|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,1
Departments of
* Physiology,
Obstetrics and Gynaecology, and Medicine, University of Toronto and Division of Cellular and Molecular Biology, Toronto General Hospital Research Institute, University Health Network, Toronto, Ontario, Canada
1Correspondence: Department of Physiology, University of Toronto, Medical Sciences Bldg. 3247A, 1 Kings College Cir., Toronto, ON, Canada M5S 1A8. E-mail: d.belsham{at}utoronto.ca
ABSTRACT
The adipokine leptin signals energy status to the hypothalamus, which triggers a network of neuropeptide responses. Each hypothalamic cell type expresses a unique complement of neuropeptides, receptors, and second messengers; thus each likely responds specifically to peripheral hormones. We describe here the analysis of leptin signaling in a clonal population of mouse neurotensin (NT) -expressing hypothalamic neurons, N-39. Leptin induced phosphorylation of STAT3 and MAPK ERK1/2, but not the downstream effector of PI3K, Akt, and also induced c-Fos protein. We found activation of p38 MAPK by leptin, accompanied by phosphorylation of its downstream effector ATF-1. Phosphorylation of ATF-1 is blocked by the p38 MAPK inhibitor SB 203580. We linked this signaling directly to NT transcription. Protein binding analysis indicates that both ATF-1 and c-Fos are capable of binding to the mouse NT/N gene predominantly at physiological or high concentrations of leptin. The evidence indicates activation of distinct leptin signal transduction pathways that directly result in changes in NT gene expression and links these specific neurons to the control of energy homeostasis.Cui, H., Cai, F., Belsham, D. D. Leptin signaling in neurotensin neurons involves STAT, MAP kinases ERK1/2, and p38 through c-Fos and ATF1.
Key Words: leptin receptor gene expression hypothalamus neurotensin/neuromedin N gene
THE HYPOTHALAMUS IS CRITICAL for regulating homeostatic processes such as feeding and energy expenditure (1)
. Control of energy homeostasis by the hypothalamus is modulated by circulating hormones and cytokines, such as leptin, the product of the obesity (Ob) gene, which is secreted mainly from adipocytes (2
, 3)
. Leptin signals through the leptin receptors, products of the diabetes (db) gene, and members of the cytokine receptor superfamily. These receptors are highly expressed in regions of the hypothalamus (4
, 5)
. The long form of the leptin receptor (ObRb) acts primarily through the activation of intracellular Janus family tyrosine kinase (JAKs) and the signal transducer and activators of transcription (STAT) signal transduction pathways (6
, 7)
. Phosphorylated STAT3 proteins dimerize and translocate to the nucleus to activate gene transcription (8)
. In vivo and in vitro studies demonstrate that the Janus-activated kinase (JAK) -STAT pathway is responsible for leptin regulation of energy homeostasis (9
, 10)
. STAT3 induces suppressor of cytokine signaling 3 (SOCS-3) protein expression, a negative regulator of leptin signaling (11)
.
In addition to STAT3 activation, leptin regulates other key signaling pathways. The mitogen-activated protein kinase (MAPK) family is involved in leptin signaling. Extracellular signal-regulated kinase 1/2 (ERK) is phosphorylated in response to leptin in a number of tissues and cells (8
, 12
13
14
15
16
17)
. Several investigators have reported that fasting increases the phosphorylation of ERK accompanied by regulation of transcription factors such as phospho-cAMP response element binding protein (CREB) and increased expression of c-Fos (18
19
20)
. Studies have also shown that leptin stimulates the Jun N-terminal kinase (c-Jun NH2-terminal kinase) (14
, 21
, 22)
or p38 MAP kinase (p38) (17
, 22
, 23)
. In addition, leptin has been shown to induce activation of phosphatidylinositol-3-kinase (PI3K) (15
, 17
, 24)
, which may be mediated by insulin receptor substrates 1 and 2 (IRS-1 and IRS-2) (25
26
27)
. Leptin also activates phosphodiesterase 3B (PDE3B), leading to a decrease in cyclic adenosine monophosphate (cAMP) levels (25
, 28)
. These pathways likely play a role in neuronal leptin signaling, perhaps in concert with JAK-STAT signaling. However, few studies have been done in specific brain cells, particularly the hypothalamus, the key site of leptin action. Little is known about the leptin receptor-induced downstream effectors of these signaling cascades especially with regard to leptin-mediated changes in gene transcription.
We previously reported that leptin induces expression of NT in a clonal, murine hypothalamic cell line generated in our laboratory (29)
. We have found that leptin-mediated up-regulation of NT requires binding of STAT3 to the 5' regulatory region of the mouse NT/N gene. In the present study we define the leptin signal transduction pathways and other downstream effector molecules involved in this process. We have determined that in addition to the classic JAK-STAT and MAPK ERK1/2 pathways, leptin directly activates the p38 MAPK pathway, resulting in specific phosphorylation of activated transcription factor-1 (ATF-1), but not CREB. Further, we elucidate that both ATF-1 and c-Fos bind to elements in the proximal promoter of the NT/N gene. This is the first demonstration that ATF-1 is involved in leptin signal transduction, and our observations provide further evidence that NT neurons may represent first-order neurons contributing to the leptin-mediated regulation of food intake and energy expenditure in the hypothalamus.
MATERIALS AND METHODS
Cell culture and treatments
Immortalized cell lines were grown as described (29)
. N-39 cells were grown overnight to 8090% confluency, and the medium was replaced with serum-free Dulbeccos modified Eagle medium (DMEM) with 1% BSA for 2 h. Cells were treated with leptin (R&D Systems, Minneapolis, MN, USA) for 4 h before harvesting total RNA to assay NT gene expression. For protein phosphorylation assays, cells were replaced with serum-free DMEM with 1% BSA for 18 h prior to leptin treatment to decrease background phosphorylation levels. Inhibitors of specific signal transduction cascades were used at the indicated concentrations and cells were preincubated with inhibitor for 1 h. The inhibitors used were SB 203580, SB 202190, and SB 239063 (all specific inhibitors of p38; Calbiochem, EMD Biosciences, Inc., San Diego, CA, USA), tyrphostin AG490 [a protein tyrosine kinase inhibitor of Janus kinase 2 (JAK2); A.G. Scientific, Inc., San Diego, CA, USA], U0126 (an potent inhibitor of both active and inactive MEK1,2; Calbiochem), and LY 294002 (a PI3K inhibitor; Cell Signaling Technology, Inc., Danvers, MA, USA).
Quantitative RT-polymerase chain reaction (RT-PCR)
Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) described in the TRIzol reagent protocol, and reverse transcription was performed with 2.5 µg of total RNA using SuperScript II and random primer as described in the Superscript II cDNA Synthesis Kit (Invitrogen). Quantitative real-time RT-PCR was performed according to the manufacturers instruction with SYBR Green Master Mix or TaqMan Universal polymerase chain reaction (PCR) Master Mix (Applied Biosystems, Foster City, CA, USA). The sequences of the primers for the beta actin gene are as follows: actin-SYBR-F: 5'CTTCCCCACGCCATCTTG3' (sense), actin-SYBR-R: 5'CCCGTTCAGTCAGGATCTTCAT3' (antisense). Primers were designed using Primer Express software (Applied Biosystems). Gene-specific TaqMan primers and probe of NT were purchased from Applied Biosystems. Data were represented as Ct values, defined as the threshold cycle of PCR at which amplified product was first detected, and analyzed using ABI Prism 7000 SDS software package (Applied Biosystems). Copy number of amplified NT gene was standardized to actin using the standard curve method (ABI Prism 7700 Users Bulletin). The final fold differences in expression were relative to the corresponding treatment or time-matched control.
SDS-polyacrylamide gel electrophoresis and Western blot analysis
Cell protein was prepared as described previously (29)
. Total protein (50 µg) was resolved on SDS-PAGE gels and blotted onto Immobilon-P transfer membranes (Millipore Corp., Bedford, MA, USA). The resulting blot was blocked with 5% skim milk in PBS containing 0.2% Tween 20 and incubated with primary antibody (Ab) overnight at 4°C. Protein was visualized using the Western Lightning Chemiluminescence Reagent Plus kit (PerkinElmer, Boston MA, USA). Akt, phospho-Akt (Thr 308), CREB, phospho-CREB (Ser-133, STAT3, and phospho-STAT3 (Tyr 705) antibodies were purchased from Cell Signaling Technology. ERK1/2, phospho-ERK1/2, p38, and phospho-p38 antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Protein was visualized on a Kodak Image Station 2000R using Kodak 1D Image Analysis Software 3.6 (Eastman Kodak Company, Rochester, NY, USA), allowing for the bands to be resolved within the linear range due to continuous digital imaging.
Nuclear extracts and electrophoretic mobility shift assays (EMSA)
Nuclear extracts were prepared as described previously (30)
. For EMSA, 5 µg of nuclear extract was incubated with 100 fmol of 32P-labeled STAT3 consensus oligonucleotide probe for 30 min at RT (Santa Cruz Biotechnology). Competition reactions were performed by incubating the EMSA reaction mix with the specified amount of excess unlabeled oligonucleotide for 10 min before adding the probe. Ab supershift assay was performed by incubating the EMSA reaction mix with 2 µl EMSA-specific anti-ATF-1, CREB, c-Fos, and Jun-D antibodies (Santa Cruz Biotechnology) for 1 h at room temperature before addition of the probe. The probe was a double-stranded oligonucleotide from 60 to 37 of the mouse NT/N gene (sequence: 5'-TGTAGCCAATGACATCACCTCCTG-3').
Chromatin immunoprecipitation assay
Chromatin immunoprecipitation analysis was performed as described (29)
. Briefly, cells were cross-linked and the cell pellet was resuspended in cell lysis buffer. Nuclei were lysed in the nuclear lysis buffer; 10% of the lysate was used as input control. The rest of the supernatant was incubated with 2 µl normal IgG, anti-ATF-1, and antic-Fos antibodies (Santa Cruz Biotechnology) at 4°C overnight, then 60 µl of a 50% salmon sperm DNA/protein G agarose slurry was added for 1 h at 4°C. Immunoprecipitates were washed sequentially for 5 min each in low- and high-salt wash buffers, and LiCl wash buffer. Bead precipitates were then washed twice with TE buffer and eluted twice with elution buffer. The eluates were combined and incubated at 65°C for 5 h to reverse the formaldehyde cross-linking. DNA was precipitated, dissolved in water, and treated with proteinase K at 45°C for 2 h. DNA was purified using Qiaquick spin columns (Qiagen Inc, Valencia, CA, USA) and eluted in 50 µl water. For PCR, 2 µl of DNA was amplified for 35 cycles. The following primers were used: 5'GGTACCAGAAGTACCTCTCACTATGC3' (sense), 5'AGCAGGAGGATGATGTCATGGCTA3' (antisense) from 252 to 36 bp of the mouse NT/N promoter.
Statistical analysis
Data were analyzed using 1-way ANOVA by GraphPad Prism (GraphPad Software Inc., San Diego, CA, USA) and statistical significance was determined using Tukeys multiple comparison tests or Students t test with P < 0.05.
RESULTS
Leptin induces the STAT3 and MAPK ERK1/2 pathways and c-fos protein synthesis, but not the PI3-K/Akt pathway
In an earlier study we noted that 1011 M (0.01 nM or 0.16 ng/ml) and 107 M (100 nM or 1600 ng/ml) leptin significantly induced NT gene expression in clonal hypothalamic N-39 cells that endogenously express the long form of the leptin receptor, ObRb (29)
. To define which pathways are activated by leptin, we determined the status of STAT3, ERK1/2, and AKT phosphorylation on leptin stimulation of ObRb by Western blot analysis. As shown in Fig. 1
, leptin (1011 M or 107 M) significantly induced phosphorylation of STAT3 by
1.4 ± 0.058 and 1.2 ± 0.032-fold at 15 min, respectively (Fig. 1A
), with a trend toward induction at 30 min, although these results were not statistically significant; leptin (1011 M or 107 M) induced phosphorylation of ERK 1/2 by
1.3 ± 0.014 and 1.23 ± 0.078-fold at 15 min, respectively (Fig. 1B
). However, there was no significant increase in Akt phosphorylation with leptin treatment (Fig 1C
). We also found that c-Fos protein was induced by leptin (1011 M or 107 M) at 30 and 60 min (Fig. 1D
).
|
p38 MAPK and ATF-1 are activated by leptin
In addition to JAK-STAT and ERK1/2 MAPK, evidence suggests that leptin administration increases p38 MAPK phosphorylation in peripheral sites (17
, 22
, 23
, 31)
. However, few studies have been performed in the hypothalamus to define the pathways involved in leptin sensitivity. To determine whether leptin regulates p38 MAPK in NT-expressing hypothalamic neurons, we examined the level of p38 MAPK phosphorylation using Western blot analysis. Exposure of N-39 neurons to leptin (1011 M or 107 M) resulted in a significant increase in the level of p38 MAPK phosphorylation at 5 min (1.56±0.075-fold and 1.52±0.080-fold; Fig. 2
A). We also examined the effect of leptin on phosphorylated CREB/ATF-1, a downstream effector of p38 MAPK (32)
. ATF-1 is a CREB-related transcription factor characterized by a b-ZIP DNA binding domain. The CREB Ab produces two bands and recognizes both CREB (upper band) and ATF-1 (lower band). Notably, leptin (1011 M or 107 M) exposure for 15 and 30 min significantly induced phosphorylation of ATF-1 (Fig. 2B, D
; 1.55±0.088-fold and 1.51±0.13-fold), but failed to affect phosphorylation of CREB (Fig. 2B, C
).
|
Leptin activates ATF-1 via p38 MAPK, while leptin-mediated induction of NT transcription can be linked to a number of signaling events
Although it is known that CREB/ATF-1 are downstream substrates of p38 MAPK, other signaling pathways have been shown to phosphorylate CREB/ATF-1. To determine whether p38 MAPK activation results in ATF-1 phosphorylation and if it plays a role in cAMP response element (CRE) -dependent gene expression, we used the p38 MAPK inhibitor, SB 203580. We analyzed CREB/ATF-1 phosphorylation by Western blot analysis in the presence or absence of SB 203580 (10 uM). Leptin-stimulated ATF-1 phosphorylation was blocked by SB 203580 (Fig. 3
A), while CREB phosphorylation was unaffected. To determine whether the induction of NT gene expression by leptin was mediated by p38/ATF-1 phosphorylation, N-39 neurons were treated with or without leptin (1011 M or 107 M) in the presence or absence of SB 203580, SB 202190, or SB 239063 (all specific p38 inhibitors, 10 uM). NT mRNA was quantified by real-time RT-PCR. Leptin (1011 M or 107 M) induced neurotensin gene expression by 1.48- and 1.41-fold, respectively, similar to levels previously reported (29)
, and the JAK2 inhibitor AG490 blocked the leptin-mediated induction of NT gene expression in N-39 neurons (Fig. 3B
). SB 203580 alone induced NT gene expression by 2.2-fold (Fig. 3B
), indicating that the p38 MAPK pathway is perhaps involved in regulating basal NT transcription. Further, SB 203580 blocked the induction of NT at both concentrations of leptin. Because SB 203580 alone induced NT gene expression and therefore may have alternative effects on NT gene expression, we used two other inhibitors of p38 to confirm the p38-mediated effect on NT gene expression. Neither SB 202190 nor SB 239063 caused an induction of basal NT transcription but they were able to block the leptin-mediated increase in NT mRNA (Fig. 3B
). We also used pharmacological inhibitors of PI3K and ERK1/2 MAPK to determine the necessity of these signaling events to NT gene regulation. We found that U0126, a MEK1/2 inhibitor that is able to block the downstream effects of ERK1/2, also blocked induction of NT by leptin, but only at 107 M leptin (Fig. 3B
). Although we do not see any increased phosphorylation of Akt on leptin treatment, we found that the inhibitor of PI3K LY294002 appears to inhibit the leptin-mediated increase in NT gene expression (Fig. 3B
).
|
Leptin induces enhanced binding of protein to the CRE/activating protein-1 response element of the NT/N promoter
To study NT gene regulation by leptin at the transcriptional level and whether ATF-1 or c-Fos binding was involved, we focused on a region of the 5' flanking region of the mouse NT gene that contains a CRE/activating protein-1 (CREB/AP-1) site described in rat and human genes (33)
. The prohormone gene contains coding regions for the two peptides, NT and neuromedin N, and therefore is properly referred to as NT/N. The mouse NT/N promoter contains binding sites for a number of transcription factors, and we have described the leptin-responsive region containing cis-regulatory motifs located within 381 bp to 250 bp (131 bp) of the NT/N gene (29)
. In particular, we found that STAT binding within this region is induced by leptin exposure (29)
. In this study, the CREB/AP-1-like motif (TGACATCA) at 60 to 37 was of particular interest due to the induction of c-Fos protein andATF-1 phosphorylation by leptin, and its putative involvement in NT gene regulation. This region is 100% homologous in the mouse, rat, and human (29)
. We therefore examined binding activity of ATF-1 and c-Fos at the level of the mouse NT/N promoter region encompassing this CREB/AP-1 element. Using EMSA with a CREB/AP-1 oligonucleotide from 60 to 37 of the mouse NT/N gene, we detected four protein complexes with N-39 nuclear extracts: S1 and S2 appear to be regulated by leptin exposure (Fig. 4
A) whereas the two faster migrating complexes (NS) did not change upon leptin exposure (data not shown). We demonstrate that nuclear extracts from N-39 neurons treated with leptin (1011 M or 107 M; 15 min) increased complex formation of S1 and S2 (Fig. 4A
, lanes 2 and 3) compared with nuclear extracts from untreated cells (Fig. 4A
, lane 1). Unlabeled CREB/AP-1 oligonucleotides were able to compete for formation of these complexes (Fig. 4A
, lanes 46).
|
Ab supershift assays using leptin-treated nuclear extracts from N-39 cells indicate that ATF-1 and c-Fos antibodies are capable of producing a slower mobility complex or a supershift (SS) (Fig. 4B
, lanes 9 and 10). The supershift appears to originate from the S1 complex due to decreased levels of this complex upon addition of Ab, indicating that ATF-1 and c-Fos are both part of the S1 complex. CREB or JunD antibodies do not produce a detectable supershift, but the levels of S1 complex do appear to decrease upon addition of Ab; therefore, we cannot completely rule out binding of CREB or JunD to the S1 complex using EMSA (Fig. 4B
, lanes 8 and 11). IgG did not affect either S1 or S2 complex formation (Fig. 4B
, lane 7). Chromatin immunoprecipitation (ChIP) was utilized to demonstrate whether the CREB/AP-1 region of the NT/N promoter was active in cell culture and whether leptin would affect in vivo binding of the transcription factors to these elements. ChIP analysis indicates that leptin induces enhanced binding of ATF-1 or c-Fos to the 252 to 36 bp region of the NT/N gene containing the CRE/activating protein-1 element, as detected by PCR (Fig. 4C
). It appears that binding of ATF-1 is more prevalent at 1011 M leptin, whereas c-Fos binding is predominantly at 107 M leptin. PCR analysis did not detect any occupancy in the normal IgG control (Fig. 4C
). Together, these results suggest that transcription factors ATF-1 and c-Fos may be involved in the leptin-mediated induction of NT gene expression at the consensus CREB/AP-1 site (Fig. 4D
).
DISCUSSION
Leptin induces its effects through the ObRb, which is expressed primarily in the hypothalamus (34)
. It is well documented in vivo that the JAK-STAT pathway is involved in this process. The mechanisms involved in alternative leptin signaling in the hypothalamus are poorly understood, although it is accepted that other important pathways are necessary for all of the diverse functions ascribed to leptin (9)
. The hypothalamus itself is a heterogeneous population of cell types, each expressing a distinct combination of neuropeptides, receptors, and neuromodulators. As a result, it is difficult to study the signal transduction events in individual neurons from the hypothalamus. To circumvent this problem, we generated clonal hypothalamic cell models representing many unique hypothalamic cell types, including the NT-expressing cell model N-39 (29
, 35)
. These neurons represent the first central cell models available to study endogenous leptin receptor signal transduction and permit analysis of differential leptin-mediated signaling events in divergent cell types. Emerging data from analysis of leptin receptor activation in peripheral tissues paint a diverse picture of overlapping signal transduction pathways that are likely accountable for cell-specific responses. We expect that these convergent pathways will allow for cell-specific responses to leptin stimulation in individual cell types from the hypothalamus.
Studies based on peripheral tissues have shown leptin-mediated activation of the p38 MAP kinase pathway. Leptin activates p38 MAPK in skeletal muscle cells, where it contributes to glucose (Glc) uptake by modulating the intrinsic activity of Glc transporters (36
, 37)
. Using immunohistochemistry in mouse hypothalamus, Morikawa et al. reported that fasting increased phosphorylation of p38 MAPK in periventricular nucleus (PVN) neurons but not in arcuate nucleus (Arc) NPY neurons. Fasting also increased phosphorylation of ERK, CREB, and c-Fos, which accompanied an increase in NPY expression within Arc neurons (20)
. However, they were unable to detect pCREB in the PVN neurons, which supports our results indicating that p38 MAPK activates ATF-1, but not pCREB, in the N-39 neurons. These studies demonstrate the possibility of presence of cell- and region-specific effects of leptin in the hypothalamus.
Hypothalamic NT neurons are responsive to leptin (38
39
40)
. Evidence from in vivo studies in rats indicates that NT may modulate the central effects of leptin on feeding behavior (41
, 42)
. We previously reported that leptin directly induces NT gene expression in clonal NT-expressing hypothalamic cell models, N-39 and N-36/1, and that this induction requires STAT3 binding at the level of the NT/N promoter region (29)
. We therefore sought to define the leptin-mediated signal transduction events in these cells. The results here demonstrate that in the N-39 neurons, leptin significantly induces p38 MAPK activity, causing phosphorylation of its downstream substrate ATF-1, a CREB-related transcription factor. The increase in pATF-1 activity was completely inhibited by SB 203580, indicating that the p38 pathway is an upstream mediator of ATF-1-specific phosphorylation in these cells. In contrast, leptin did not alter the level of pCREB and binding activation, indicating that ATF-1 plays a major role in what appears to be cell-specific leptin signaling.
In SH-SY5Y neuroblastoma cells, leptin signaling through ERK1/2 has been linked to cell proliferation and inhibition of apoptosis (15)
, whereas in MCF-7, a breast cancer cell model, leptin signaling through ERK1/2 has been shown to potentiate estrogen action and aromatase activity (16
, 43)
. These actions likely occur via SHP-2, which binds tyrosine 985 of the ObRb, leading to activation of the ERK pathway and induction of c-Fos expression in cells transfected with ObRb (8
, 44)
. In the N-39 neurons, which endogenously express ObRb, we found induction of ERK1/2 phosphorylation and c-Fos protein expression by leptin. ERK1/2 signaling is necessary for the leptin-mediated induction of NT gene expression in N-39 neurons as demonstrated by inhibitors of MEK1/2, an upstream effector of ERK1/2, but only at 107 M leptin. This also correlates with the increased binding of ATF-1 to the NT/N promoter at the higher leptin concentration. Although CREB is classically known as a PKA effector, CREB is also a major downstream substrate of ERK1/2 activation. It has been shown that CREB/ATF-1 binding at the CRE activates c-Fos gene expression (45)
. There is evidence that activation of ERK1/2 induces c-Fos gene expression in a number of cell types, and this gene regulation can be CREB/ATF-1 dependent or independent. We speculate in our N-39 model that acute ERK1/2 phosphorylation by leptin induces c-Fos gene expression at 3060 min and is a permissive step in the regulation of NT transcription by leptin.
The Fos, Jun, CREB, and ATF proteins belong to the leucine zipper family of proteins (46)
. These transcription factors are expressed at different levels and can homo- or heterodimerize to form inhibitory or stimulatory complexes depending on the cell type studied. Therefore, it is possible that functional cross-talk between these transcription factors may serve as a mechanism to achieve cell-specific gene expression. In N-39 neurons, leptin selectively induces ATF-1 phosphorylation and c-Fos protein expression. We reveal that activated ATF-1 and c-Fos bind to the AP-1-like element in the proximal promoter of the mouse NT/N gene. To our knowledge, we are the first to analyze promoter activity of the mouse NT/N gene (29)
. Elegant analysis of the rat NT/N promoter in rat PC12 pheochromocytoma cells and BON intestinal N cells indicates that it contains a proximal CREB/AP-1-like motif that binds c-Jun, JunD, CREB, and ATF proteins, a near-consensus glucocorticoid response element, and a distal consensus AP-1 site that binds c-Fos, Fra-1, and JunD (33
, 47)
. At the AP-1 site, there appear to be cell-specific and family member-specific binding effects of immediate early transcription factors (47
, 48)
. Previous studies have indicated that ATF and c-Jun bind to the rat NT/N promoter to activate NT gene transcription after combined treatment with neuronal growth factor, glucocorticoid, and an adenylate cyclase activator in rat PC12 pheochromocytoma cells (33
, 48)
. However, PC12 cells do not normally express the NT/N gene in unstimulated cells, and no changes in gene expression can be detected upon treatment with single agents alone (47)
. We do not yet know the dimerization partner for c-Fos binding to the AP-1 site in the NT/N gene, although our EMSA analysis may implicate JunD as a candidate. Additional studies must be done to analyze the complex interactions between transcription factors at the level of the mouse NT/N gene promoter using deletion and linker scanning mutants.
It appears that leptin and insulin may compose a cross-talk network associated with PI3K activity and increased IRS1 and IRS2 phosphorylation in certain hypothalamic neurons to regulate energy homeostasis (3)
. A recent study indicates that the decrease in NPY and AgRP by leptin requires PI3K, but not STAT3, signaling in rats, as determined by the PI3K inhibitor LY294002 (49)
. PI3K typically activates Akt (also known as PKB); however, in our cell model we found no significant activation of Akt by leptin. Other reports have also shown that leptin has little or no effect on Akt or that leptin activates IRS/PI3K signaling without a corresponding increase in Akt phosphorylation (50)
. Our results may reach this same conclusion, as the PI3K inhibitor LY294002 is able to block the leptin-mediated increase in NT gene expression. We predict, therefore, that the neurotensin system may in fact be a parallel or first-order neuron regulated by leptin and may not specifically require Akt activity for its downstream effects on feeding, but instead may use an as yet unknown substrate of PI3K for NT gene activation.
Leptin can achieve highly divergent and apparently cell-specific regulation of a number of signal transduction pathways. We have linked leptin-mediated p38 activation to ATF-1 phosphorylation, but it has no effect on CREB. This is the first description of p38/ATF-1 activation by leptin in hypothalamic neurons. We propose that regulation of NT gene expression by leptin involves synergistic interactions between the JAK-STAT, p38, and ERK1/2 signal transduction pathways, resulting in downstream activation of a number of transcription factors that likely include STAT3, ATF-1, and c-Fos (Fig. 5
). These proteins bind to the mouse NT/N promoter region at the previously defined CREB/AP-1 and STAT binding sites to direct transcription of the NT gene. It is intriguing that there appears to be differential binding to the CREB/AP-1 site depending on the concentration of leptin used in the study. For instance c-Fos binds more prevalently at the higher leptin concentration (107 M) whereas ATF-1 binds predominantly at the more physiological leptin concentration. We also detected this kind of effect in our analysis of STAT3 binding to the NT/N promoter, which was more prevalent at a greater physiological level of leptin (1011 M) (29)
. The MEK inhibitor results also indicate that the ERK1/2 pathway is predominantly active at the 107 M leptin concentration, as blocking this pathway with U0126 at the 1011 M leptin concentration had no effect on the induction of NT mRNA levels. We therefore again speculate that leptin may induce differential signaling pathways and effector molecules at physiological vs. supraphysiological leptin levels. This may therefore provide a potential mechanism by which leptin resistance develops in the obese, although we acknowledge that the 107 M concentration used in this study is much higher than that detected in serum from obese patients. These studies provide further evidence that NT neurons of the hypothalamus may indeed be first-order neurons responsive to leptin that, in turn, regulate NT-responsive neuronal cell types. Since NT has been described as a potent anorexigenic compound and therefore decreases feeding, we suggest this may be a mechanism by which NT neurons from the hypothalamus contribute to the regulation of energy homeostasis.
|
ACKNOWLEDGMENTS
Thanks to members of the Belsham Lab for critical reading of the manuscript. We thank Danny Titolo for technical assistance. This work was supported by the Canadian Institutes for Health Research (CIHR). D.D.B. holds a Canada Research Chair in Neuroendocrinology and is a Canada Foundation for Innovation Researcher.
Received for publication March 13, 2006. Accepted for publication July 17, 2006.
REFERENCES
-melanocyte stimulating hormone directly induce neurotensin (NT) gene expression in novel NT-expressing cell models. J. Neurosci. 25,9497-9506This article has been cited by other articles:
![]() |
C. Hindmarch, M. Fry, S. T. Yao, P. M. Smith, D. Murphy, and A. V. Ferguson Microarray analysis of the transcriptome of the subfornical organ in the rat: regulation by fluid and food deprivation Am J Physiol Regulatory Integrative Comp Physiol, December 1, 2008; 295(6): R1914 - R1920. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wauman, A.-S. De Smet, D. Catteeuw, D. Belsham, and J. Tavernier Insulin Receptor Substrate 4 Couples the Leptin Receptor to Multiple Signaling Pathways Mol. Endocrinol., April 1, 2008; 22(4): 965 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. He, J. Jiang, M. Kokkinaki, N. Golestaneh, M.-C. Hofmann, and M. Dym Gdnf Upregulates c-Fos Transcription via the Ras/Erk1/2 Pathway to Promote Mouse Spermatogonial Stem Cell Proliferation Stem Cells, January 1, 2008; 26(1): 266 - 278. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |