|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Division of Drug Target Discovery and Development, Central Drug Research Institute, Chatter Manzil Palace, Mahatma Gandhi Marg, Uttar Pradesh, India
1Correspondence: Division of Drug Target Discovery and Development, Central Drug Research Institute, Chatter Manzil Palace, Mahatma Gandhi Marg, Lucknow-226001, Uttar Pradesh, India. E-mail: ubandyo_1964{at}yahoo.com
ABSTRACT
Hepatic dysfunction is a common clinical complication in malaria, although its pathogenesis remains largely unknown. Using a variety of in vivo and ex vivo approaches, we have shown for the first time that malarial infection induces hepatic apoptosis through augmentation of oxidative stress. Apoptosis in hepatocyte has been confirmed by terminal deoxynucleotidyl transferase (TdT)-mediated dUTP-biotin-nick-end labeling assay (TUNEL) and caspase-3 activation. Gene expression analysis using RT-PCR indicates the significant down-regulation of Bcl-2 and up-regulation of Bax expression in liver of malaria infected mice suggesting the involvement of mitochondrial pathway of apoptosis. The levels of Fas expression and caspase-8 activity in infected liver were same as that of uninfected control mice indicating death receptor (Fas) pathway did not contribute to liver apoptosis during malarial infection. Moreover, evidence has been presented by confocal microscopy to show the translocation of Bax from cytosol to mitochondria in apoptotic hepatocyte, resulting in opening of permeability transition pores, which in turn decreases mitochondrial membrane potential and induces cytochrome c release into cytosol. Malarial infection induces the generation of hydroxyl radical (·OH) in liver, which may be responsible for the induction of oxidative stress and apoptosis as administration of ·OH specific antioxidant as well as spin trap, alpha-phenyl-tert-butyl-nitrone in malaria-infected mice significantly inhibits the development of oxidative stress as well as induction of apoptosis. Thus, results suggest the implication of oxidative stress induced-mitochondrial pathway of apoptosis in the pathophysiology of hepatic dysfunction in malaria.Guha, M., Kumar, S., Choubey, V., Maity, P., Bandyopadhyay, U. Apoptosis in liver during malaria: Role of oxidative stress and implication of mitochondrial pathway.
Key Words: malaria Plasmodium yoelii apoptosis oxidative stress
MALARIA IS ONE of the most devastating diseases of the world, particularly in tropical countries (1
, 2)
. Annually, around 300500 million of people get affected with this disease worldwide and of them
13 million die (3)
. Despite significant progress in the treatment of malaria, this disease has staged a huge comeback in large areas of the world, due to the development of drug-resistant parasites (1
, 2)
. Malarial infection develops serious systemic complications such as hematological abnormalities (4
, 5)
, splenomegaly and hepatitis (6)
. There is strong evidence of hepatic dysfunction in malarial infection (6)
. The histopathological changes occurring in the liver of malaria patients include heapatocyte necrosis, cholestasis, bile stasis, granulomatous lesions and malarial nodules (7
, 8)
. It is assumed that pathological changes in liver during malarial infection contribute significantly in the development of hepatic dysfunction and other systemic complications (6)
. However, the pathogenesis underlying the hepatic damage and associated dysfunction are largely unknown.
The role of oxidative stress during malarial infection needs clear illumination, as some have demonstrated a protective role while other suggested relation with malarial pathophysiology and complication (9)
. However, recent reports suggest that generation of reactive oxygen species (ROS) and associated oxidative stress play crucial role in the development of systemic complications in malaria (9)
. Malarial infection decreases the levels of antioxidant enzymes and other antioxidants such as catalase, glutathione (GSH) peroxidase, superoxide dismutase, albumin, GSH, ascorbate and plasma tocopherol (10)
. Plasmodium infection in mice increases the activity of xanthine oxidase and lipid peroxide content in liver, indicating development of hepatic oxidative stress in malaria (11)
. However, there is no clear idea on the identity of the reactive species of ROS family involved in the development of oxidative stress.
ROS, in addition to imparting oxidative insult by damaging structural and functional components of cellular systems, is also able to induce apoptosis (12
, 13)
. Apoptosis, the programmed death of cells is linked intimately with both physiology as well as pathology in variety of cellular systems (14)
. Apoptosis may be either caspase dependent or caspase independent (15)
. The caspase-dependent apoptosis is mainly mediated through two distinct pathways, viz., the death receptor pathway (extrinsic) and the mitochondrial pathway (intrinsic). The death receptor pathway is comprising Fas (CD95/Apo-1) and TRAIL (Apo-2) and this pathway is activated when ligands specific for either Fas or TRAIL bind to their respective receptors, resulting in activation of caspase-8, which finally activates caspase-3 (16)
. On the other hand mitochondrial pathway of apoptosis is initiated by the down-regulation of antiapoptotic proteins (such as, Bcl-2, BclxL) and/or up-regulation of pro-apoptotic proteins (such as, Bax, Bad, Bid), resulting in opening of mitochondrial permeability transition pores and release of apoptosis inducing proteins (cytochrome c, apoptosis inducing factor etc.) from mitochondria (14
, 17
, 18)
. Evidence of hepatocyte apoptosis especially during oxidative stress is common in different infectious and noninfections diseases (12
, 19
, 20)
. However, so far studies regarding apoptosis in liver have been overlooked in malarial infection. We aimed to identify the mechanisms underlying hepatic pathology in malaria and the significance of two conventional pathways of cell injury, viz., oxidative stress and apoptosis in this hepatic damage. In the present study, we have shown for the first time that malarial infection induces apoptosis in liver through the development of oxidative stress and ·OH is shown to be the causative agent for oxidative stress. Treatment with ·OH scavengers attenuates hepatic oxidative stress as well as apoptosis. Moreover, our findings implicate the role of the mitochondrial pathway for the induction of apoptosis in liver by oxidative stress during malarial infection.
MATERIALS AND METHODS
MATERIALS
5,5'-Dithio-bis (2-nitrobenzoic acid) (DTNB), GSH, thiobarbituric acid (TBA), trichloro acetic acid (TCA), tetraethoxypropane, dinitrophenylhydrazine, guanidine hydrochloride, trifluoroacetic acid, mitochondria isolation kit, caspase assay kit, Triton X-100, diaminobenzidine, phalloidin-FITC, proteinase K, mannitol, DMSO, alpha-phenyl-tert-butyl-nitrone (PBN), DEVD-pNA, paraformaldehyde, Nonidet P-40 (Nonidet P-40), paraphenylene diamine (PPD), pepstatin A, leupeptin, aprotinin, collagenase type 1, hepatocyte medium, primers for Fas (CD95), Bcl-2 and Bax were all procured from Sigma (St. Louis, MO, USA). TUNEL assay kit was purchased from Promega (USA). Rabbit polyclonal antibody against caspase 3, cytochrome C and Bax were purchased from Santa Cruz Biotechnology (USA). Cy5 labeled goat anti-rabbit IgG was from Amersham Biosciences (UK), HRP coupled anti-rabbit IgG was procured from Santa Cruz Biotechnology (USA). RNeasy kit was purchased from Qiagen (USA) and ready to go RT-PCR beads were from Amersham Pharmasia Biotech Inc (NJ, USA). JC-1 and mitotracker CMXRos red were purchased from Molecular Probe, USA. All other chemicals were of analytical grade purity.
In vivo growth of Plasmodium yoelii
Swiss albino mice (2025 g) were used for the in vivo studies and study design was done in accordance with the institute animal ethical committee guidelines. Animals were inoculated (ip) with P. yoelii (MDR strain) as described earlier (21)
. Percent parasitemia was monitored by preparing thin smear of blood and subsequent Giemsa staining.
Measurement of reduced GSH
GSH content of liver from control and P. yoelii infected mice was determined as described (22
23
24)
. Liver was homogenized in 10 ml of 20 mM ice-cold EDTA in a Potter-Elvehjem glass homogenizer for 40 s and centrifuged at 105,000 g for 90 min in a Beckman benchtop ultracentrifuge. One ml aliquot of the supernatant was mixed with equal vol of 10% TCA and protein precipitate was removed by centrifugation. The supernatant was added to equal vol of 0.8 M Tris-Cl, pH 9 containing 20 mM DTNB (55'- dithionitrobenzoic acid) to yield the yellow chromophore of TNB (thionitrobenzoic acid) which was measured at 412 nm. GSH was used as standard.
Measurement of lipid peroxidation as an index of oxidative damage
Lipid peroxidation products of the mitochondrial membrane fraction of liver homogenate were determined as thiobarbituric acid reactive substances (TBARS) (22
, 23
, 25)
. Liver (1 gm) from control or infected mice was homogenized in ice-cold 0.9% saline in Ultra Turrax T25 homogenizer for 45 s to get 10% homogenate. Subcellular fractionation was performed to get mitochondrial fraction. One ml of this fraction was allowed to react with 2 ml of trichloroaceticacid-thiobarbituric acid-HCl reagent containing 0.01% butylated hydroxytolune, heated in a boiling water bath for 15 min, cooled, and centrifuged, and the supernatant was used for thiobarbituric acid-reactive substances determination at 535 nm using tetraethoxypropane as standard (26)
. Mitochondrial membrane fraction was used instead of the whole liver homogenate, as the whole liver homogenate contained several nonlipid thiobarbituric acid sensitive materials (27)
.
Measurement of protein carbonyl as an index of oxidative damage
Formation of protein carbonyl was measured as a parameter of protein oxidation (23
, 28)
. The liver from control or infected mice was homogenized in 50 mM sodium phosphate buffer, pH 7.4 in Ultra Turrax T25 homogenizer for 1 min. to get 10% homogenate. After centrifugation at 600 g for 10 min, the protein from 0.8 ml of the supernatant was precipitated with 5% tricholoroacetic acid and allowed to react with 0.5 ml of 10 mM 2, 4 dinitrophenylhydrazine for 1 h. After precipitation with 10% trichloroaceticacid, the protein was washed thrice with a mixture of ethanol:ethyl acetate (1:1), dissolved in 0.6 ml of a solution containing 6 M guanidine-HCl in 20 mM potassium phosphate adjusted to pH 2.3 with trifluoroaceticacid, and centrifuged, and the supernatant was used for measurement of carbonyl content at 362 nm.
TUNEL assay for DNA fragmentation
To detect apoptosis, in situ DNA fragmentation using TUNEL assay was performed as described in Promega technical bulletin. Briefly paraffin embedded liver sections from both control and infected animals were deparaffinized and then washed with PBS followed by fixation with 4% paraformaldehyde and permeabilized with proteinase K solution. Tissue sections were next incubated with equilibration buffer, biotinylated nucleotide mix and TdT at 37°C for 60 min. The activity of TdT was terminated by addition of 2 x saline-sodium citrate (0.9% NaCl and sodium citrate). The endogenous peroxidase was blocked by 0.3% H2O2. Tissue sections were then incubated with streptavidin HRP solution for 30 min. followed by incubation with substrate. After mounting in 80% glycerol the slides were observed in a light microscope.
Assay of caspase-3 like activity and caspase-8 activity
To study the activation of caspases, caspase-3 like activity and caspase-8 activity were measured in cytosolic fraction of liver tissues, using commercially available kits and according to manufacturer protocol (Sigma, St. Louis, MO, USA). In brief, cytosolic fraction of liver tissues from both control and infected mice was prepared as described earlier (29)
. Protein concentration in cytosolic fraction was estimated as described (30)
. Equal amount of cytosolic proteins (50 µg) were used for the assay of caspase activity. Cytosol (10 µl containing 50 µg protein) was mixed in a microtiter plate with assay buffer and caspase specific substrates (Ac-DEVD-pNA for caspase-3 and Ac-IETD-pNA for caspase-8). After 416 h incubation at 37°C, the absorbance of pNA released as a result of caspase-3 like activity was measured at 405 nM in a microtiter plate reader. For studying caspase-8 activity, release of pNA was measured in a microtiter plate reader at 405 nM as described in technical bulletin. The absorbance of negative control (assay buffer+substrate) was subtracted from specific values. Mean values of triplicate measurements were presented.
Isolation of hepatocyte
Hepatocytes were isolated from control and infected mice (2025 gm) by the collagenase perfusion (31)
with some modifications. Preperfusion of liver was carried at 37°C with buffer containing, 100 mM HEPES (pH 7.4), 143 mM NaCl and 7 mM KCl, followed by perfusion with buffer containing 0.05% collagenase and 5 mM CaCl2. Following digestion, the liver was dispersed in the perfusion solution and further incubated in the perfusion buffer at 37°C for 5 min. The dispersed cell suspension was then filtered through a nylon mesh and centrifugation (100 g, 3 min, at 25°C) to get cell pellet. The final cell pellet was resuspended in the hepatocyte medium and the viability was then determined by trypan blue exclusion test.
Immunocytochemistry of caspase-3
Hepatocytes isolated from control and infected mice as described earlier, were allowed to adhere on poly lysine coated coverslip and fixed with 4% paraformaldehyde for 10 min at 4°C. Cells were washed three times with PBS and incubated in blocking buffer (PBS containing 0.2% Triton X-100 and 10% BSA) for 30 min at 25°C. Coverslip was incubated with caspase-3 antibody (Ab) (1:200 dilution) in blocking buffer overnight at 4°C. Cells were washed with PBS three times and incubated with secondary HRP conjugated Ab (1:200 dilution) in blocking buffer for two hours at 25°C. After the incubation, cells were again washed three times with PBS and color was developed by chromogenic reaction of peroxidase using 3,3'diaminobenzidine (3,3'-diaminobenzidine) and H2O2. After the development of color, cover slips were mounted on a slide using 80% glycerol and images were acquired by light microscopy.
RT-PCR for apoptosis related proteins
Equal amount of liver (30 mg) from control and infected mice (5060% parasitemia) were used for RNA isolation using the RNeasy kit (Qiagen). The purity of RNA was checked in 1% agarose gel and quantitated by measuring O.D. at 260 nM. Equal amount of RNA (1 µg) was used for RT-PCR using the following sets of primers (provided in expression kit of Sigma, St Louis, MO, USA): Fas (CD95) (forward primer; 5'MAGAAGGGRAGGAGTACA3', reverse primer; 5'TGCACTTGGTATTCTGGGTC3'), Bcl-2 (forward primer; 5/-CCTGTGGATGACTGAGTACC-3/, reverse primer; 5/-GAGACAGCCAGGAGAAATCA-3/), Bax (forward primer; 5/-GTTTCATCCAGGATCGAGCAG-3/, reverse primer, 5/-CATCTTCTTCCAGATGGT-3/). GAPDH, as control (forward primer; 5/-TGCMTCCTGCACCACCAA-3/, M=A or C, reverse primer; 5/- YGCCTGCTTCACCACCTTC-3/ Y=T or C). RT-PCR was performed using ready to go RT-PCR beads (Amersham Pharmasia) with following PCR program: cDNA synthesis at 42°C for 30 min; 94°C for 2 min for initial denaturation; then 35 cycles of denaturation at 94°C for 1 min; annealing at 55°C for 1 min; extension at 72°C for 1.5 min; 72°C for 7 min. The amplified DNA was resolved in 12% polyacrylamide gel and documented.
Confocal microscopy for Bax translocation and cytochrome c release
Hepatocytes (1x106 cells) from control and infected mice were incubated with mitotracker Red CMXRos (250 nM) for 30 min in dark at 37°C to stain mitochondria. After staining, cells were washed twice by PBS and adhered on poly- L- lysine coated coverslips. Cells were fixed on the coverslip by adding 4% paraformaldehyde solution for 5 min, followed by a permeabilization step with 0.2% Nonidet P-40 in PBS containing glycine (0.5%) for 20 min. Cells were blocked in PBS containing 3% BSA for 30 min, then incubated with Bax Ab diluted in blocking buffer (1:100 dilution) at 4°C overnight. Cells were washed with blocking buffer and incubated with Cy5 tagged secondary Ab (1:1000) for 56 h at 4°C in dark. The cells were then incubated with phalloidin tagged with FITC (1:1000) for 1 h in dark to stain the actin to visualize the contour of the cell. The cover slips were then mounted on slides using 90% glycerol containing 0.025% PPD as antifade. The images were acquired in confocal microscope at respective excitation and emission. The same protocol was followed to study cytochrome c release, except that the cells were incubated with cytochrome c Ab (1:100), in lieu of Bax Ab.
Measurement of mitochondrial membrane potential (
m)
The integrity of the inner mitochondrial membrane may be measured by observing the potential gradient across this membrane. This can be achieved by observing the uptake of the cationic carbocyanine dye JC1 into the matrix. Mitochondria isolated from control and infected mice liver using mitochondria isolation kit (Sigma, St. Louis, MO, USA). Isolated mitochondria were incubated with 2 µl JC1 stain (from stock 1mg/ml) and 950 µl JC1 assay buffer (20 mM MOPS, pH 7.5, containing 110 mM KCl, 10 mM ATP, 10 mM MgCl2, 10 mM sodium succinate, and 1 mM EGTA) for 10 min in dark at 25°C. The fluorescence of each sample (total assay vol. 1ml) was recorded in a Perkin Elmer LS50B spectrofluorometer (excitation 490 nm, slit, 5 nm; emission 590 nm, slit, 7.2 nm) (32)
.
In vivo measurement of hydroxyl radical
Hydroxy radical (·OH) generated in liver during malarial infection was measured using dimethyl sulfoxide (DMSO) as ·OH scavenger (23
,33
34
35)
. Briefly, there were three groups of animal having 6 animals in each group. The mice from both control group and infected group (5060% parasitemia) received 200 µl of 25% DMSO (i.p.). The third group constitutes only infected mice with no dose of DMSO, when parasitemia of mice was 5060%. After sacrificing the animals, liver was dissected out and 20% homogenate was prepared in triple distilled water from each animal and processed for the extraction of methanesulfinic acid formed by the reaction of ·OH with DMSO. Methanesulfinic acid formed was allowed to react it with Fast Blue BB salt and the intensity of the resulting yellow chromophore was measured at 425 nm using benzene-sulfinic acid as standard.
Effect of hydroxyl radical scavengers and spin trap in vivo on oxidative stress and liver apoptosis during malarial infection
Mice (2025gm) were injected i.p. with different ·OH specific scavengers such as DMSO (500 mg/kg b.w), mannitol (500 mg/kg b.w) and spin trap such as PBN (300 mg/kg b.w) one hour before P. yoelii infection (1.5x106 parasites/mouse). Parasitemia was monitored everyday and all the above-mentioned scavengers and spin trap were administrated to the respective animals daily at doses previously mentioned. On day four of infection, when parasitemia was 5060%, all the animals (control, infected and scavengers treated) were sacrificed and liver was excised and proceeded for measuring ·OH generation, lipid peroxidation and apoptosis.
Data analysis
All the data were expressed as mean ± SEM The levels of significance were calculated using unpaired Students t test and one way ANOVA as applied. P value less than 0.05 (P<0.05) was taken as statistically significant.
RESULTS
Malarial infection induces oxidative stress in liver
To detect oxidative stress in liver during malarial (P. yoelii) infection, measurement of GSH concentration along with lipid and protein oxidation were carried out as shown in Fig. 1
. Significant decrease in GSH concentration (with respect to control as 100%) was found in malaria-infected mice. The decrease of GSH concentration correlated well with the degree of parasitemia. At 510% parasitemia, GSH concentration was found to be decreased by 20%, at 2030% parasitemia, it decreased by 45% (P<0.01), and at 5060% parasitemia, the value decreased further by 66% (P<0.001). The degree of parasitemia also directly influenced lipid peroxidation, which attained its maximum (148% increment over 100% control, P<0.001) at the highest level of parasitemia. At 2030% parasitemia, lipid peroxidation attained a 96% increment (P<0.01) and at 510% parasitemia there was only 36% increment over the control value. Formation of protein carbonyl, a measure of protein oxidation also correlated well with the percentage of parasitemia, with the highest 112% increment over the control level (100%) at 5060% parasitemia (P<0.001).
|
Malarial infection induces apoptosis in liver
To investigate whether oxidative stress developed by malarial infection can lead to apoptosis in liver, markers for apoptosis such as in situ DNA fragmentation and caspase-3 like protease activation were studied. No apoptotic DNA fragmentation was observed in the liver of uninfected mice (Fig. 2
A, a) as measured by TUNEL assay, whereas, liver from infected mice showed significant DNA fragmentation (Fig. 2A, b
), suggesting incidence of apoptosis. This apoptotic DNA fragmentation pattern was similar to DNase treated positive control tissue section (Fig. 2A, c
). In cytosol of infected liver (Fig. 2B
), there was clear evidence of 10-fold activation of caspase-3 like proteases compared to uninfected cytosol (P<0.001). Moreover, the activity of caspase-3 like proteases was significantly inhibited when infected cytosol was treated with Ac-DEVD-CHO, a potent inhibitor of caspase-3, indicating the specific assay of caspase-3 like proteases. Furthermore, to demonstrate hepatocyte apoptosis, hepatocytes were isolated and purified from uninfected and infected mice (purity 98%) to detect caspase-3 activation by immunocytochemistry using Ab against caspase-3 (Fig. 2C
). The results indicated the absence of activation of caspase-3 like proteases in hepatocyte isolated from the uninfected mice (Fig. 2C, a
) but the liver of infected mice showed tremendous caspase-3 activation (Fig. 2C, b
). Immunocytochemical analysis further confirmed the activation of caspase-3 and occurrence of apoptosis in hepatocytes as a result of malarial infection.
|
Involvement of the mitochondrial pathway for hepatocyte apoptosis during malaria
After detection of apoptosis, we studied the pathways involved in hepatocyte apoptosis during malarial infection. Contribution of mitochondrial pathway is indicated by the change in the expression of antiapoptotic Bcl-2 and apoptotic Bax protein whereas involvement of death receptor pathway is indicated by change of death receptor expression. RT-PCR analyses showed that P. yoelii infection led to down-regulation of Bcl-2 expression by
60% compared to the control value taken as 100% (P<0.001) (Fig. 2D and E
). Interestingly, there was also significant up-regulation (150% over control, P<0.001) in the expression of Bax in infected liver (Fig 2D, E
). These data indicated the activation of mitochondrial pathway of apoptosis. To understand whether Fas (CD95) related death receptor pathway had any role in malaria infected hepatocyte apoptosis, RT-PCR analysis using Fas (CD95) specific primer and activation of caspase-8, a common event for death receptor mediated pathway were performed. The results indicated that the level of Fas expression in infected liver was same as that of basal level of expression (taken as 100%) in uninfected control mice (Fig. 2D, E
), indicating death receptor (Fas) pathway did not contribute to liver apoptosis during malarial infection. GAPDH expression in liver of both control and infected mice was analyzed as positive control. Besides Fas, there is other member of death receptors, such as TRAIL (Apo-2), which also participates in apoptosis. All the death receptor pathways mediate apoptosis through caspase-8, activation of which in turn activates caspase-3 (36)
. Therefore, caspase-8 activation was measured to see the role of other death receptor besides Fas. The results showed no activation of caspase-8 from basal level in cytosolic fraction of liver from infected mice, compared to control value (Fig. 2F
). The assay system was checked using purified caspase-8 and its inhibitor, provided in the caspase-8 assay kit. These findings ruled out the possibility of involvement of other death receptors in liver apoptosis. Thus, it is clear that mitochondrial pathway, not the death receptor-mediated one is operating in the induction of hepatic apoptosis during malarial infection.
Whether reduction in Bcl-2 to Bax ratio could induce Bax activation and translocation to mitochondria, we studied latter by confocal microscopy using anti-Bax Ab as shown in Fig. 3
B. The result indicated that P. yoelii infection increased the translocation of Bax from cytosol to mitochondria, but this translocation was absent in the case of control hepatocytes (Fig. 3A
). Bax translocation to mitochondria might lead to opening of mitochondrial permeability transition pores (MPTP), which in turn may decrease the mitochondrial membrane potential (
m). The latter was therefore studied in mitochondria isolated from liver of P. yoelii infected mice and compared it with the mitochondria from uninfected mice. The change in
m was investigated using membrane potential sensitive dye, JC1 (5,5',6,6'-tetrachloro-1,1',3,3'- tetraethylbenzimidazolcarbocyanine iodide). In intact healthy mitochondria with higher
m, JC1 would be accumulated in mitochondrial matrix to form J-aggregate, showing intense fluorescence at 590 nm. In mitochondria with open transition pores would be at low
m and the accumulation of JC1 would be less in the matrix, leading to less availability of JC1 to form aggregates, showing weak fluorescence at 590 nm. Figure 4
showed that P. yoelii infection induced opening of permeability transition pores and decreased
m, as evidenced from 50% reduction in fluorescence at 590 nm due to JC1 uptake (P<0.001). As opening of MPTP is considered as the main factor for the release of mitochondrial cytochrome c into cytosol to induce apoptosis, we studied the release of cytochrome c through confocal microscopic analysis using cytochrome c Ab (Fig. 5
). Fig. 5A
showed the distribution of cytochrome c exclusively within the mitochondria of control (uninfected) hepatocytes, while, cytochrome c was found to be distributed profusely in the cytosol of infected hepatocytes (Fig. 5B
) indicating the release of cytochrome c from mitochondria to cytosol.
|
|
|
Hydroxyl radical (·OH) is a possible cause for oxidative stress and apoptosis
After revealing of oxidative stress in liver during malarial infection and induction of apoptosis, we aimed to investigate which particular member of ROS family is responsible for the observed effects. Fig. 6
A showed that P. yoelii infection significantly increased generation of ·OH (200% over control, which was taken as 100%) in the liver of infected mice (P<0.001). Scavenging of ·OH with the administration of ·OH specific scavengers, such as mannitol and spin trap PBN, significantly inhibited the development of oxidative stress, as evidenced from the decreased formation of lipid peroxidation products (P<0.001, P<0.01) (Fig. 6A
). Furthermore, the data indicated that the generation of ·OH correlated well with the formation of lipid peroxide and the inhibition of ·OH also correlated with the inhibition of lipid peroxidation (Fig. 6A
). Thus ·OH generation may be the cause of oxidative stress. To investigate the possible role of ·OH in apoptosis, the effect of ·OH scavengers were studied especially on caspase-3 protease activation during infection. Results clearly indicated that scavenging of ·OH by DMSO, mannitol and PBN attenuated apoptosis significantly, as evidenced from the decreased activities of caspase-3 like proteases (P<0.001) (Fig. 6B
). In the liver of infected mice, caspase-3 like activity was found to be nearly11-fold (Fig. 6B
) higher than control (P<0.001). Treatment with ·OH scavengers reduced it back to 3-fold over the control value.
|
If ·OH mediated oxidative stress is responsible for the activation of mitochondrial pathway of liver apoptosis, scavenging of ·OH should correct the altered expression of Bcl-2 as well as Bax toward the control level and, as a result the decrease in
m should also return to normal. Interestingly, all the scavengers such as DMSO, mannitol and PBN treatment to infected mice significantly inhibited the down-regulation of Bcl-2 (P<0.001, P<0.001, P<0.01 respectively) and up-regulation of Bax (P<0.001, P<0.001, P<0.01 respectively) (Fig. 6C
). The result further showed that DMSO, mannitol and PBN also significantly restored the
m toward the control value (Fig. 6D
). P. yoelii infection decreased
m, as evidenced from 50% reduction in fluorescence at 590 nm due to JC1 uptake and treatment of scavengers (DMSO, mannitol and PBN) significantly inhibited the decrease of
m (Fig. 6D
). It is thus clear that oxidative stress caused by ·OH triggers the mitochondrial pathway of apoptosis to cause liver damage during malarial infection.
DISCUSSION
In the present study, we have provided evidence that malarial infection can induce apoptosis in liver. The results clearly indicated the role of oxidative stress and the implication of the mitochondrial pathway for liver apoptosis. To our knowledge, this is the first report, which provides mechanistic basis of hepatocyte apoptosis in malarial infection. Plasmodium infection induced oxidative stress in liver as evidenced by the decreased GSH concentration as well as increased formation of lipid peroxidation, and protein carbonyl. The extent of lipid and protein oxidation positively correlated with the percentage of parasitemia, attaining a 22.5-fold increment in 5060% parasitemia. GSH is an excellent and potent endogenous antioxidant, which by scavenging various types of reactive radicals protects the cell from oxidative insults (37)
. On encounter with reactive radicals, GSH stores may be depleted, leaving the cells with compromised antioxidant defense system against oxidant-induced injury. P. yoelii infection depleted cellular GSH content, attaining a 3 fold decrease at maximum parasitemia. Lowering of cellular GSH content thus indicates generation of large quantity of ROS.
Oxidative stress is known to induce apoptosis in many cellular systems, including liver (12
, 13
, 23)
. But apoptosis in liver during malarial infection has been overlooked. However, malaria-induced apoptosis in other cellular systems has been studied in mice (38)
, monkeys (39)
and human (40)
. Dramatic cellular changes take place in the spleen during malarial infection and Fas mediated apoptotic T cells, B cells and macrophages are found in the spleen (38)
. In vitro studies with human peripheral blood mononuclear cells from patients with acute Plasmodium falciparum malaria have also demonstrated the incidence of apoptosis (40)
. Moreover Plasmodium chabaudi infection in mice induces apoptosis in spleen and thymus (41)
. Furthermore, Plasmodium falciparum through the activation of Ca2+-permeable cation channels of host erythrocytes induces apoptosis like alterations and ultimately death of the infected erythrocytes (eryptosis) (42
43
44)
. In this study we have detected apoptosis in liver of P. yoelii infected mice through visualization of in situ DNA fragmentation and detection of caspase-3 activation. Caspase-3 activation constitutes the execution phase of apoptosis and mainly two distinct pathways can activate caspase cascade, viz., the death receptor pathway and mitochondrial pathway (16)
. P. yoelii infection does not involve death receptor (Fas) mediated pathway during induction of hepatocyte apoptosis. RT-PCR analysis exhibits no such significant alteration of Fas expression in malaria parasite infected hepatocytes in comparison to control. Besides, absence of caspase-8 activation in liver from infected mice further confirms that Fas mediated pathway is not involved in hepatocyte apoptosis. Evidence has been presented to show that in P. yoelii infection there is significant down-regulation of Bcl-2 expression along with the up-regulation of Bax expression, resulting in reduction of Bcl-2 to Bax ratio. The ratio at which these proteins are present intracellularly can determine whether or not a cell undergoes apoptosis (45)
. Mitochondrial pathway of apoptosis is initiated by the down-regulation of antiapoptotic proteins e.g., Bcl-2 and BclXL and/or up-regulation, activation and translocation of proapoptotic proteins e.g., Bax, Bak, Bid to mitochondria (18)
. Proapoptotic proteins induce apoptosis either by forming pores (mitochondrial permeability transition pores) in mitochondria directly or by binding to antiapoptotic proteins via BH3 domain to antagonizing their antiapoptotic actions (14
, 17)
. Opening of mitochondrial transition pores results in release of some apoptotic inducing factors from mitochondria, some of such are cytochrome c, apoptosis inducing factor (AIF), Smac/DIABLO (second mitochondrial derived activator of caspase/Direct IAP binding protein with low pI) etc (17
, 18)
. In P. yoelii infection, the absence of Bcl-2 antagonizing action, activates Bax proteins and these activated Bax then translocates to mitochondria, where they induce opening of MPTP, as a result of that mitochondrial membrane permeability increases, leading to decrease in
m. Mitochondrial anomalies and up-regulation of apoptosis inducing proteins such as Bax, p53 have also been reported in mice brain during experimental murine cerebral malaria (46)
. Opening of MPTP causes release of cytochrome c from mitochondria to cytosol. Cytochrome c after its release into cytosol, binds with apoptotic protease activating factor 1 (Apaf-1) and forms a macromolecular complex, which activates caspase-9. Activated caspase-9 in turn activates the downstream effector caspase, caspase-3, the main executioner of apoptosis (47
, 48)
. Once activated, the effector caspase proteolytically cleaves a broad spectrum of cellular targets leading ultimately to cell death (49)
. Evidence has also been presented to show the reduction of
m, release of cytochrome c and activation of caspase-3 in liver of infected mice, but not in liver of control mice.
Generation of ROS and associated oxidative stress has been found to activate mitochondrial pathway of apoptosis (12
, 50)
. We have found that P. yoelii infection significantly induces ·OH generation in the liver of infected mice. The data suggest that administration of spin trap (PBN) or ·OH scavengers attenuates P. yoelii infection associated oxidative stress (assayed by lipid peroxidation) as well as apoptosis (as revealed from reduction of caspase-3 like activity), indicating a causative role of ·OH in the initiation of apoptosis. Scavenging of ·OH also significantly inhibits the mitochondrial pathway, as evidenced from the near normal restoration of
m as well as Bcl-2 and Bax expression. Attenuation of apoptosis by scavengers and spin trap therefore may be mediated through the inhibition of mitochondrial pathway. PBN is a well-known spin trap used to trap free radicals in vivo and can be used to detect ·OH due to its spin trapping action (51)
.
In the recent past, it has been reported that liver stage of malarial parasite (exoerythrocytic forms) inhibits hepatocyte apoptosis (52)
, although sporozoits can induce apoptosis in hepatocytes to a small extent but significantly in some cases (53)
. Interestingly, our data provide evidence that blood stages (intraerythrocytic forms) of parasite can induce apoptosis, as these blood stages cannot infect liver. It can be suggested that exoerythrocytic stages of malarial parasite protect host cell from apoptosis for its multiplication and its own benefit, but intraerythrocytic stages of parasite damage liver, when it requires RBC only to continue infection. Therefore, it can reasonably be assumed that it is not the parasite itself, but some metabolites derived from the blood stage of parasite can induce apoptosis through oxidative stress.
We have demonstrated the central role of ·OH mediated oxidative stress in the induction of hepatic apoptosis. But the mechanistic details of the generation of ·OH in P. yoelii infection are not very much clear. Several possibilities may exist for the generation of ·OH. During intraerythrocytic stage, plasmodium proteolytically degrades huge quantities of hemoglobin in the food vacuole, yielding large amount of redox active free heme as by product (54)
. Heme while serving as a prosthetic group (protein bound state) performs many important functions (55
, 56)
, whereas in free state it is toxic and develops oxidative stress through generation of ROS (57
, 58)
. Malaria parasite detoxifies redox active free heme to less toxic hemozoin, a polymer of free heme (59)
. However, a high concentration of circulating free heme has been reported during malarial infection (60)
. Even hemozoin, which is deposited in liver during malaria, can also exhibit pro-oxidant activity (59
, 61)
. Thus ROS may be generated from heme or hemozoin. Alternatively, free heme in mammalian system can be detoxified by hemopexin mediated heme oxygenase pathway to yield equimolar amounts of biliverdin, carbon monoxide (CO) and free iron (Fe2+) (58
, 62)
. Fe2+ stimulates up-regulation of ferritin, which helps in the sequestration of Fe2+. There is a relation between intracellular chelatable iron concentration and the synthesis of ferritin. An iron regulatory protein (IRP) binds to ferritin mRNA and inhibits its translation. Cytosolic iron binds to IRP causing release of Fe-IRP complex from ferritin mRNA and initiates translation of ferritin mRNA (63)
. However, it is assumed that before its sequestration, the released Fe2+ can cause many deleterious oxidation reactions, such as Fenton reaction, where in presence of H2O2, Fe2+ generates ·OH (64)
. It is hypothesized that in malarial infection, an excess quantity of heme is degraded resulting in release of huge amount of Fe2+ causing iron overload which produce large quantities of ROS in malarial infection (65)
. Further studies are necessary to confirm it. We can thus conclude that malarial infection augments oxidative stress in liver and oxidative stress through the activation of mitochondrial pathway induces apoptosis (Fig. 7
) to cause liver damage in malarial infection.
|
ACKNOWLEDGMENTS
We gratefully acknowledge Council of Scientific and Industrial Research (CSIR), New Delhi, for providing grants through CSIR Networked Project [SMM03, (P22)] and offering Senior Research fellowship to Mithu Guha to carry out this work. We thank Kalyan Moitra of Electron Microscopy Unit, CDRI, Lucknow for his help to do confocal microscopy. We also thank Dr. Sudhir Sinha for helpful and valuable suggestions during the course of this work. This report bears CDRI communication No 6902.
Received for publication November 10, 2005. Accepted for publication January 6, 2006.
REFERENCES
This article has been cited by other articles:
![]() |
E. Seixas, R. Gozzelino, A. Chora, A. Ferreira, G. Silva, R. Larsen, S. Rebelo, C. Penido, N. R. Smith, A. Coutinho, et al. From the Cover: Heme oxygenase-1 affords protection against noncerebral forms of severe malaria PNAS, September 15, 2009; 106(37): 15837 - 15842. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Maity, S. Bindu, S. Dey, M. Goyal, A. Alam, C. Pal, K. Mitra, and U. Bandyopadhyay Indomethacin, a Non-steroidal Anti-inflammatory Drug, Develops Gastropathy by Inducing Reactive Oxygen Species-mediated Mitochondrial Pathology and Associated Apoptosis in Gastric Mucosa: A NOVEL ROLE OF MITOCHONDRIAL ACONITASE OXIDATION J. Biol. Chem., January 30, 2009; 284(5): 3058 - 3068. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Maity, S. Bindu, V. Choubey, A. Alam, K. Mitra, M. Goyal, S. Dey, M. Guha, C. Pal, and U. Bandyopadhyay Lansoprazole Protects and Heals Gastric Mucosa from Non-steroidal Anti-inflammatory Drug (NSAID)-induced Gastropathy by Inhibiting Mitochondrial as Well as Fas-mediated Death Pathways with Concurrent Induction of Mucosal Cell Renewal J. Biol. Chem., May 23, 2008; 283(21): 14391 - 14401. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tremellen Oxidative stress and male infertility--a clinical perspective Hum. Reprod. Update, May 1, 2008; 14(3): 243 - 258. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kumar, S. K. Das, S. Dey, P. Maity, M. Guha, V. Choubey, G. Panda, and U. Bandyopadhyay Antiplasmodial Activity of [(Aryl)arylsulfanylmethyl]Pyridine Antimicrob. Agents Chemother., February 1, 2008; 52(2): 705 - 715. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. M. Oakley, S. Kumar, V. Anantharaman, H. Zheng, B. Mahajan, J. D. Haynes, J. K. Moch, R. Fairhurst, T. F. McCutchan, and L. Aravind Molecular Factors and Biochemical Pathways Induced by Febrile Temperature in Intraerythrocytic Plasmodium falciparum Parasites Infect. Immun., April 1, 2007; 75(4): 2012 - 2025. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |