected-, and scavenger-treated (viz., DMSO, mannitol, and PBN) infected mice was used for RT-PCR amplification. The amplified products were then checked in 12% polyacrylamide gel. Histogram represents the densitometric analysis of Bcl-2 and Bax expression (percent relative to control, where control was considered as 100% expression) in the liver. The data presented are mean ± SE (n=6). (***P<0.001 vs. control, ###P<0.001, ##P<0.01 vs. infected). D) Measurement of {psi}m (JC1 uptake) in presence or absence of DMSO mannitol, and PBN. Details of the treatment of ·OH scavengers and PBN are described above. Mitochondria were isolated from liver of control, infected, and treated groups. Equal amounts of mitochondria (50 µg) from each group were used to measure JC1 uptake. Data presented are mean ± SE (n=6). (***P<0.001 vs. control, ###P<0.001 vs. infected).

If ·OH mediated oxidative stress is responsible for the activation of mitochondrial pathway of liver apoptosis, scavenging of ·OH should correct the altered expression of Bcl-2 as well as Bax toward the control level and, as a result the decrease in {psi}m should also return to normal. Interestingly, all the scavengers such as DMSO, mannitol and PBN treatment to infected mice significantly inhibited the down-regulation of Bcl-2 (P<0.001, P<0.001, P<0.01 respectively) and up-regulation of Bax (P<0.001, P<0.001, P<0.01 respectively) (Fig. 6C ). The result further showed that DMSO, mannitol and PBN also significantly restored the {psi}m toward the control value (Fig. 6D ). P. yoelii infection decreased {psi}m, as evidenced from 50% reduction in fluorescence at 590 nm due to JC1 uptake and treatment of scavengers (DMSO, mannitol and PBN) significantly inhibited the decrease of {psi}m (Fig. 6D ). It is thus clear that oxidative stress caused by ·OH triggers the mitochondrial pathway of apoptosis to cause liver damage during malarial infection.

DISCUSSION

In the present study, we have provided evidence that malarial infection can induce apoptosis in liver. The results clearly indicated the role of oxidative stress and the implication of the mitochondrial pathway for liver apoptosis. To our knowledge, this is the first report, which provides mechanistic basis of hepatocyte apoptosis in malarial infection. Plasmodium infection induced oxidative stress in liver as evidenced by the decreased GSH concentration as well as increased formation of lipid peroxidation, and protein carbonyl. The extent of lipid and protein oxidation positively correlated with the percentage of parasitemia, attaining a 2–2.5-fold increment in 50–60% parasitemia. GSH is an excellent and potent endogenous antioxidant, which by scavenging various types of reactive radicals protects the cell from oxidative insults (37) . On encounter with reactive radicals, GSH stores may be depleted, leaving the cells with ‘compromised antioxidant defense system’ against oxidant-induced injury. P. yoelii infection depleted cellular GSH content, attaining a 3 fold decrease at maximum parasitemia. Lowering of cellular GSH content thus indicates generation of large quantity of ROS.

Oxidative stress is known to induce apoptosis in many cellular systems, including liver (12 , 13 , 23) . But apoptosis in liver during malarial infection has been overlooked. However, malaria-induced apoptosis in other cellular systems has been studied in mice (38) , monkeys (39) and human (40) . Dramatic cellular changes take place in the spleen during malarial infection and Fas mediated apoptotic T cells, B cells and macrophages are found in the spleen (38) . In vitro studies with human peripheral blood mononuclear cells from patients with acute Plasmodium falciparum malaria have also demonstrated the incidence of apoptosis (40) . Moreover Plasmodium chabaudi infection in mice induces apoptosis in spleen and thymus (41) . Furthermore, Plasmodium falciparum through the activation of Ca2+-permeable cation channels of host erythrocytes induces apoptosis like alterations and ultimately death of the infected erythrocytes (eryptosis) (42 43 44) . In this study we have detected apoptosis in liver of P. yoelii infected mice through visualization of in situ DNA fragmentation and detection of caspase-3 activation. Caspase-3 activation constitutes the execution phase of apoptosis and mainly two distinct pathways can activate caspase cascade, viz., the death receptor pathway and mitochondrial pathway (16) . P. yoelii infection does not involve death receptor (Fas) mediated pathway during induction of hepatocyte apoptosis. RT-PCR analysis exhibits no such significant alteration of Fas expression in malaria parasite infected hepatocytes in comparison to control. Besides, absence of caspase-8 activation in liver from infected mice further confirms that Fas mediated pathway is not involved in hepatocyte apoptosis. Evidence has been presented to show that in P. yoelii infection there is significant down-regulation of Bcl-2 expression along with the up-regulation of Bax expression, resulting in reduction of Bcl-2 to Bax ratio. The ratio at which these proteins are present intracellularly can determine whether or not a cell undergoes apoptosis (45) . Mitochondrial pathway of apoptosis is initiated by the down-regulation of antiapoptotic proteins e.g., Bcl-2 and BclXL and/or up-regulation, activation and translocation of proapoptotic proteins e.g., Bax, Bak, Bid to mitochondria (18) . Proapoptotic proteins induce apoptosis either by forming pores (mitochondrial permeability transition pores) in mitochondria directly or by binding to antiapoptotic proteins via BH3 domain to antagonizing their antiapoptotic actions (14 , 17) . Opening of mitochondrial transition pores results in release of some apoptotic inducing factors from mitochondria, some of such are cytochrome c, apoptosis inducing factor (AIF), Smac/DIABLO (second mitochondrial derived activator of caspase/Direct IAP binding protein with low pI) etc (17 , 18) . In P. yoelii infection, the absence of Bcl-2 antagonizing action, activates Bax proteins and these activated Bax then translocates to mitochondria, where they induce opening of MPTP, as a result of that mitochondrial membrane permeability increases, leading to decrease in {psi}m. Mitochondrial anomalies and up-regulation of apoptosis inducing proteins such as Bax, p53 have also been reported in mice brain during experimental murine cerebral malaria (46) . Opening of MPTP causes release of cytochrome c from mitochondria to cytosol. Cytochrome c after its release into cytosol, binds with apoptotic protease activating factor 1 (Apaf-1) and forms a macromolecular complex, which activates caspase-9. Activated caspase-9 in turn activates the downstream effector caspase, caspase-3, the main executioner of apoptosis (47 , 48) . Once activated, the effector caspase proteolytically cleaves a broad spectrum of cellular targets leading ultimately to cell death (49) . Evidence has also been presented to show the reduction of {psi}m, release of cytochrome c and activation of caspase-3 in liver of infected mice, but not in liver of control mice.

Generation of ROS and associated oxidative stress has been found to activate mitochondrial pathway of apoptosis (12 , 50) . We have found that P. yoelii infection significantly induces ·OH generation in the liver of infected mice. The data suggest that administration of spin trap (PBN) or ·OH scavengers attenuates P. yoelii infection associated oxidative stress (assayed by lipid peroxidation) as well as apoptosis (as revealed from reduction of caspase-3 like activity), indicating a causative role of ·OH in the initiation of apoptosis. Scavenging of ·OH also significantly inhibits the mitochondrial pathway, as evidenced from the near normal restoration of {psi}m as well as Bcl-2 and Bax expression. Attenuation of apoptosis by scavengers and spin trap therefore may be mediated through the inhibition of mitochondrial pathway. PBN is a well-known spin trap used to trap free radicals in vivo and can be used to detect ·OH due to its spin trapping action (51) .

In the recent past, it has been reported that liver stage of malarial parasite (exoerythrocytic forms) inhibits hepatocyte apoptosis (52) , although sporozoits can induce apoptosis in hepatocytes to a small extent but significantly in some cases (53) . Interestingly, our data provide evidence that blood stages (intraerythrocytic forms) of parasite can induce apoptosis, as these blood stages cannot infect liver. It can be suggested that exoerythrocytic stages of malarial parasite protect host cell from apoptosis for its multiplication and its own benefit, but intraerythrocytic stages of parasite damage liver, when it requires RBC only to continue infection. Therefore, it can reasonably be assumed that it is not the parasite itself, but some metabolites derived from the blood stage of parasite can induce apoptosis through oxidative stress.

We have demonstrated the central role of ·OH mediated oxidative stress in the induction of hepatic apoptosis. But the mechanistic details of the generation of ·OH in P. yoelii infection are not very much clear. Several possibilities may exist for the generation of ·OH. During intraerythrocytic stage, plasmodium proteolytically degrades huge quantities of hemoglobin in the food vacuole, yielding large amount of redox active free heme as by product (54) . Heme while serving as a prosthetic group (protein bound state) performs many important functions (55 , 56) , whereas in free state it is toxic and develops oxidative stress through generation of ROS (57 , 58) . Malaria parasite detoxifies redox active free heme to less toxic hemozoin, a polymer of free heme (59) . However, a high concentration of circulating free heme has been reported during malarial infection (60) . Even hemozoin, which is deposited in liver during malaria, can also exhibit pro-oxidant activity (59 , 61) . Thus ROS may be generated from heme or hemozoin. Alternatively, free heme in mammalian system can be detoxified by hemopexin mediated heme oxygenase pathway to yield equimolar amounts of biliverdin, carbon monoxide (CO) and free iron (Fe2+) (58 , 62) . Fe2+ stimulates up-regulation of ferritin, which helps in the sequestration of Fe2+. There is a relation between intracellular chelatable iron concentration and the synthesis of ferritin. An iron regulatory protein (IRP) binds to ferritin mRNA and inhibits its translation. Cytosolic iron binds to IRP causing release of Fe-IRP complex from ferritin mRNA and initiates translation of ferritin mRNA (63) . However, it is assumed that before its sequestration, the released Fe2+ can cause many deleterious oxidation reactions, such as Fenton reaction, where in presence of H2O2, Fe2+ generates ·OH (64) . It is hypothesized that in malarial infection, an excess quantity of heme is degraded resulting in release of huge amount of Fe2+ causing iron overload which produce large quantities of ROS in malarial infection (65) . Further studies are necessary to confirm it. We can thus conclude that malarial infection augments oxidative stress in liver and oxidative stress through the activation of mitochondrial pathway induces apoptosis (Fig. 7 ) to cause liver damage in malarial infection.


Figure 7
View larger version (65K):
[in this window]
[in a new window]
 
Figure 7. Schematic presentation of oxidative stress induced mitochondrial pathway of apoptosis in liver of malaria infected mice. Scavenging of ·OH by scavengers and spin trap inhibited the mitochondrial pathway of apoptosis. (dotted arrow, unknown pathway, Tbar, inhibition).

ACKNOWLEDGMENTS

We gratefully acknowledge Council of Scientific and Industrial Research (CSIR), New Delhi, for providing grants through CSIR Networked Project [SMM03, (P22)] and offering Senior Research fellowship to Mithu Guha to carry out this work. We thank Kalyan Moitra of Electron Microscopy Unit, CDRI, Lucknow for his help to do confocal microscopy. We also thank Dr. Sudhir Sinha for helpful and valuable suggestions during the course of this work. This report bears CDRI communication No 6902.

Received for publication November 10, 2005. Accepted for publication January 6, 2006.

REFERENCES

  1. Shiff, C. (2002) Integrated approach to malaria control. Clin Microbiol Rev 15,278-293[Abstract/Free Full Text]
  2. Najera, J. A. (2001) Malaria control: achievements, problems and strategies. Parassitologia 43,1-89[Medline]
  3. Sachs, J., Malaney, P. (2002) The economic and social burden of malaria. Nature 415,680-685[CrossRef][Medline]
  4. Abdalla, S. H. (1988) Peripheral blood and bone marrow leucocytes in Gambian children with malaria: numerical changes and evaluation of phagocytosis. Ann Trop Paediatr 8,250-258[Medline]
  5. Perrin, L. H., Mackey, L. J., Miescher, P. A. (1982) The hematology of malaria in man. Semin Hematol 19,70-82[Medline]
  6. Kochar, D. K., Agarwal, P., Kochar, S. K., Jain, R., Rawat, N., Pokharna, R. K., Kachhawa, S., Srivastava, T. (2003) Hepatocyte dysfunction and hepatic encephalopathy in Plasmodium falciparum malaria. Qjm 96,505-512[Abstract/Free Full Text]
  7. Srivastava, A., Khanduri, A., Lakhtakia, S., Pandey, R., Choudhuri, G. (1996) Falciparum malaria with acute liver failure. Trop Gastroenterol 17,172-174[Medline]
  8. Rodriguez-Acosta, A., Finol, H. J., Pulido-Mendez, M., Marquez, A., Andrade, G., Gonzalez, N., Aguilar, I., Giron, M. E., Pinto, A. (1998) Liver ultrastructural pathology in mice infected with Plasmodium berghei. J Submicrosc Cytol Pathol 30,299-307[Medline]
  9. Pabon, A., Carmona, J., Burgos, L. C., Blair, S. (2003) Oxidative stress in patients with non-complicated malaria. Clin Biochem. 36,71-78[CrossRef][Medline]
  10. Clark, I. A., Chaudhri, G., Cowden, W. B. (1989) Some roles of free radicals in malaria. Free Radic Biol Med 6,315-321[CrossRef][Medline]
  11. Siddiqi, N. J., Pandey, V. C. (1999) Studies on hepatic oxidative stress and antioxidant defence systems during arteether treatment of Plasmodium yoelii nigeriensis infected mice. Mol Cell Biochem. 196,169-173[CrossRef][Medline]
  12. Czaja, M. J. (2002) Induction and regulation of hepatocyte apoptosis by oxidative stress. Antioxid Redox Signal 4,759-767[CrossRef][Medline]
  13. Sarafian, T. A., Bredesen, D. E. (1994) Is apoptosis mediated by reactive oxygen species?. Free Radic Res 21,1-8[Medline]
  14. Zimmermann, K. C., Bonzon, C., Green, D. R. (2001) The machinery of programmed cell death. Pharmacol Ther 92,57-70[CrossRef][Medline]
  15. Cande, C., Cecconi, F., Dessen, P., Kroemer, G. (2002) Apoptosis-inducing factor (AIF): key to the conserved caspase-independent pathways of cell death?. J. Cell Sci. 115,4727-4734[Medline]
  16. Ueda, S., Masutani, H., Nakamura, H., Tanaka, T., Ueno, M., Yodoi, J. (2002) Redox control of cell death. Antioxid Redox Signal 4,405-414[CrossRef][Medline]
  17. Jiang, X., Wang, X. (2004) Cytochrome C-mediated apoptosis. Annu. Rev. Biochem. 73,87-106[CrossRef][Medline]
  18. Gulbins, E., Dreschers, S., Bock, J. (2003) Role of mitochondria in apoptosis. Exp Physiol 88,85-90[Abstract]
  19. Quaresma, J. A., Barros, V. L., Fernandes, E. R., Pagliari, C., Takakura, C., da Costa Vasconcelos, P. F., de Andrade, H. F., Jr, Duarte, M. I. (2005) Reconsideration of histopathology and ultrastructural aspects of the human liver in yellow fever. Acta Trop 94,116-127[CrossRef][Medline]
  20. Minana, J. B., Gomez-Cambronero, L., Lloret, A., Pallardo, F. V., Del Olmo, J., Escudero, A., Rodrigo, J. M., Pelliin, A., Vina, J. R., Vina, J., Sastre, J. (2002) Mitochondrial oxidative stress and CD95 ligand: a dual mechanism for hepatocyte apoptosis in chronic alcoholism. Hepatology 35,1205-1214[CrossRef][Medline]
  21. Pandey, A. V., Joshi, R., Tekwani, B. L., Singh, R. L., Chauhan, V. S. (1997) Synthetic peptides corresponding to a repetitive sequence of malarial histidine rich protein bind haem and inhibit haemozoin formation in vitro. Mol Biochem. Parasitol 90,281-287[CrossRef][Medline]
  22. Bandyopadhyay, U., Biswas, K., Chatterjee, R., Bandyopadhyay, D., Chattopadhyay, I., Ganguly, C. K., Chakraborty, T., Bhattacharya, K., Banerjee, R. K. (2002) Gastroprotective effect of Neem (Azadirachta indica) bark extract: possible involvement of H(+)-K(+)-ATPase inhibition and scavenging of hydroxyl radical. Life Sci 71,2845-2865[CrossRef][Medline]
  23. Biswas, K., Bandyopadhyay, U., Chattopadhyay, I., Varadaraj, A., Ali, E., Banerjee, R. K. (2003) A novel antioxidant and antiapoptotic role of omeprazole to block gastric ulcer through scavenging of hydroxyl radical. J. Biol. Chem. 278,10993-11001[Abstract/Free Full Text]
  24. Sedlak, J., Lindsay, R. H. (1968) Estimation of total, protein-bound, and nonprotein sulfhydryl groups in tissue with Ellman’s reagent. Anal. Biochem. 25,192-205[CrossRef][Medline]
  25. Buege, J. A., Aust, S. D. (1978) Microsomal lipid peroxidation. Methods Enzymol. 52,302-310[Medline]
  26. Bhattacharjee, M., Bhattacharjee, S., Gupta, A., Banerjee, R. K. (2002) Critical role of an endogenous gastric peroxidase in controlling oxidative damage in H. pylori-mediated and nonmediated gastric ulcer. Free Radic Biol Med 32,731-743[CrossRef][Medline]
  27. Mak, S., Newton, G. E. (2001) The oxidative stress hypothesis of congestive heart failure: radical thoughts. Chest 120,2035-2046[Medline]
  28. Levine, R. L., Garland, D., Oliver, C. N., Amici, A., Climent, I., Lenz, A. G., Ahn, B. W., Shaltiel, S., Stadtman, E. R. (1990) Determination of carbonyl content in oxidatively modified proteins. Methods Enzymol. 186,464-478[Medline]
  29. Wissing, D., Mouritzen, H., Jaattela, M. (1998) TNF-induced mitochondrial changes and activation of apoptotic proteases are inhibited by A20. Free Radic Biol Med 25,57-65[CrossRef][Medline]
  30. Lowry, O. H., Rosebrough, N. J., Farr, A. L., Randall, R. J. (1951) Protein measurement with the Folin phenol reagent. J. Biol. Chem. 193,265-275[Free Full Text]
  31. Seglen, P. O. (1976) Preparation of isolated rat liver cells. Methods Cell Biol. 13,29-83[Medline]
  32. Cossarizza, A., Baccarani-Contri, M., Kalashnikova, G., Franceschi, C. (1993) A new method for the cytofluorimetric analysis of mitochondrial membrane potential using the J-aggregate forming lipophilic cation 5,5',6,6'-tetrachloro-1,1',3,3'-tetraethylbenzimidazolcarbocyanine iodide (JC-1). Biochem. Biophys. Res. Commun. 197,40-45[CrossRef][Medline]
  33. Das, D., Bandyopadhyay, D., Bhattacharjee, M., Banerjee, R. K. (1997) Hydroxyl radical is the major causative factor in stress-induced gastric ulceration. Free Radic Biol Med 23,8-18[CrossRef][Medline]
  34. Bandyopadhyay, D., Biswas, K., Bandyopadhyay, U., Reiter, R. J., Banerjee, R. K. (2000) Melatonin protects against stress-induced gastric lesions by scavenging the hydroxyl radical. J Pineal Res 29,143-151[CrossRef][Medline]
  35. Babbs, C. F., Steiner, M. G. (1990) Detection and quantitation of hydroxyl radical using dimethyl sulfoxide as molecular probe. Methods Enzymol. 186,137-147[Medline]
  36. Kruidering, M., Evan, G. I. (2000) Caspase-8 in apoptosis: the beginning of "the end"?. IUBMB Life 50,85-90[CrossRef][Medline]
  37. Hayes, J. D., McLellan, L. I. (1999) Glutathione and glutathione-dependent enzymes represent a co-ordinately regulated defence against oxidative stress. Free Radic Res 31,273-300[Medline]
  38. Helmby, H., Jonsson, G., Troye-Blomberg, M. (2000) Cellular changes and apoptosis in the spleens and peripheral blood of mice infected with blood-stage Plasmodium chabaudi chabaudi AS. Infect Immun 68,1485-1490[Abstract/Free Full Text]
  39. Matsumoto, J., Kawai, S., Terao, K., Kirinoki, M., Yasutomi, Y., Aikawa, M., Matsuda, H. (2000) Malaria infection induces rapid elevation of the soluble Fas ligand level in serum and subsequent T lymphocytopenia: possible factors responsible for the differences in susceptibility of two species of Macaca monkeys to Plasmodium coatneyi infection. Infect Immun 68,1183-1188[Abstract/Free Full Text]
  40. Toure-Balde, A., Sarthou, J. L., Aribot, G., Michel, P., Trape, J. F., Rogier, C., Roussilhon, C. (1996) Plasmodium falciparum induces apoptosis in human mononuclear cells. Infect Immun 64,744-750[Abstract]
  41. Sanchez-Torres, L., Rodriguez-Ropon, A., Aguilar-Medina, M., Favila-Castillo, L. (2001) Mouse splenic CD4+ and CD8+ T cells undergo extensive apoptosis during a Plasmodium chabaudi chabaudi AS infection. Parasite Immunol 23,617-626[CrossRef][Medline]
  42. Brand, V. B., Sandu, C. D., Duranton, C., Tanneur, V., Lang, K. S., Huber, S. M., Lang, F. (2003) Dependence of Plasmodium falciparum in vitro growth on the cation permeability of the human host erythrocyte. Cell Physiol Biochem. 13,347-356[CrossRef][Medline]
  43. Lang, F., Lang, P. A., Lang, K. S., Brand, V., Tanneur, V., Duranton, C., Wieder, T., Huber, S. M. (2004) Channel-induced apoptosis of infected host cells-the case of malaria. Pflugers Arch 448,319-324[CrossRef][Medline]
  44. Lang, K. S., Lang, P. A., Bauer, C., Duranton, C., Wieder, T., Huber, S. M., Lang, F. (2005) Mechanisms of suicidal erythrocyte death. Cell Physiol Biochem. 15,195-202[CrossRef][Medline]
  45. Agarwal, M. K., Agarwal, M. L., Athar, M., Gupta, S. (2004) Tocotrienol-rich fraction of palm oil activates p53, modulates Bax/Bcl2 ratio and induces apoptosis independent of cell cycle association. Cell Cycle 3,205-211[Medline]
  46. Kumar, K. A., Babu, P. P. (2002) Mitochondrial anomalies are associated with the induction of intrinsic cell death proteins-Bcl(2), Bax, cytochrome-c and p53 in mice brain during experimental fatal murine cerebral malaria. Neurosci Lett 329,319-323[CrossRef][Medline]
  47. Green, D. R., Reed, J. C. (1998) Mitochondria and apoptosis. Science 281,1309-1312[Abstract/Free Full Text]
  48. Li, P., Nijhawan, D., Budihardjo, I., Srinivasula, S. M., Ahmad, M., Alnemri, E. S., Wang, X. (1997) Cytochrome c and dATP-dependent formation of Apaf-1/caspase-9 complex initiates an apoptotic protease cascade. Cell 91,479-489[CrossRef][Medline]
  49. Shi, Y. (2002) Mechanisms of caspase activation and inhibition during apoptosis. Mol Cell 9,459-470[CrossRef][Medline]
  50. Simon, H. U., Haj-Yehia, A., Levi-Schaffer, F. (2000) Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 5,415-418[CrossRef][Medline]
  51. Burkitt, M. J., Mason, R. P. (1991) Direct evidence for in vivo hydroxyl-radical generation in experimental iron overload: an ESR spin-trapping investigation. Proc. Natl. Acad. Sci. U. S. A. 88,8440-8444[Abstract/Free Full Text]
  52. van de Sand, C., Horstmann, S., Schmidt, A., Sturm, A., Bolte, S., Krueger, A., Lutgehetmann, M., Pollok, J. M., Libert, C., Heussler, V. T. (2005) The liver stage of Plasmodium berghei inhibits host cell apoptosis. Mol Microbiol 58,731-742[CrossRef][Medline]
  53. Leiriao, P., Mota, M. M., Rodriguez, A. (2005) Apoptotic Plasmodium-infected hepatocytes provide antigens to liver dendritic cells. J Infect Dis 191,1576-1581[CrossRef][Medline]
  54. Sherman, I. W. (1998) Malaria: Parasite biology, pathogenesis, and protection ASM Press Washington, DC.
  55. Ponka, P. (1999) Cell biology of heme. Am J Med Sci 318,241-256[CrossRef][Medline]
  56. Bandyopadhyay, U., Chatterjee, R., Chakraborty, T. K., Ganguly, C. K., Bhattacharyya, D. K., Banerjee, R. K. (1997) Activation of parietal cell by mercaptomethylimidazole: a novel inducer of gastric acid secretion. Biochem. Pharmacol 54,241-248[CrossRef][Medline]
  57. Jeney, V., Balla, J., Yachie, A., Varga, Z., Vercellotti, G. M., Eaton, J. W., Balla, G. (2002) Pro-oxidant and cytotoxic effects of circulating heme. Blood 100,879-887[Abstract/Free Full Text]
  58. Kumar, S., Bandyopadhyay, U. (2005) Free heme toxicity and its detoxification systems in human. Toxicol Lett 157,175-188[CrossRef][Medline]
  59. Omodeo-Sale, F., Monti, D., Olliaro, P., Taramelli, D. (2001) Prooxidant activity of beta-hematin (synthetic malaria pigment) in arachidonic acid micelles and phospholipid large unilamellar vesicles. Biochem. Pharmacol 61,999-1009[CrossRef][Medline]
  60. Arruda, M. A., Rossi, A. G., de Freitas, M. S., Barja-Fidalgo, C., Graca-Souza, A. V. (2004) Heme inhibits human neutrophil apoptosis: involvement of phosphoinositide 3-kinase, MAPK, and NF-kappaB. J. Immunol. 173,2023-2030[Abstract/Free Full Text]
  61. Oliveira, M. F., Timm, B. L., Machado, E. A., Miranda, K., Attias, M., Silva, J. R., Dansa-Petretski, M., de Oliveira, M. A., de Souza, W., Pinhal, N. M., Sousa, J. J., Vugman, N. V., Oliveira, P. L. (2002) On the pro-oxidant effects of haemozoin. FEBS Lett. 512,139-144[CrossRef][Medline]
  62. Maines, M. D. (1988) Heme oxygenase: function, multiplicity, regulatory mechanisms, and clinical applications. Faseb J 2,2557-2568[Abstract]
  63. Eisenstein, R. S., Munro, H. N. (1990) Translational regulation of ferritin synthesis by iron. Enzyme 44,42-58[Medline]
  64. Ryter, S. W., Tyrrell, R. M. (2000) The heme synthesis and degradation pathways: role in oxidant sensitivity. Heme oxygenase has both pro- and antioxidant properties. Free Radic Biol Med 28,289-309[CrossRef][Medline]
  65. Erel, O., Kocyigit, A., Avci, S., Aktepe, N., Bulut, V. (1997) Oxidative stress and antioxidative status of plasma and erythrocytes in patients with vivax malaria. Clin Biochem. 30,631-639[CrossRef][Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
P. Maity, S. Bindu, V. Choubey, A. Alam, K. Mitra, M. Goyal, S. Dey, M. Guha, C. Pal, and U. Bandyopadhyay
Lansoprazole Protects and Heals Gastric Mucosa from Non-steroidal Anti-inflammatory Drug (NSAID)-induced Gastropathy by Inhibiting Mitochondrial as Well as Fas-mediated Death Pathways with Concurrent Induction of Mucosal Cell Renewal
J. Biol. Chem., May 23, 2008; 283(21): 14391 - 14401.
[Abstract] [Full Text] [PDF]


Home page
Hum Reprod UpdateHome page
K. Tremellen
Oxidative stress and male infertility--a clinical perspective
Hum. Reprod. Update, May 1, 2008; 14(3): 243 - 258.
[Abstract] [Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
S. Kumar, S. K. Das, S. Dey, P. Maity, M. Guha, V. Choubey, G. Panda, and U. Bandyopadhyay
Antiplasmodial Activity of [(Aryl)arylsulfanylmethyl]Pyridine
Antimicrob. Agents Chemother., February 1, 2008; 52(2): 705 - 715.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
M. S. M. Oakley, S. Kumar, V. Anantharaman, H. Zheng, B. Mahajan, J. D. Haynes, J. K. Moch, R. Fairhurst, T. F. McCutchan, and L. Aravind
Molecular Factors and Biochemical Pathways Induced by Febrile Temperature in Intraerythrocytic Plasmodium falciparum Parasites
Infect. Immun., April 1, 2007; 75(4): 2012 - 2025.
[Abstract] [Full Text] [PDF]
<