|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
University of Tuebingen, Department of Internal Medicine IV, Tuebingen, Germany
1Correspondence: University of Tuebingen, Department of Internal Medicine IV, Tuebingen D-72076, Germany. E-mail: hans-ulrich.haering{at}med.uni-tuebingen.de
ABSTRACT
Insulin resistance in skeletal muscle is found in obesity and type 2 diabetes. A mechanism for impaired insulin signaling in peripheral tissues is the inhibition of insulin action through serine phosphorylation of insulin receptor substrate (Irs) proteins that abolish the coupling of Irs proteins to the activated insulin receptor. Recently, we described serine-318 as a protein kinase C (PKC)-dependent phosphorylation site in Irs1 (Ser-318) activated by hyperinsulinemia. Here we show in various cell models that the adipose hormone leptin, a putative mediator in obesity-related insulin resistance, promotes phosphorylation of Ser-318 in Irs1 by a janus kinase 2, Irs2, and PKC-dependent pathway. Mutation of Ser-318 to alanine abrogates the inhibitory effect of leptin on insulin-induced Irs1 tyrosine phosphorylation and glucose uptake in L6 myoblasts. In C57Bl/6 mice, Ser-318 phosphorylation levels in muscle tissue were enhanced by leptin and insulin administration in lean animals while in diet-induced obesity Ser-318 phosphorylation levels were already up-regulated in the basal state, and further stimulation was diminished. In analogy, in lymphocytes of obese hyperleptinemic human subjects basal Ser-318 phosphorylation levels were increased compared to lean individuals. During a hyperinsulinemic euglycemic clamp, the increment in Ser-318 phosphorylation observed in lean individuals was absent in obese. In summary, these data suggest that phosphorylation of Ser-318 in Irs1 mediates the inhibitory signal of leptin on the insulin-signaling cascade in obese subjects.Hennige A. M., Stefan N., Kapp K., Lehmann R., Weigert C., Beck A., Moeschel K., Mushack J., Schleicher E., and Häring H. U. Leptin down-regulates insulin action through phosphorylation of serine-318 in insulin receptor substrate 1.
Key Words: protein kinase C obesity Irs protein insulin resistance
OBESITY IS THE MOST COMMON endocrine disorder that causes insulin resistance and finally contributes to the development of type 2 diabetes (1)
. Extensive studies were made to unveil the cause of peripheral insulin resistance, but the precise mechanisms are largely unknown. Nevertheless, there is increasing evidence that adipose-derived cytokines and hormones like tumor necrosis factor-
, interleukins, and leptin are relevant for impaired insulin action in liver, fat, and pancreatic beta-cells and skeletal muscle (2)
.
Leptin is a product of the obesity gene (ob) and is primarily secreted from adipocytes (3)
. It is known to play a dual role in terms of Glc metabolism and insulin signaling, both insulin sensitizing as well as insulin antagonizing (4
5
6)
. Most data available support leptin as a central satiety hormone that acts as an insulin-sensitizing factor to regulate appetite and energy balance of the body, but on the other hand it is well supported that hyperleptinemia in the presence of obesity is associated with insulin resistance in tissues such as liver, fat, and pancreatic beta-cells and muscle (7
8
9
10)
. Elevated plasma leptin levels correlate positively with total body fat mass, and in a large cohort, leptin levels are negatively correlated with insulin sensitivity (11
, 12)
. However, if elevated leptin levels in the face of obesity are the result of central and peripheral leptin resistance or a primary cause for impaired peripheral insulin sensitivity is still under investigation.
The insulin and leptin signaling pathways are known to share certain downstream molecules like janus kinase-2 (Jak-2), insulin receptor substrates (Irs), phosphatidyl-inositol 3-kinase (PI 3-K), protein kinase B (PKB), and mitogen-activated protein kinase (MAPK). All of these molecules are candidates for mediators of the complex inhibitory crosstalk of leptin with the insulin-signaling chain (5
, 13
, 14)
, and recent in vitro data provide evidence that high leptin levels lead to the hallmarks of insulin resistance including inhibition of insulin-stimulated Glc uptake (15)
. Moreover, leptin pretreatment reduced the extent of insulin-stimulated MAP kinase phosphorylation in skeletal muscle cells, liver cells, and adipocytes, leading to a down-regulation of the insulin signal (10
, 16)
. In hepatoma cells as well as in liver of diet-induced obesity, leptin treatment inhibits insulin receptor downstream action (15
, 17
, 18)
. These data suggest that obesity, insulin resistance, and type 2 diabetes are tightly linked by a crosstalk of the leptin and insulin-signaling cascade that impairs insulin action in the presence of high leptin levels (19)
.
Looking at early postreceptor molecules, insulin action is regulated by serine phosphorylation of Irs proteins, as this leads to diminished coupling of Irs proteins to the activated insulin receptor (20
21
22)
. Recently, we described serine-318 as a protein kinase C (PKC)-dependent inhibitory phosphorylation site in Irs1 (Ser-318), which is activated during prolonged hyperinsulinemia (23)
, and raised a phosphospecific polyclonal antibody that specifically recognizes phosphorylated Ser-318 residues in Irs1.
In the present study, we focused on the impact of the adipose hormone leptin on serine-318 phosphorylation in Irs1. Our data reveal that leptin leads to phosphorylation of Ser-318 in Irs1 in vitro and in vivo through a pathway involving Jak-2, Irs2, and PKC-
. As this effect is increased in obese mouse models as well as obese humans, we propose that Ser-318 might be a pivotal mechanism for leptin-induced insulin resistance in humans.
MATERIALS AND METHODS
Materials
Cell culture materials were purchased from Life Technologies (Eggenstein, Germany). Recombinant human insulin was from Novo Nordisk (Kopenhagen, Denmark), and mouse and human leptin were purchased from Sigma-Aldrich (Taufkirchen, Germany). Bisindolylmaleimide and tyrphostin AG 490 were from Sigma-Aldrich (Taufkirchen, Germany). Enhanced chemiluminescence (ECL) reagent and nitrocellulose were purchased from Amersham Biosciences (Buckinghamshire, UK), and gel blotting papers were from Schleicher & Schuell (Dassel, Germany). The polyclonal serine318 antibody (Ab) was produced and characterized in our laboratory (23)
. Anti Irs1 (06248) and Irs2 (06506) antibodies were from Upstate (Charlottesville, VA).
Cell culture and transfection
Human embryonic kidney fibroblasts (HEK) 293 were grown in Dulbecco's MEM/nutrient F-12 medium (DMEM) supplemented with 2 mM glutamine and 10% fetal calf serum (FCS) and transiently transfected using the Ca3(PO4)2-DNA coprecipitation method (13)
. After incubation overnight at 37°C in 5% CO2, the cells were starved for 16 h in DMEM containing 0.5% FCS and then stimulated with either 107 M insulin or leptin 125 ng/ml for 5 and 30 min, respectively.
L6 myoblasts were cultured in DMEM containing 5.5 mM Glc, 10% FCS, 100 U/ml penicillin, and 100 µg/ml streptomycin. After an overnight fast, cells were treated with 107 M insulin (Ins, 5 min), leptin 125 ng/ml (Lep, 30 min), or leptin (30 min) followed by insulin (5 min), 500 nM bisindolylmaleimide (Bis, 20 min), or 50 µM tyrphostin (Jak-I, 20 min) and separated by SDS-PAGE.
C2C12 cells were cultured in DMEM containing 10% fetal calf serum and 2 mM glutamine. Cells were plated in sixwell plates and transfected using the Ca3(PO4)2-DNA coprecipitation method and then treated with either insulin (107 M, 5 min) or leptin (125 ng/ml, 30 min) as indicated. Cells were lysed, and total protein was separated by SDS-PAGE, and Western blot analysis was performed. For mutation of the codon for amino acid position 318 (Ser to Ala), base substitutions were made by oligonucleotide-mediated mutagenesis. The mutagenic upstream primer used was Ala318/1: GGTGGGAAACCAGGTGCCTTCAGGGTGCGTGCC with the wild-type (WT) Irs1 expression vector as template. Positive clones were verified by sequencing.
Determination of 2-deoxyglucose uptake
L6 myoblasts stably transfected with myc-tagged Glut4 (kindly provided by A. Klip, Toronto, Canada) were transiently transfected with either Irs1-wt or Irs1-Ala318 using Lipofectamine 2000 (Invitrogen, Karlsruhe, Germany). Cells were seeded in sixwell plates, serum-deprived for 3 h, and then stimulated with either insulin alone (100 nM for 5 min) or with leptin (100 nM for 30 min) followed by insulin (100 nM for 5 min) at 37°C. [3H]deoxygluocose (Perkin Elmer, Wellesley, MA) was mixed with unlabeled deoxyglucose (Sigma Taufkirchen, Germany) and 1:50 and 20 µl were added for 3 min. Plates were washed with ice-cold KBR-buffer and cells were lysed using 1% triton. Radioactivity was determined by liquid scintillation counting.
Purification and in vitro phosphorylation of a recombinant glutathione S-transferase (GST)-Irs1 fragment with PKC isoforms
The Irs1 fragment was ligated into the pGEX-2T vector (Amersham Biosciences, Freiburg, Germany) resulting in the generation of an Irs1- glutathione S-transferase (GST) construct (size: 53.8 kDa; amino acid residues 265522). The fusion protein was expressed in E. coli BL 21 and purified by affinity chromatography. The phosphorylation assays were performed as described using 1 µCi of
[32P]ATP (24)
. The samples were analyzed on a 7.5% SDS-PAGE and visualized by autoradiography.
Tryptic ingel digestion and RP-HPLC separation of the in vitro phosphorylated recombinant GST-Irs1 fragments
Phosphorylated Irs1-GST bands were excised and ingel digested with trypsin as described previously (24)
. Resulting peptides were separated by RP-HPLC, and the collected fractions were analyzed in a Trilux 1450 MicroBeta Plus ß-counter (PerkinElmer/Wallac, Turku, Finland), as described previously (23)
.
Animal studies
Four-week-old male Irs2 knockout mice on a pure C57Bl/6 background (25)
were provided by Morris F. White (Howard Hughes Medical Institute, Children's Hospital, Boston, MA). Four-week old male C57Bl/6 WT mice were obtained from Charles River. They were maintained on a normal light/dark cycle and kept on a high/low fat diet for 8 wk (D12450B/D12451, Research Diet Inc., New Brunswick, NJ). Insulin resistance in these mice was estimated by HOMA-IR index (46.70±5.45 in obese vs. 2.02±0.63 in lean, n=6, P<0.001). For in vivo stimulation, a bolus of human insulin (1 IU/mouse for 5 min) or mouse leptin (100 µg/mouse for 30 min) was injected into the inferior vena cava of overnight fasted mice. Controls received a comparable amount of diluent. Muscle tissue was removed and homogenized at 4°C (26)
. Homogenates were allowed to solubilize for 30 min on ice and clarified by centrifugation at 12,000 g for 20 min. For detection of Ser-318 phosphorylation, supernatants containing 0.1 mg of total protein were used. Visualization after gel-electrophoresis and Western blotting with the antiphosphoserine318 Ab was performed with the nonradioactive ECL system.
All procedures are in accordance with the accepted standard of humane animal care and were approved by the local Animal Care and Use Committee.
Human subjects
Cross-sectional data from 47 subjects were included in this analysis. They participated in an ongoing study to reduce adiposity and to prevent type 2 diabetes. Subjects were recruited from the southern part of Germany and were not related to each other. Individuals were included when they fulfilled at least one of the following criteria: a family history of type 2 diabetes, a body mass index >27 kg/m2, and a previous diagnosis of impaired Glc tolerance or gestational diabetes. All subjects first underwent a 75 g oral Glc tolerance test (OGTT). The participants did not take any medication known to affect Glc tolerance or insulin sensitivity. They were considered healthy according to a physical examination and routine laboratory tests. Informed written consent was obtained from all participants, and the local medical ethics committee approved the protocol.
Euglycemic hyperinsulinemic clamp and body composition
After a 12 h overnight fast around 7 a.m., an antecubital vein was cannulated for infusion of insulin and Glc. A dorsal hand vein of the contra lateral arm was cannulated and placed under a heating device to permit sampling of arterialized blood. After basal blood was drawn, subjects received a primed insulin infusion at a rate of 1.0 mU·kg-1·min-1 for 2 h. Blood was drawn every 5 min for determination of blood Glc, and a Glc infusion was adjusted appropriately to maintain the fasting Glc concentration. An insulin sensitivity index (ISI; in µM·kg-1·min-1·pM-1) for systemic Glc uptake was calculated as the mean infusion rate of Glc (in µM·kg-1·min-1) necessary to maintain euglycemia during the last 60 min of the euglycemic hyperinsulinemic clamp divided by the steady-state plasma insulin concentration.
Isolation of human peripheral mononuclear cells and Western blot analysis
Human peripheral mononuclear cells (PMNCs) are obtained by Ficoll-Paque density gradient centrifugation. Briefly, 2.5 ml of Li-heparinized blood was mixed with the same volume of PBS (137 mM NaCl, 4.3 mM Na2HPO4, 2.7 mM KCl, 1.4 mM KH2PO4, pH 7.4) and carefully layered onto 3 ml Ficoll-Paque (density 1.077 g/l) at 20°C. After centrifugation at 400 g for 20 min at room temperature, the PMNCs were harvested from the interphase. Five volumes of PBS were added, and the cells were separated by centrifugation at 200 g for 10 min. Cells were lysed on ice, and lysates were cleared by centrifugation at 13,000 g for 5 min at 4°C. Laemmli buffer was added to the same amount of protein (100 µg), and samples were applied to a 7.5% SDS-PAGE. Each gel contained a sample of a control subject set 100% to compare Ser-318 phosphorylation levels in Irs1.
Statistics
Unless otherwise stated data are mean ± SE. Statistical comparison between variables was performed using logarithmically transformed data (for non-normally distributed parameters). Regarding the human data, first subjects were stratified in quartiles of percentage of body fat. For statistical analyses, lean subjects in the first quartile were compared to obese subjects in the fourth quartile. To adjust the effects of relevant covariates (age, gender, percentage of body fat), multivariate linear regression analyses were performed. In these models, basal and fold-change in Ser-318 phosphorylation were adjusted for their determinants age and percentage body fat that were found in univariate analyses, while the other metabolic characteristics were additionally adjusted for gender. The statistical software packages JMP (SAS Institute Inc, Cary, NC) and Statistical Packages for the Social Sciences (SPSS) version 10.0 software (SPSS Inc., Chicago, IL) were used.
RESULTS
Leptin and insulin stimulate Ser-318 phosphorylation
Recently, we described Ser-318 as a PKC-dependent phosphorylation site in Irs1 activated by hyperinsulinemia (23)
. Due to the fact that phosphorylation of Ser-318 in Irs1 is able to induce a reduced coupling of Irs proteins to the activated insulin receptor, and therefore alters insulin signaling, this serine site is potentially important for peripheral insulin resistance in vivo. In this study, we determined the impact of the adipose hormone leptin on the insulin-signaling cascade at the level of Ser-318 phosphorylation in cell lines, as well as in mouse and human tissues.
Earlier studies in HEK 293 cells revealed that insulin receptor signaling and leptin signaling interfere at the level of Jak-2 and that leptin signaling occurs through Irs2 and leads to an activation of PI 3-kinase (5
, 13
, 50)
. To test whether this pathway is involved in Irs1-Ser-318 phosphorylation, we transfected HEK 293 cells with IR, Irs1 with or without Irs2. On either leptin or insulin stimulation, Ser-318 phosphorylation was markedly increased (Fig. 1
A). The extent of Ser-318 phosphorylation was strongly dependent on the amount of Irs2 protein present in the cell, as Ser-318 phosphorylation was diminished on the lack of Irs2. To validate the importance of Irs2 in this activation loop in vivo, we intravenously (iv) treated C57Bl/6 WT and Irs2 knockout mice with either leptin or insulin. The results obtained revealed that both leptin- and insulin-stimulated Ser-318 phosphorylation is dependent on the presence of Irs2 in muscle tissue (Fig. 1B
).
|
Specificity of PKC isoforms to phosphorylate Ser-318
To identify the signaling molecules that are involved in leptin-induced Ser-318 phosphorylation, we first used an in vitro phosphorylation approach to examine the specificity of different PKC classes (27)
to phosphorylate an Irs1 protein fragment covering amino acid residues 265522. This protein fragment was used since it contains the Ser-318 site, and among other fragments of Irs1 this fragment incorporated 32P at the highest rate (data not shown).
Briefly, the Irs1 wild-type protein fragment was fused to GST and incubated with a member of the "classical" PKCs (PKC-ß1) or with PKC-
as a member of the "novel" PKCs and the "atypical" PKC-
, respectively, and phosphorylation was monitored using incorporation of 32P. Incubation of PKC-ß1 with this fragment resulted in a 32P incorporation of 39 pmolATP/80 µg substrate, whereas for PKC-
the incorporation rate was elevated to 63 pmolATP/80 µg substrate (P<0.005, ß1 vs.
, n=6), and 81 pmolATP/80 µg substrate for PKC-
(P < 0.001, ß1 vs.
, n=6) as described previously (23)
. After gel separation and tryptic digestion, the phosphorylated recombinant Irs1-GST fragments were separated by RP-HPLC and the collected fractions were analyzed for radioactive incorporation representing the phosphorylation concentration. As demonstrated in Fig. 2
, the Irs1 fragment is a substrate of all three PKCs, PKC-ß1 (Fig. 2A
), PKC-
(Fig. 2B
), and PKC-
(Fig. 2C
). Mass spectrometric analysis of the peaks of fraction number 20 and 24 showed phosphorylation of Ser-318. Due to tryptic miscleavage, two different peptides arise both containing Ser-318. Moreover, specificity was verified by a Ser-318 to Ala318 mutation, indicating that Ser-318 is a specific phosphorylation site in this Irs1 fragment (data not shown). Besides Ser-318, a minor phosphorylation site was detected at 436 (Fig. 2A-C
).
|
Ser-318 phosphorylation is downstream of Jak-2 and PKC-
To determine which of these PKC isoforms are involved in leptin-induced Ser-318 phosphorylation, we treated L6 myoblasts with insulin, leptin, or leptin and bisindolylmaleimide to inhibit classical (ß) and novel (
) but not atypical (
) PKC activity. Bisindolylmaleimide was able to prevent Ser-318 phosphorylation suggesting a PKC-ß/
-dependent mechanism (Fig. 2D
). Moreover, leptin-induced Ser-318 phosphorylation was disrupted by the use of the Jak-2 inhibitor tyrphostin, confirming earlier data obtained in HEK 293 cells (13)
.
As our in vitro studies revealed that PKC-
is one of the major PKCs to phosphorylate Ser-318 in Irs1, we further established the signaling cascade in C2C12 cells that are known to express tiny amounts of PKC-
(28)
. In this cell line, the stimulatory effect of leptin was not detectable, suggesting a PKC-
-dependent mechanism (Fig. 2E
). To finally validate the importance of PKC-
on Ser-318 phosphorylation, we overexpressed constitutively active PKC-
in C2C12 cells. The results obtained revealed that Ser-318 phosphorylation is dependent on the presence of PKC-
(Fig. 2F
, upper panel); however, further stimulation on leptin treatment is missing, most likely due to the maximal basal stimulation in the presence of the constitutively active PKC-
(Fig. 2F
, middle panel).
It is noteworthy that insulin-induced Ser-318 phosphorylation was preserved due to the presence of PKC-
in C2C12 cells, and insulin stimulation leads to a gel shift of Irs1, suggesting that multiple phosphorylation sites are involved (Fig. 2F
).
Ser-318 phosphorylation down-regulates insulin action and 2-deoxyglucose uptake
To test the hypothesis whether leptin-induced Ser-318 phosphorylation also results in impaired insulin signaling, we transfected L6 cells with either Irs1 or a Ser-318 to Ala318 point-mutated Irs1 and performed Western blot analysis on Irs1 tyrosine phosphorylation. The data reveal that insulin stimulates tyrosine phosphorylation of Irs1, while leptin had no effect (Fig. 3
A, upper panel). However, leptin pretreatment leads to a greatly diminished insulin-induced tyrosine phosphorylation of Irs1, suggesting an inhibitory effect of leptin on the insulin-signaling cascade. In the presence of the Ala318 mutant, the inhibitory effect of leptin pretreatment on Irs1 tyrosine phosphorylation was absent, indicating that Ser-318 is required for leptin-induced inhibition of the insulin signal (Fig. 3B
, upper panel). To validate the importance of this serine-site in Glc metabolism, we determined Glc uptake in L6 myoblasts transfected with Glut-4 and either Irs1-wt or the Ala318 mutant. Compared to Irs1-wt, where leptin pretreatment leads to a diminished Glc uptake rate, leptin was unable to decrease Glc uptake in the presence of the Ala318 mutant (Fig. 3
, right panels). This strongly suggests that Ser-318 is the key serine-phosphorylation site involved in leptin-induced insulin resistance.
|
Ser-318 phosphorylation is elevated in muscle tissue of obese mice
To determine whether Ser-318 phosphorylation is indeed present and regulated in vivo, we injected C57Bl/6 mice with leptin and insulin and determined the phosphorylation levels of Ser-318 in muscle tissue. Leptin and insulin were able to activate Ser-318 phosphorylation as determined by the phospho-specific Ab in muscle tissue of lean animals (Fig. 4
A, left panel). To prove the fact that Ser-318 phosphorylation is regulated in mouse physiology, we investigated the extent of Ser-318 phosphorylation in the presence of obesity. In muscle tissue of high fat diet fed mice (26)
, where insulin and adipose-derived cytokines and hormones are elevated, basal Ser-318 phosphorylation was greatly enhanced compared to low-fat diet fed mice (Fig. 4A
, right panel). Moreover, in obese mice, insulin and leptin are not able to substantially increase Ser-318 phosphorylation compared to lean animals (Fig. 4A
).
|
Ser-318 phosphorylation is regulated in human lymphocytes
As another system to investigate the role of Ser-318 phosphorylation in the presence of metabolic alterations in humans, we made use of lymphocytes isolated from human blood. These cells provide a useful tool to determine alterations in the insulin-signaling cascade in vivo as they include all of the signaling proteins present in insulin target tissues (29)
.
To prove the fact that insulin and leptin phosphorylate Ser-318 in this system, we first determined Ser-318 phosphorylation levels in lymphocytes isolated from human blood. Lymphocytes were therefore stimulated with either human insulin or leptin and the experiments confirmed that insulin as well as leptin activates Ser-318 and that the use of bisindolylmaleimide to inhibit PKC activity was able to diminish the leptin signal (data not shown). Interestingly, insulin-stimulated Ser-318 phosphorylation was conserved in the presence of bisindolylmaleimide, again suggesting a PKC-
-dependent insulin-signaling pathway.
These data from human lymphocytes prompted us to further determine the Ser-318 phosphorylation levels in an in vivo system. Therefore, Ser-318 phosphorylation was investigated in lymphocytes isolated from nondiabetic human subjects (Table 1
) before and at the end of an euglycemic hyperinsulinemic clamp. In analogy to the data obtained from mouse muscle, Western blot analysis in human lymphocytes of lean revealed an increase in Ser-318 phosphorylation by the end of the clamp (Fig. 4B
, left panel), while in obese the phosphorylation levels were already up-regulated in the basal state. Moreover, further stimulation during the clamp is missing in obese subjects (Fig. 4B
). Looking at data of 47 individuals, basal Ser-318 phosphorylation is negatively associated with age (Fig. 4C
) and positively with body fat mass (Fig. 4D
), suggesting that the previously described decrease in cytosolic PKCs during aging is relevant for the extent of Ser-318 phosphorylation in vivo.
|
After the mouse data, we further analyzed the impact of obesity on the potential to increase Ser-318 phosphorylation during hyperinsulinemia in humans. Western blot analysis revealed that the basal Ser-318 phosphorylation in the presence of elevated leptin levels in obese and insulin resistant humans was already up-regulated and further stimulation of Ser-318 during the clamp was absent in these subjects (Fig. 4F
, Table 1
, 4th quartile), reflecting the data obtained from muscle of overweight mice. By contrast, Ser-318 phosphorylation was inducible in lymphocytes of lean and insulin-sensitive human subjects (Fig. 4E
, Table 1
, 1st quartile) and correlated to the data obtained from mice fed a low fat diet.
In summary, our data reveal that leptin phosphorylates Ser-318 in Irs1 in various cell models and therefore down-regulates the insulin signal in the presence of obesity. The fact that Ser-318 phosphorylation is elevated in obesity as determined in mouse muscle and human lymphocytes demonstrates that this mechanism is present and regulated in rodent and human physiology.
DISCUSSION
Among a large number of hormones secreted from adipocytes, leptin is supposed to signal the nutrient status to the central nervous system, especially the hypothalamus where it decreases food intake (30
, 31)
. Moreover, there is a bulk of evidence supporting the idea that leptin acts as a insulin-sensitizing factor as leptin administration either centrally or peripherally leads to a reduction in body weight, and the loss of the leptin gene results in massive obesity (32)
, reversed by leptin administration (33
, 34)
.
On the other hand, leptin levels are elevated in the presence of obesity, and circulating levels are proportional to body adiposity, consistent with the idea that obesity causes leptin resistance in peripheral tissues and the brain (35)
. As this phenomenon is mechanistically related to insulin resistance and insulin and leptin share downstream signaling elements, studies are focusing on the crosstalk of the insulin and leptin signaling cascade to alter its downstream action (4
, 17)
. In L6 muscle cells, elevated leptin levels are able to diminish MAP kinase phosphorylation and inhibit insulin-stimulated Glc uptake. Moreover, leptin pretreatment impairs insulin receptor downstream action in muscle, liver and adipocytes (10
, 15
, 17)
. This dual effect of leptin action on Glc metabolism is supposed to be regulated by the nutritional status, as in obese rats, leptin administration leads to a reduced insulin signal in liver, whereas in lean rats, leptin was not able to diminish the insulin response (18)
. Therefore, the insulin-antagonizing effects of leptin on peripheral tissues such as muscle, liver, or fat may become prominent in the presence of obesity, which leads to central leptin resistance (6
, 36)
.
To define the mechanism involved in impaired insulin signaling in the face of obesity, we determined a potential mechanism for the inhibition of the insulin signal at the level of Irs proteins and serine/threonine phosphorylation (20)
. It is hypothesized that prolonged serine phosphorylation in Irs1 reduces the pool of Irs1 molecules available for adequate insulin signaling in peripheral tissues and/or create binding sites for inhibitory molecules. Up to now, several potential serine phosphorylation sites in Irs1 were described to mediate an inhibitory feedback signal during hyperinsulinemia and metabolic stress (37
38
39)
. Ser-302, Ser-307 (40
41
42
43)
, and Ser-636 (44)
were identified as inhibitory/feedback sites and when phosphorylated, the interaction of Irs1 and the insulin receptor was found to be markedly reduced. Ser-302 phosphorylation is dependent on PI 3-kinase/mTOR, whereas Ser-307 depends on c-Jun NH2-terminal kinase to inhibit Irs1 tyrosine phosphorylation. Ser-636 is located around the PI 3-kinase binding site and, therefore, thought to inhibit PI 3-kinase signaling.
In this study, we determined the impact of the adipose hormone leptin on the insulin-signaling cascade at the level of Ser-318 which was found to be a PKC-dependent phosphorylation site in Irs1 during hyperinsulinemia. Previous work from our laboratory revealed that insulin-mediated phosphorylation on Ser-318 is dependent on PKC
(45)
, and phosphorylation of Irs1 by PKC
blocks the interaction of Irs1 with the insulin receptor, therefore reducing its phosphorylation on tyrosine residues and down-regulate the insulin signal (23)
.
With the use of a phosphospecific anti-Ser-318 Ab, our present findings obtained from various cell lines provide clear evidence that Ser-318 is in fact regulated by physiological stimuli present in insulin resistance and obesity. Besides insulin, leptin enhances Ser-318 phosphorylation and is therefore meant to inhibit insulin action as demonstrated by impaired Glc uptake in L6 myoblasts (Fig. 3)
. The pathway involved is dependent on Irs2, Jak-2, and PKC
, as our studies revealed a diminished leptin signal in Irs2 knockout animals and in the presence of the appropriate inhibitors. Our present data do not prove the fact that PKC
is the only PKC involved in the leptin signal, however, we have circumstantial evidence from inhibitory studies and C2C12 cells that the lack of active PKC-
leads to diminished Ser-318 phosphorylation levels.
Previous reports suggest that fatty acid induced insulin resistance in liver is accompanied by a progressive increase in hepatic PKC
translocation (8)
, and PKC
seems to be the major PKC isoform activated by lipid infusion (46)
. Furthermore, recent studies demonstrate that PKC
modulates the ability of the insulin receptor to tyrosine phosphorylate Irs1 and therefore modify the downstream insulin signal (47)
as preincubation of Irs1 with activated PKC
in vitro inhibits the insulin-receptor-kinase-induced Irs1 tyrosine phosphorylation by almost 90% (48
, 49)
. In this respect, Ser-318 is supposed to be the link that down-regulates insulin action in the presence of elevated leptin levels in adiposity. Moreover, the fact that Irs2 is involved in this pathway is supported by previous work from our lab demonstrating that leptin signals to PI 3-kinase and PKC through an Irs2-dependent pathway, and thereby leads to serine phosphorylation of Irs1. This pathway is also dependent on Jak-2, as leptin-induced activation of PI 3-kinase is detectable in Jak-2 immunoprecipitates (50)
, and Ser-318 phosphorylation is diminished in the presence of Jak-2 inhibitors.
To prove the biological importance of Ser-318 phosphorylation, we demonstrated that leptin is able to stimulate Ser-318 in mouse muscle tissue in vivo, however, in the face of obesity and hyperleptinemia, Ser-318 is up-regulated in the basal state and further increase is absent contributing to leptin-associated peripheral insulin resistance. This is consistent with the observation that in muscle and adipose cells from obese type 2 diabetic subjects, the basal activity of serine/threonine kinases including PKC
is highly enhanced and further stimulation is missing (51
, 52)
. Similar results emerged from our studies in human lymphocytes during the hyperinsulinemic euglycemic clamp where stimulation of Ser-318 was not detectable in overweight and insulin resistant individuals. In addition, Ser-318 phosphorylation in human lymphocytes is strongly associated with age consistent with data obtained from rodents that display greatly diminished expression of Irs2 and PKC
during aging (53
54
55)
. Moreover, previous studies demonstrate that all major PKC isoforms are present in human lymphocytes and that lymphocytes of young subjects are more sensitive to PKC inhibitors than those of elderly subjects, further suggesting a regulation of these kinases in human physiology (56)
.
Taken together, our data suggest that Ser-318 in Irs1 is a common site for integrating the inhibitory signaling of leptin on the insulin-signaling cascade in vitro and in vivo through an Jak-2/Irs2 and PKC
-dependent pathway. To uncouple obesity from insulin resistance in peripheral tissue, pharmacological tools to inhibit leptin-dependent phosphorylation of Ser-318 in Irs1 could be a rational treatment to improve peripheral insulin signaling in overweight subjects.
ACKNOWLEDGMENTS
We are grateful to all the research volunteers for participation and Katrin Brodbeck for excellent technical assistance. We thank Amira Klip for providing the L6-Glut4myc cells and Morris F. White for the Irs2 knockout mice. This work was in part supported by the Deutsche Forschungsgemeinschaft (KFO 114/1), the fortüne program of the University of Tuebingen (12090-0), and the Deutsche Diabetes Gesellschaft.
Received for publication August 4, 2005. Accepted for publication December 29, 2005.
REFERENCES
This article has been cited by other articles:
![]() |
S. Boura-Halfon and Y. Zick Phosphorylation of IRS proteins, insulin action, and insulin resistance Am J Physiol Endocrinol Metab, April 1, 2009; 296(4): E581 - E591. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Shan, T. B. Nguyen, H. Totary-Jain, H. Dansky, S. O. Marx, and A. R. Marks Leptin-enhanced neointimal hyperplasia is reduced by mTOR and PI3K inhibitors PNAS, December 2, 2008; 105(48): 19006 - 19011. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Weigert, M. Kron, H. Kalbacher, A. K. Pohl, H. Runge, H.-U. Haring, E. Schleicher, and R. Lehmann Interplay and Effects of Temporal Changes in the Phosphorylation State of Serine-302, -307, and -318 of Insulin Receptor Substrate-1 on Insulin Action in Skeletal Muscle Cells Mol. Endocrinol., December 1, 2008; 22(12): 2729 - 2740. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Schmidt, M. Richter, D. Montag, T. Sartorius, V. Gawlik, A. M. Hennige, S. Scherneck, H. Himmelbauer, S. Z. Lutz, R. Augustin, et al. Neuronal functions, feeding behavior, and energy balance in Slc2a3+/- mice Am J Physiol Endocrinol Metab, November 1, 2008; 295(5): E1084 - E1094. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Koh, S. M. Park, and M. J. Quon Leptin and Cardiovascular Disease: Response to Therapeutic Interventions Circulation, June 24, 2008; 117(25): 3238 - 3249. [Full Text] [PDF] |
||||
![]() |
R. S. Waraich, C. Weigert, H. Kalbacher, A. M. Hennige, S. Z. Lutz, H.-U. Haring, E. D. Schleicher, W. Voelter, and R. Lehmann Phosphorylation of Ser357 of Rat Insulin Receptor Substrate-1 Mediates Adverse Effects of Protein Kinase C-{delta} on Insulin Action in Skeletal Muscle Cells J. Biol. Chem., April 25, 2008; 283(17): 11226 - 11233. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. F. Chehab Minireview: Obesity and LipOdystrophy--Where Do the Circles Intersect? Endocrinology, March 1, 2008; 149(3): 925 - 934. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Muniyappa, M. Montagnani, K. K. Koh, and M. J. Quon Cardiovascular Actions of Insulin Endocr. Rev., August 1, 2007; 28(5): 463 - 491. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Dube, B. A. Bhatt, N. Dedousis, A. Bonen, and R. M. O'Doherty Leptin, skeletal muscle lipids, and lipid-induced insulin resistance Am J Physiol Regulatory Integrative Comp Physiol, August 1, 2007; 293(2): R642 - R650. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |