FASEB J. Experimental Biology 2009
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published as doi: 10.1096/fj.06-6133fje.
This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
fj.06-6133fjev1
20/14/2648    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Contin, M. A.
Right arrow Articles by Guido, M. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Contin, M. A.
Right arrow Articles by Guido, M. E.
(The FASEB Journal. 2006;20:2648-2650.)
© 2006 FASEB

An invertebrate-like phototransduction cascade mediates light detection in the chicken retinal ganglion cells

Maria Ana Contin, Daniela M. Verra and Mario E. Guido1

CIQUIBIC (CONICET)-Departamento de Química Biológica, Facultad de Ciencias Químicas, Universidad Nacional de Córdoba, Córdoba, Argentina

1Correspondence: CIQUIBIC- Departamento de Química Biológica, Facultad de Ciencias Químicas, Universidad Nacional de Córdoba, Ciudad Universitaria, 5000 Córdoba, Argentina. E-mail: mguido{at}mail.fcq.unc.edu.ar

ABSTRACT

Prebilaterian animals perceived ambient light through nonvisual rhabdomeric photoreceptors (RPs), which evolved as support of the chordate visual system. In vertebrates, the identity of nonvisual photoreceptors and the phototransduction cascade involved in nonimage forming tasks remain uncertain. We investigated whether chicken retinal ganglion cells (RGCs) could be nonvisual photoreceptors and the nature of the photocascade involved. We found that primary cultures of chicken embryonic RGCs express such RP markers as transcription factors Pax6 and Brn3, photopigment melanopsin, and G-protein q but not markers for ciliary photoreceptors ({alpha}-transducin and Crx). To investigate the photoreceptive capability of RGCs, we assessed the direct effect of light on 3H-melatonin synthesis in RGC cultures synchronized to 12:12 h light-dark cycles. In constant dark, RGCs displayed a daily variation in 3H-melatonin levels peaking at subjective day, which was significantly inhibited by light. This light effect was further increased by the chromophore all-trans-retinal and suppressed by specific inhibitors of the invertebrate photocascade involving phosphoinositide hydrolysis (100 µM neomycin; 5 µM U73122) and Ca2+ mobilization (10 mM BAPTA; 1 mM lanthanum). The results demonstrate that chicken RGCs are intrinsically photosensitive RPs operating via an invertebrate-like phototransduction cascade, which may be responsible for early detection of light before vision occurs.—Contin, M. A., Verra, D. M., Guido, M. E. An invertebrate-like phototransduction cascade mediates light detection in the chicken retinal ganglion cells


Key Words: RGCs • rhabdomeric photoreceptors • melatonin • phosphoinositide cascade

LIGHT STRONGLY INFLUENCES life of all living beings on the planet through the stimulation of the visual system and the regulation of the circadian timing system (1) . The vertebrate retina contains circadian clocks that temporally regulate its physiology, as well as photoreceptors responsible for the synchronization of the circadian system to environmental illumination conditions (2 3 4) . These oscillatory and photoreceptive capacities are likely to converge all together on selected cell populations. However, the identity of circadian photoreceptors/photopigments and the neurochemical cascade participating in the light entrainment and other nonvisual functions of nonmammalian vertebrates are still unknown. In the absence of formal vision, the retina may act as a sensor of the environmental illumination conditions. In mammals suffering retinal degeneration with complete loss of their photoreceptor cells (cones and rods), light still regulates a number of nonvisual activities necessarily implying that other retinal cells may display oscillatory behaviors and light responsiveness (2 , 5 6 7 8) ; remarkably, these responses are lost with enucleation. Vertebrate retinal ganglion cells (RGCs) are responsible for sending photic information to the brain that synchronizes endogenous clocks to the environmental lighting conditions (1 , 2) . A subset of RGCs in mammals participates in an independent circuitry that regulates a number of nonimage forming (NIF) tasks: light entrainment of activity rhythms, pupillary light responses, melatonin suppression by light, sleep, and masking (2) . RGCs that expressed photopigment melanopsin (Opn4; ref. 9 ) were shown to be intrinsically photosensitive (10) and proposed to act as circadian photoreceptors. To date, the nature of the biochemical events operating in the circadian phototransduction of vertebrates is still uncertain. Different laboratories have attempted to identify the phototransduction cascade taking place in the intrinsically photosensitive RGCs by using diverse approaches such as cultured Xenopus dermal melanophores (11) or Xenopus oocytes (12) . In addition, transient expression of Opn4 in HEK293 cells (13) and in Neuro-2a cells (14) has rendered mammalian cells photoresponsive. It has been known for a long time from electron-optic microscopic studies that animal photoreceptor cells can be of two distinct morphologies, ciliary photoreceptors, such as retinal rods and cones and pinealocytes, and rhabdomeric photoreceptor cells of invertebrates (15) , which can coexist in many bilaterian groups. At the molecular level, the comparison of molecules involved in the specification of ancient rhabdomeric photoreceptors revealed many resemblances with RGCs (15) supporting the idea that RGCs have evolved from a rhabdomeric photoreceptor precursor cell. In birds, RGCs are rhythmic themselves containing autonomous clocks that synthesize melatonin and phospholipids in a rhythmic manner in constant darkness (DD) with higher levels during the subjective day (16 17 18) , and they express putative photopigments/photoisomerases (19 20 21) .

Classical phototransduction in vertebrates involves the activation of a particular heterotrimeric G-protein {alpha}-transducin ({alpha}-trans) that activates the effector enzyme cGMP phosphodiesterase (PDE), which hydrolyzes cGMP to 5'-GMP; this, in turn, leads to closure of cyclic nucleotide-gated (CNG) channels and the dropping off of Ca2+ influx and of the dark currents with the corresponding cell hyperpolarization (22) . By contrast, phototransduction in invertebrates implies a distinct G-protein isoform, Gq that activates a phospholipase C isoform (PLCß4) instead (23) . PLC hydrolyzes phosphoinositides (PIP2) to diacylglycerol (DAG) and inositol-P3 (InsP3). This leads to opening of two classes of Ca2+-permeable light-sensitive channels: transient receptor potential (TRP) and TRP-like (TRPL) channels and/or release of Ca2+ from the InsP3-sensitive stores (24) . All this produces the depolarization of the cell membrane.

Here, we investigated the intrinsic photoreceptive capability of chicken RGCs in culture by assessing the effect of light on the synthesis of radioactive melatonin; once this ability was confirmed, we examined the nature of the phototransduction cascade operating in these retinal cells.

MATERIALS AND METHODS

Purification and culture of RGCs from chicken embryos
RGCs were purified from embryonic day 8 (E8) neural retinas dissected in ice-cold Ca2+- Mg2+ free Tyrode’s buffer containing 25 mM glucose (Glc), according to Brocco and Panzetta (25) with modifications (18) . Briefly, cells were trypsin treated and rinsed with soybean trypsin inhibitor and Dulbecco’s modified Eagle’s medium (DMEM). After dissociation, the cell suspension from 30–60 retinas was poured into Petri dishes pretreated with 10 µg/ml protein A followed by incubation at 37°C for 30 min with an anti-chicken Thy-1 polyclonal antibody (pAb) raised in our laboratory (25) . After being washed exhaustively, identical aliquots of the remaining bound RGCs were harvested in DMEM containing B27 (Life Technologies, Invitrogen, GIBCO, Carlsbad, CA; dilution: 1/500 v/v) and seeded in petry dishes previously treated with 20 µg/ml polylysine and 5 µg/ml laminin. B-27 supplement includes retinyl acetate in a concentration ~0.61 µM according to Brewer et al. (26 27) . Characterization of harvested cells was performed by double immunostaining with RGC markers, as described previously (18 , 25) . The RGC cultures were incubated at 37°C under constant 5% CO2-air flow in a humid atmosphere. The following day, cultures were synchronized to a 12:12 h light-dark (LD) cycle for 4 days (L: cool white fluorescence light of 1500 lux turned on at time 0 and off 12 h later). Times were designated as zeitgeber times (ZTs) of which ZT0 and ZT12 correspond to the phases of the LD cycle, at which lights were turned on and off, respectively. On day 5, lights were turned on at ZT0 and turned off at ZT12 for cultures exposed to light, and cells were collected at different ZTs from 0 to 12 as indicated. After synchronization to the 12:12 LD cycle, dark controls remained in the dark on day 5 and cells were collected at the same times as those from light-exposed cultures. For this, both groups (light-exposed, and dark control cultures) were incubated in the same CO2-incubator and placed in two different compartments separated by an aluminum dividing wall. Light intensity in each compartment was measured by a lightmeter (Extech Instruments, model 401036), and intensity detected in cultures maintained in the dark was lower than 5 lux all through the experiments. All procedures involving egg handling, retina dissection, and immunopanning of RGCs were performed under dim light (<5 lux).

Chicken Thy-1 purification and antisera preparation
Preparation of anti chicken Thy-1 sera was performed as described previously (25) . Briefly, Thy-1 was purified from chicken brains at 4°C in the presence of protease inhibitors. Brains were homogenized and after removing nuclei and cellular debris, the supernatant was spun down to obtain the membranes. They were treated with phosphatidylinositol specific phospholipase C under continuous stirring. After spinning down, the supernatant was applied to a lentil lectin-Sepharose 4B column. The bound material was eluted with 1-methyl-{alpha}-D-glucopyranoside in 0.01 M Tris buffer. Fractions reacting with MAbs to Thy-1 were pooled, concentrated and run in a PAGE. The 23 kDa bands reactive to MAbs to Thy-1 were used for raising antisera in two rabbits, injecting intramuscularly (im) the purified chicken Thy-1 plus complete Freund’s adjuvant. Injections by the same via and dose were repeated a week later. After 3 wk and thereafter every 4–6 wk, the antigen in PBS/incomplete Freund’s adjuvant was injected. Bleedings were done 10 days after each boost, and the sera from each animal were pooled and heat-inactivated.

Synthesis of 3H-melatonin in RGC cultures after incubation with L-[5-3H]tryptophan
On day 5, L was turned on at time 0 (ZT0) and off 12 h later (ZT12), while cells were fed 25 µCi/ml of L-[5-3H]tryptophan (25 Ci/mmol, Amersham Biosciences, Piscataway, NJ) with a specific activity of 323 µCi/µmol, for 4–8 h at different phases across a 24 h-period. Controls that remained in the dark during the 3H-tryptophan labeling received identical treatment. After the end of labeling, the culture medium and cells were collected all together, resuspended in 0.1 M HCl, and kept on ice until melatonin extraction was carried out as described in the following section. Before extraction, aliquots from the cells were collected for protein quantification by the Bradford method. Blanks (medium without cells incubated with 3H-tryptophan or 0 time point of incubation) were included to discard the nonenzymatic production of melatonin or any eventual contamination during the extraction. In all cases, blanks were subtracted from the total radioactivity measured and, they represented <10–12% of the total labeling. Results of 3H-melatonin are presented as pg/mg of protein. To calculate pg of melatonin produced, it was considered that 1 mmol of 3H-tryptophan (specific activity: 323 µCi/µmol) generates 1 mmol of 3H-melatonin; e.g.: 710 dpm/mg prot = 1 x 10–9 mmol = 2.32 x 10–4 pg.

Melatonin assay
Melatonin from the RGC cultures was purified as described previously by Faillace et al. (28) . Briefly, RGC culture samples were homogenized in 0.1 M HCl, and melatonin was extracted with 5 ml of dichloromethane and determined in each sample by a two-dimensional thin layer chromatography (2D-TLC) (29) . The organic phase was washed twice with 2% NaHCO3 and with distilled water. The organic phases containing the 3H-melatonin from the labeling experiments of RGC cultures were dried under vacuum and resuspended in 50 µl of chloroform/methanol (9:1). 3H-Melatonin and other methoxyindoles were separated by a 2d-TLC on silica gel 60 precoated plates with fluorescent indicator UV254 (Macherey-Nagel, Düren, Germany) and developed in the first direction with a solvent system made up of chloroform/methanol/glacial acetic acid (90:10:1 by vol), and in the second direction with ethyl acetate. Standards of tryptophan, N-acetyltryptamine, N-acetylserotonin, methoxytriptophol, methoxyindole acetic, and melatonin were visualized by UV. The radioactivity in the areas corresponding to melatonin and tryptophan was assessed by scrapping and counting in a liquid scintillation counter.

Cell treatment with Inhibitors of signaling pathway components
The following signaling pathway inhibitors were used as described previously (11 , 12) : neomycin (Neo, 100 µM) and U73122 (5 µM, 1.5 h treatment) [phosphoinositide phospholipase C (PLC) inhibitors]; 1,2-bis-(o-aminophenoxy)-ethane-N,N,N',N'-tetraacetic acid tetraacetoxymethyl ester (BAPTA-AM; 10 mM) (Ca2+ chelator); lanthanum (La3+, 1 mM) TRP and TRPL-channel blocker; refs 12 , 30 ); and NO donor sodium nitropuriside (SNP) 1 mM (guanylate cyclase activator) and zaprinast [0.1 M; phosphodiesterase 6 (PDE6) inhibitor; ref 31 , 32 ]. Cells were fed all-trans-retinal (0.1 µM) as chromophore (12 , 33) . All drugs were from Sigma-Aldrich (St. Louis, MO).

Cells previously synchronized to the LD cycles for 4 days and released to darkness on the fifth day were treated with various effector drugs described above and maintained in the cultures until the synthesis of 3H-melatonin was stopped. Stock solutions of effectors were prepared in dimethyl sulfoxide (DMSO), distilled water or PBS buffer as described previously (11) such that the final solvent concentration in the culture medium did not exceed 0.5% (v/v). Controls were performed by adding 0.25% (v/v) DMSO to the medium. The concentration of DMSO used had no effect on 3H-melatonin biosynthesis.

RNA isolation and cDNA synthesis
Total RNA from RGC cultures was extracted following the method of Chomczynski and Sacchi (1987) (34) using the TRIzo kit for RNA isolation (Invitrogen). Finally, total RNA was treated with DNase (Promega) to eliminate contaminating genomic DNA. cDNA was synthesized with M-MLV (Promega) using oligo(dT).

Polymerase chain reaction
Polymerase chain reaction (PCR) reactions were carried out according to Babity et al. (1997) (35) with an initial denaturation step of 1 min at 94°C, 25 cycles of 60 s at 94°C, 50 s at 60°- 65°C, 90 s at 72°C, and a final 5-min elongation step at 72°C. Amplification products were separated by agarose gel electrophoresis and visualized by ethidium bromide staining.

Real-time PCR
cDNA samples from RGC cultures were used for each SYBR Green PCR assay. The real-time PCR (QPCR) reactions were carried out in a 7500 Real Time PCR system (Applied Biosystems, Foster City, CA). The reactions were performed using the SYBR Green PCR Master Mix (Applied Biosystems) according to Brocco et al. (36) . Each SYBR green reaction (25 µl total vol) contained 5 µl of diluted cDNA (8 ng/µl) as template. To verify that the SYBR Green dye detected only one PCR product, all the reactions were subjected to the heat-dissociation protocol after the final cycle of PCR. Direct detection of PCR products was monitored by measuring the increase in fluorescence caused by the binding of SYBR Green I dye to double-stranded DNA. All the samples were tested against the "housekeeping" gene beta-actin (ß-actin) for normalization of data (37) . Each reverse transcriptase (RT)-PCR quantitation experiment was performed in triplicates for three independent experiments.

PCR and QPCR primers
The following Gallus gallus sequences were used: glyceraldehyde 3-phosphate dehydrogenase (GAPDH; ACCESSION K01458); Pax 6 (ACCESSION NM_205066); Brn3 (developmental transcription factor) (ACCESSION X91998); Crx (ciliary transcription factor) (ACCESSION AF285171); melanopsin (Opn4, ACCESSION AY036061); guanine nucleotide binding protein (G protein), alpha 11 (Gq class) (Gq; ACCESSION AF364328); gallus gallus cone-type transducin alpha subunit ({alpha}-trans; ACCESSION AF200339); cryptochrome 1 (Cry1; ACCESSION NM_204245); cryptochrome 2 (Cry2; ACCESSION NM_204244); hydroxyindole-O-methyltransferase (HIOMT; ACCESSION X62309); arylalkylamine N-acetyltransferase (AA-NAT; ACCESSION NM_205158).

Oligonucleotides were designed using the Vector NTI Advance 10 program to generate 200–600 base pair products with minimal hairpin or loop formation. The oligonucleotide sequences used for RT-PCR were as follows: GAPDH forward: 5'AGGCGAGATGGTGAAAGTCG3', reverse: 5' TCTGCCCATTTGATGTTGCT3'; Pax6 forward: 5' GGGAGTAGAGGCACGCAGATGT3', reverse: 5' GGAGTCGCTACTCTCGGCTTACTA 3'; Crx forward: 5' GCACAGCCCAGAGCATGATGTCC 3', reverse: 5' CTCCAGGATGTCCAACTGCGCC 3'; Opn4 forward: 5' TGCTTTGTCAACAGCTTGCACAGAG 3', reverse: 5' CAGCAATAATCTGTATGGTGCGCTTC3'; Gq forward: 5' TCAAAACATCTTCACTGCCATG 3', reverse: 5' TCCACGTCGCTGAGATAGTATT 3'; {alpha}-transducin forward: 5' AAGGACCTCAACTTCAGGATGT 3', reverse: 5' CAGTCCTTGAGGTTCTCCTTG3'; Cry1 forward: 5' AGAGAGTGTCCAGAAGGCTGCAAA 3', reverse: 5' ACTGTTGCAAGAAGACCCAGTCCT 3'; Cry2 forward: 5' CCAAGTGCATCATTGGAGTGG 3', reverse: 5' CTTCAGTGCACAGCTCTTCTGCTC 3'; HIOMT forward: 5' TTACTGCATTTGACCTTTCCC 3', reverse: 5' CCTCCCCAGAACAGCATCATA 3'; AA-NAT forward: 5' ACAGGCACCTTTACAGCACGAGA 3', reverse: 5' CTGCTTCACGACAAACCAAGGCAT3'.

QPCR oligonucleotides were designed to generate 100–250 base pair products with minimal hairpin or loop formation. The oligonucleotide sequences used for RT-QPCR were as follows: ß-actin forward: 5' CACAGATCATGTTTGAGACCTTCA 3', reverse: 5' GATGGGCACAGTGTGGGTAAC 3'; HIOMT forward: 5' GGCTTGCCTTTGGATTTGAAT 3', reverse: 5' CAGCAACTCTGCACGTTTCTTT 3'; AA-NAT forward: 5' ACAGGCACCTTTACAGCACGAGA 3', reverse: 5' CTGCTTCACGACAAACCAAGGCAT3'; Opn4 forward: 5' CCTGAAGAGGAAGAGACTGAATTATTC 3', reverse: 5' AGCTTCGAGGAACTCTGTAGATGAG 3'.

Statistics
Statistical analyses involved one- or two-way ANOVA with Duncan post hoc test or Student’s t test, when appropriate (significance at P<0.05).

RESULTS

To characterize the primary chicken embryonic RGC cultures as potential circadian photoreceptors, in these cells we investigated the presence of 1) developmental/specification markers for ancient rhabdomeric photoreceptor (RP) cells: the transcription factors of the homeodomain superfamily Pax-6 and Brn3 and the photopigment Opn4; 2) the G proteins {alpha}-transducin and Gq as components of the vertebrate and invertebrate phototransduction cascades respectively; 3) the clock genes cryptochromes 1 and 2 (Cry1 and Cry2); and 4) the melatonin-synthesizing enzymes serotonin N-acetyltransferase (AA-NAT) and hydroxyindole-O-methyl transferase (HIOMT) as clock-outputs. The expression of these RNAs in RGC cultures assessed by RT-PCR and RT-QPCR is shown in Fig. 1 ; results demonstrated detectable levels of rhabdomeric photoreceptor markers Pax-6, Brn3, Gq, and Opn4 but not of markers for ciliary photoreceptors, the G-protein {alpha}-transducin, and the developmental factor Crx (Fig 1A ). These cultures also expressed detectable levels of two key melatonin-synthesizing enzymes (AA-NAT and HIOMT), and the clock genes Cry1 and Cry2 (Fig. 1A ). Interestingly, levels of HIOMT in RGCs at E8 (RGC E8) assessed by RT-QPCR are appreciable but lower than levels found in the whole retina at E8 (RET E8), whereas for AA-NAT and Opn4, mRNA levels in RGC cultures were significantly higher than those seen in the whole retina at the same embryonic state (Fig. 1B ). In addition, levels of HIOMT, AA-NAT, and Opn4 mRNAs in the whole retina significantly increased through the embryo development reaching higher values at E18 that were 352-, 1014-, and 31-fold higher than those at E8, respectively (P<0.0001 by Student’s t test).


Figure 1
View larger version (29K):
[in this window]
[in a new window]

  		Figure 1. Analysis of mRNA expression in whole chicken retina at embryonic day 8 (RET E8) and 18 (Retina E18) and in primary cultures of chicken RGCs at E8 (RGC-E8). Chicken embryonic retinas were dissected out at E8 and E18, and RGCs were immunopurified and cultured at E8. A) Rhabdomeric specification markers: Pax-6, Brn3 and melanopsin (Opn4); developmental ciliary photoreceptor marker CRX; phototransduction cascade components: G proteins {alpha}-transducin ({alpha}-trans) (vertebrate cone and rod cascade) and Gq (invertebrate phototransduction cascade); Clock gene cryptochromes 1 (Cry1) and 2 (Cry2), and Clock-outputs: the melatonin-synthesizing enzymes, serotonin AA-NAT and HIOMT. mRNA expression was assessed by RT-PCR from RGC-E8 and retina E18 samples (positive control) and GADPH as a housekeeping gene. B) Expression of HIOMT, AA-NAT, and Opn4 mRNAs in RGC E8 cultures and in embryonic retina (RET E8). Expression levels were quantitated by real time PCR (QPCR). Results were normalized according to ß-actin levels, and expression of each gene in RGCs was compared to expression in the whole retina. Data are mean ± SD values (n=3–6) from 3 independent mRNA preparations. *P < 0.0001 by Student’s t test.

We previously showed that RGC cultures synchronized by medium culture exchange were capable of synthesizing a 3H-melatonin-like indole from 3H-tryptophan in a rhythmic manner (18) . Here, cell cultures were exposed to bright light of ~1500 lux (white cool fluorescence light) according to conditions used to depolarize intrinsically photoreceptive RGCs in mammals (38) and maintained at least for 4 d under a 12:12 h LD cycle, released to DD at day 5, and fed 3H-tryptophan for 8 h at different phases during 24 h. Results shown in Fig. 2 A demonstrate that in DD there was a daily variation in the synthesis of 3H-melatonin of RGC cultures (F=4.090, P<0.006 by ANOVA). Under this constant darkness condition, the higher levels of 3H-melatonin were observed at ZT8 and ZT10 during the subjective day while basal levels were found at ZT14–22 during the projected night. Posthoc comparisons revealed that levels of 3H-melatonin at ZT8 and ZT10 were significantly greater than those at other times examined.


Figure 2
View larger version (16K):
[in this window]
[in a new window]

  		Figure 2. Synthesis of 3H-melatonin in RGC cultures from E8 chicken embryos. A). Temporal regulation of 3H-melatonin synthesis in RGC cultures. Cultures were synchronized to a 12:12 h LD cycle for 4 d [L: cool white fluorescence light of 1500 lux turned on at time 0 (ZT0) and off at 12 h (ZT12)]. On day 5, cultures remained in DD. Cells were fed 3H-tryptophan (25 µCi/ml) for 8 h at different phases across 24 h. Data are mean ± SE (n=7–9/group) from 3 independent experiments and correspond to the total content of 3H-melatonin extracted from the cells and culture medium (F=4.09, P < 0.006 by one-way ANOVA with factor of time). See text for further detail. B) Light effect on 3H-melatonin synthesis in RGC cultures. RGCs were immunopurified and cultured in 10 ml of B27-DMEM containing vitamin A, and synchronized to a 12:12 h LD cycle for 4 d [L: cool white fluorescence light of 1500 lux turned on at time 0 (ZT0) and off 12 h later (ZT12)]. On day 5 at time 0, L was turned on and cells were fed 3H-tryptophan (25 µCi/ml) for 4 h at different phases during subjective day. Controls were exposed to light at time 0 and released to dark during the 4 h 3H-tryptophan labeling. Results are sum of 3H-melatonin content isolated from cells and culture medium. Data are mean ± SE (n=7–9/group) from 3 independent experiments. P < 0.02 by a 2-way ANOVA (factors of light condition and time). C) Effect of all-trans-retinal administration in RGC cultures. Cultures were handled as in B. At time 0, light was turned on and all-trans-retinal (0.1 µM) added 4 h later (ZT4) together with 3H-tryptophan. Controls that remained in dark were treated with 0.1 µM all-trans-retinal or vehicle only. Data are mean ± SEM (n=6–9/group) from 3 independent experiments. **P < 0.002, ***P < 0.0001 by pairwise comparison (marked values were compared to dark controls). See text for further details.

Strikingly, when RGC cultures previously synchronized to a LD cycle were exposed to bright light during the subjective day (ZT0–10) on day 5, diurnal levels of 3H-melatonin were significantly decreased as compared to controls maintained in the dark after 4 h of labeling with 3H-tryptophan (P<0.02 by ANOVA; Fig. 2B ). These findings clearly demonstrated that chicken RGCs are intrinsically photosensitive. Taking into consideration the light effect observed on the synthesis of radioactive melatonin, and considering that most opsin photopigments use a vitamin A-derived chromophore in both invertebrate and vertebrate photoreceptors (11 , 12 , 22 , 23 , 31) , we investigated whether light absorption can be enhanced by the addition of all-trans-retinal, a precursor for the chromophore 11-cis retinal to the culture medium. To test this, cultures were fed 0.1 µM all-trans-retinal in addition to the basal level of vitamin A supplemented in the culture medium by the manufacturer (Dulbecco’s modified Eagle’s medium-B27, GIBCO, Gaithersburg, MD). Results showed that the inhibitory effect of light on the 3H-melatonin synthesis (L control vs. D control: P<0.001) is further increased by the addition of the chromophore to the culture medium (L+all-trans-retinal vs. D: P<0.0001) (Fig. 2C ). No significant differences were observed between cultures maintained in the dark and treated with all-trans-retinal or the vehicle only. Strikingly, the observations indicate that light detection in cultured RGCs is mediated by a vitamin A-based chromophore since these cells are able to utilize vitamin A and all-trans-retinal, and further respond to the photic input in the presence of increasing amounts of retinal derivatives.

To investigate if the invertebrate phototransduction cascade is the pathway acting in photosensitive RGCs, we pharmacologically blocked the phosphoinositide breakdown with specific PLC antagonists such as 100 µM neomycin (Neo) or 5 µM U73122 {1-[6-(17–3-methoxyestra-1,3,5,10-trien-17-yl)amino[hexyl-1H-pyrrole-2,5-dione} in the RGC cultures. These compounds inhibit InsP3 production; concomitantly they inhibit the activation of InsP3 receptors and probably the TRP and TRPL channels involved in phototransduction as well (12 , 23 , 28) . We found that RGC cultures treated with neomycin (100 µM) for 4 h or with U73122 (5 µM) for 90 min, showed a significant effect on the labeling of 3H-melatonin that revert the suppressive effect of light as compared to light controls treated with the vehicle (Fig. 3 A, P<0.007). No significant differences were observed between the dark control and the pharmacologically treated cultures in light (Fig. 3A ) or among them and the effector-treated cultures in dark (data not shown). To further investigate the participation of TRP and TRPL channels in RGC cultures, we examined the effect of 1 mM lanthanum (La3+), a known TRP channel blocker (12) on the light inhibition of 3H-melatonin synthesis. TRP and TRPL channels were shown to be expressed in chicken RGCs (39) . We found that there is a significant increase in levels of labeled melatonin in cultures exposed to light and treated with La3+ with respect to vehicle-treated controls kept in light (Fig. 3B ; P<0.04). No significant effect of La3+ treatment was observed on melatonin labeling in cultures kept in the dark as compared with controls treated with the vehicle only (data not shown). Our observations demonstrated that blocking the activation of TRP channels by light could prevent the light suppression of melatonin synthesis in RGC cultures. In addition, we assessed the effect of decreasing levels of intracellular Ca2+ by the administration of the Ca2+ chelator BAPTA-AM (10 mM; ref 11 ). As shown in Fig. 3B , the treatment with BAPTA-AM significantly increased 3H-melatonin levels in light as compared to controls treated with the vehicle only (P<0.001). No significant differences were observed between the dark control and the pharmacologically treated cultures in light (Fig. 3B ) or among them and the effector-treated cultures in dark (data not shown). We also investigated the involvement of cGMP in the process triggered by light in chicken RGCs and the participation of the phosphodiesterase 6 (PDE6) shown to be present in the chicken pineal gland (31 32) . We used the specific activity inhibitor zaprinast (0.1 M) that avoids the light suppression of AA-NAT activity in the pineal gland (32) . Results shown in Fig. 3C revealed a significant effect of 0.1 M zaprinast on levels of 3H-melatonin of RGCs maintained in the dark, mimicking the inhibitory effect of light (P<0.02). By contrast, we examined the effect of stimulating the guanylate cyclase (GC) activity by NO donor SNP (1 mM) on the synthesis of 3H-melatonin in RGC cultures kept in the dark. Results summarized in Fig. 3C revealed that 1 mM SNP significantly decrease levels of 3H-melatonin synthesized in the RGCs in the dark with respect to dark controls treated with the vehicle (P<0.04). In addition, no further effect was observed on the inhibition of melatonin labeling by light after the administration of 1mM SNP (data not shown).


Figure 3
View larger version (14K):
[in this window]
[in a new window]

  		Figure 3. Effect of different pharmacological treatments on light suppression of 3H-melatonin synthesis in RGC cultures from E8 chicken embryos. Cultures were synchronized to a 12:12 h LD cycle for 4 d (L: cool white fluorescence light of 1500 lux turned on at ZT0 and off at ZT12). On day 5, L was turned on at time 0 and cells were fed 3H-tryptophan (25 µCi/ml) 4 h later together with different effectors. Controls that remained in the dark during the 4 h of 3H-tryptophan labeling received identical treatments. Data are mean ± SE (n=6–9/group) from 3 independent experiments. A) Effect of phosphoinositide PLC inhibitors neomycin (Neo, 100 µM) and U73122 (5 µM, 1.5 h treatment). **P < 0.007 as compared to the light control treated with the vehicle. B) Effect of the Ca2+ chelator BAPTA-AM (10 mM) and the TRP and TRPL-channel blocker lanthanum (Lan, 1 mM). *P < 0.04, **P < 0.001 as compared to the light control treated with the vehicle. C) Effect of cGMP modulators in controls maintained during the 4 h of labeling in dark: the NO donor sodium nitropuriside SNP (1 mM) and the phosphodiesterase 6 (PDE6) inhibitor zaprinast (ZAP, 0.1 M). *P < 0.04 for the SNP or *P < 0.02 for the Zaprinast treatments as compared to controls in dark (vehicle). See text for further details.

DISCUSSION

Our observations constitute the first demonstration that RGCs in culture are capable of sensing photic information from the environment. In this respect, cultures were first entrained to the environmental lighting conditions (LD cycles) to reset their endogenous oscillators to display the overt rhythms. Thus, RGCs that were previously synchronized to LD cycles exhibited a daily variation in the synthesis of melatonin under constant darkness with maximum levels during the subjective day and lower values at the subjective night. Strikingly, when light was turned on, cultured cells responded to the photic input by substantially suppressing levels of recently synthesized 3H-melatonin. The inhibitory effect of light was further enhanced by increasing amounts of all-trans-retinal, the ubiquitous chromophore utilized throughout the phylogenetic tree. These results indicate that RGCs in culture somehow detect light by using a vitamin A-based chromophore.

Remarkably, cultures of RGCs used to perform all experiments were obtained at a very early developmental stage, the embryonic day 8 (E8), on which only these cells are postmitotic and mostly mature in the retina (40) . When we characterized RGC cultures, we found that they expressed HIOMT, the last enzyme in the biosynthesis of melatonin in addition to AA-NAT previously described to be present in these embryonic cells (18) . RGCs also showed the expression of the specification/developmental factors Pax6 and Brn3, the photopigment Opn4, the clock genes Cry1 and Cry2 and the G-protein q (Gq) involved in the invertebrate photocascade. By contrast, these cells did not show detectable levels of transcripts of the vertebrate G protein, {alpha}-transducin, nor of the Crx developmental factor, markers for rod and cone photoreceptor cells. Pax6 is a master control gene of eye development (41) , which, apart from its earlier role in generating most retinal cell types, remains expressed in RGCs of the differentiating RPs of various species (15) . The POU family member Brn3 is specific for differentiating vertebrate RGCs, promotes their differentiation (42) and is required for axon outgrowth, from the retina to the brain (43 , 44) . The axonal projection to the brain constitutes a notable similarity between RGCs and RPs (15) . Opn4 is proposed to be the vertebrate ortholog of invertebrate rhabdomeric opsins (9 , 11) , which uses a vitamin A-based chromophore, and was shown to render mammalian cells photoresponsive (13 , 14) . Strikingly, Pax6, Brn3, Gq, and Opn4 are proposed to be RP markers (15) . These observations strongly support the idea that chicken RGCs may have evolved from an ancient RP precursor cell.

We recently demonstrated that chicken RGCs contain autonomous circadian oscillators that synthesize a melatonin-like indole in a rhythmic manner with levels peaking during the day (18) . This and other studies from our laboratory (16 , 17) , along with strong evidences in mammals (10 , 38) , identified specifically RGCs as novel components of the vertebrate circadian timing system. Thus, these cells contain clocks that autonomously measure time displaying self-sustained rhythms in lipid and methoxyindole synthesis, AA-NAT mRNA expression and activity, and cAMP levels (16 17 18) . Furthermore, these cells convey photic information to the brain required for the entrainment of the circadian system and regulation of NIF tasks. By measuring time, cells acquire the capability of predicting environmental changes in light conditions. According to our observations, we estimated that many RGCs may contain circadian clocks displaying daily rhythms in melatonin synthesis and other parameters studied. However, probably a few cells in the cultures are able to detect light, since no significant changes were seen in levels of cGMP, the most conspicuous second messenger involved in photoreception (23) , between light and dark after the photic input (1–5 to 90 min). Nevertheless, a tendency of higher cGMP levels was observed after the exposure to light pulses at short times (data not shown); this probably reflects the dilution of cGMP content from photoreceptive cells with the rest of cells of the RGC population.

Remarkably, under constant illumination conditions, the synthesis of 3H-melatonin was both driven by an endogenous circadian clock and considerably suppressed by light stimulation. The rhythmicity in melatonin production is thought to be regulated by intracellular levels of cAMP and controlled by the enzyme AA-NAT (45 , 46) , which is also thought to detoxify arylalkylamines through N-acetylation (47) . RGC cultures display the expression of AA-NAT mRNA in a rhythmic manner when cells are synchronized by different cues (medium exchange or 100 µM glutamate administration) (18) . In this respect, light could be rapidly decreasing AA-NAT mRNA expression and/or activity in the cultures; interestingly, the addition of forskolin (10 µM) to the RGC cultures that increases the activity of the adenylyl cyclase enzyme, significantly elevates levels of 3H-melatonin also (data not shown).

Our observations involving diverse pharmacological treatments support the idea that the cascade of phototransduction operating in the chicken embryonic RGCs involves 1) Gq, a distinct G-protein isoform expressed in these cells, which activates a PIP2-phospholipase C, since the blockade of PIP2 hydrolysis with specific PLC inhibitors causes the suppression of light effect; 2) the participation of Ca2+-permeable light-sensitive channels such as the TRP and the TRPL channels, and/or the release of Ca2+ from the InsP3-sensitive stores since the treatments with a Ca2+ chelator or a TRP channel blocker were able to revert the effect of light. These results are in agreement with previous evidences reported in cultured Xenopus dermal melanophores (11) or Xenopus oocytes (12) showing a phosphoinositide signaling pathway similar to that found in invertebrate phototransduction. Moreover, the signal triggered by light implies the increase in levels of cGMP and potentially the activity of a PDE-like enzyme that controlled levels of cGMP in these nonclassical photoreceptor cells.

Nonclassical photoreceptors such as RGCs, which have probably evolved from formerly RP precursor cells, respond to light by triggering neurochemical events similar to those of the invertebrate phototransduction cascade.

The results allow us to speculate that the presence of these photoreceptors may be linked to the requirement for light detection at early developmental stages, at which RGCs are mostly mature (40) . This early light sensitivity can be essential for the embryo to temporally regulate vital developmental programs and physiology in response to environmental illumination conditions (48) before any sign of formal vision may occur.

ACKNOWLEDGMENTS

We thank Dr. A. Alonso for helpful comments. This study was supported by Fundación Antorchas, Agencia Nacional de Promoción Científica y Técnica (FONCyT), CAEN-International Society for Neurochemistry, Consejo Nacional de Investigaciones Científicas y Técnicas de la República Argentina (CONICET), Secretaría de Ciencia y Técnica-Universidad Nacional de Córdoba (SeCyT-UNC), and Agencia Córdoba Ciencia.

Received for publication April 13, 2006. Accepted for publication August 21, 2006.

REFERENCES

  1. Dunlap, J. C., Loros, J. J., DeCoursey, P. J. (2004) Chronobiology: Biological Timekeeping Sinauer Suderland, MA.
  2. Foster, R. G., Hankins, M. W. (2002) Non-rod, non-cone photoreception in the vertebrates. Prog. Retin. Eye Res. 21,507-527[CrossRef][Medline]
  3. Cahill, G. M., Besharse, J. C. (1989) Retinal melatonin is metabolized within the eye of xenopus laevis. Proc. Natl. Acad. Sci. U. S. A. 86,1098-2102[Abstract/Free Full Text]
  4. Guido, M. E., Carpentieri, A. R., Garbarino-Pico, E. (2002) Circadian phototransduction and the regulation of biological rhythms. Neurochem. Res. 27,1473-1489[CrossRef][Medline]
  5. David-Gray, Z. K., Janssen, J. W., DeGrip, W. J., Nevo, E., Foster, R. G. (1998) Light detection in a "blind" mammal. Nat. Neurosci. 1,655-656[CrossRef][Medline]
  6. Freedman, M. S., Lucas, R. J., Soni, B., von Schantz, M., Munoz, M., David-Gray, Z., Foster, R. (1999) Regulation of mammalian circadian behavior by non-rod, non-cone, ocular photoreceptors. Science 284,502-504[Abstract/Free Full Text]
  7. Lucas, R. J., Freedman, M. S., Munoz, M., Garcia-Fernandez, J. M., Foster, R. G. (1999) Regulation of the mammalian pineal by non-rod, non-cone, ocular photoreceptors. Science 284,505-507[Abstract/Free Full Text]
  8. Selby, C. P., Thompson, C., Schmitz, T. M., Van Gelder, R. N., Sancar, A. (2000) Functional redundancy of cryptochromes and classical photoreceptors for nonvisual ocular photoreception in mice. Proc. Natl. Acad. Sci. U. S. A. 97,14697-14702[Abstract/Free Full Text]
  9. Provencio, I., Rodriguez, I. R., Jiang, G., Hayes, W. P., Moreira, E. F., Rollag, M. D. (2000) A novel human opsin in the inner retina. J. Neurosci. 20,600-605[Abstract/Free Full Text]
  10. Berson, D. M., Dunn, F. A., Takao, M. (2002) Phototransduction by retinal ganglion cells that set the circadian clock. Science 295,1070-1073[Abstract/Free Full Text]
  11. Isoldi, M. C., Rollag, M. D., Castrucci, A. M., Provencio, I. (2005) Rhabdomeric phototransduction initiated by the vertebrate photopigment melanopsin. Proc. Natl. Acad. Sci. U. S. A. 102,1217-2121[Abstract/Free Full Text]
  12. Panda, S., Nayak, S. K., Campo, B., Walker, J. R., Hogenesch, J. B., Jegla, T. (2005) Illumination of the melanopsin signaling pathway. Science 307,600-604[Abstract/Free Full Text]
  13. Qiu, X., Kumbalasiri, T., Carlson, S. M., Wong, K. Y., Krishna, V., Provencio, I., Berson, D. M. (2005) Induction of photosensitivity by heterologous expression of melanopsin. Nature 433,745-749[CrossRef][Medline]
  14. Melyan, Z., Tarttelin, E. E., Bellingham, J., Lucas, R. J., Hankins, M. W. (2005) Addition of human melanopsin renders mammalian cells photoresponsive. Nature 433,741-745[CrossRef][Medline]
  15. Arendt, D. (2003) Evolution of eyes and photoreceptor cell types. Int. J. Dev. Biol. 47,563-571[Medline]
  16. Guido, M. E., Pico, E. G., Caputto, B. L. (2001) Circadian regulation of phospholipid metabolism in retinal photoreceptors and ganglion cells. J. Neurochem. 76,835-845[CrossRef][Medline]
  17. Garbarino-Pico, E., Carpentieri, A. R., Castagnet, P. I., Pasquare, S. J., Giusto, N. M., Caputto, B. L., Guido, M. E. (2004) Synthesis of retinal ganglion cell phospholipids is under control of an endogenous circadian clock: daily variations in phospholipid-synthesizing enzyme activities. J. Neurosci. Res. 76,642-652[CrossRef][Medline]
  18. Garbarino-Pico, E., Carpentieri, A. R., Contin, M. A., Sarmiento, M. I., Brocco, M. A., Panzetta, P., Rosenstein, R. E., Caputto, B. L., Guido, M. E. (2004) Retinal ganglion cells are autonomous circadian oscillators synthesizing N-acetylserotonin during the day. J. Biol. Chem. 279,51172-51181[Abstract/Free Full Text]
  19. Bailey, M. J., Chong, N. W., Xiong, J., Cassone, V. M. (2002) Chickens’ Cry2: molecular analysis of an avian cryptochrome in retinal and pineal photoreceptors. FEBS Lett. 513,169-174[CrossRef][Medline]
  20. Bailey, M. J., Cassone, V. M. (2004) Opsin photoisomerases in the chick retina and pineal gland: characterization, localization, and circadian regulation. Invest. Ophthalmol. Vis. Sci. 45,769-775[Abstract/Free Full Text]
  21. Chaurasia, S. S., Rollag, M. D., Jiang, G., Hayes, W. P., Haque, R., Natesan, A., Zatz, M., Tosini, G., Liu, C., Korf, H. W., et al (2005) Molecular cloning, localization and circadian expression of chicken melanopsin (Opn4): differential regulation of expression in pineal and retinal cell types. J. Neurochem. 92,158-710[CrossRef][Medline]
  22. Tessier-Lavigne, M. (1991) Phototransduction and information processing in the retina. Kandel, E. Schwartz, J. Jessel, T. eds. Principles of Neural Science 3rd edition ,400-417 Apleton & Langen Norwalk, Connecticut. chap 28 pp
  23. Hardie, R. C., Raghu, P. (2001) Visual transduction in Drosophila. Nature 413,186-913[CrossRef][Medline]
  24. Ukhanov, K., Payne, R. (1995) Light activated calcium release in Limulus ventral photoreceptors as revealed by laser confocal microscopy. Cell Calcium 18,301-313[Medline]
  25. Brocco, M. A., Panzetta, P. (1999) Survival and process regrowth of purified chick retinal ganglion cells cultured in a growth factor lacking medium at low density. Modulation by extracellular matrix proteins. Brain Res. Dev. Brain Res. 118,23-32[CrossRef][Medline]
  26. Brewer, G. J., Espinosa, J., Struble, R. G. (2003) Effect of Neuregen nutrient medium on survival of cortical neurons after aspiration lesion in rats. J. Neurosurg. 98,1291-1298[Medline]
  27. Brewer, G. J., Espinosa, J., McIlhaney, M. P., Pencek, T. P., Kesslak, J. P., Cotman, C., Viel, J., McManus, D. C. (2001) Culture and regeneration of human neurons after brain surgery. J. Neurosci. Meth. 107,15-23[CrossRef][Medline]
  28. Faillace, M. P., Sarmiento, M. I., Siri, L. N., Rosenstein, R. E. (1994) Diurnal variations in cyclic AMP and melatonin content of golden hamster retina. J. Neurochem. 62,1995-2000[Medline]
  29. Klein, D. C., Ntides, A. (1969) Thin-layer chromatographic separation of pineal gland derivatives of serotonin-14C. Anal. Biochem. 31,480-483[CrossRef][Medline]
  30. Wang, Y., Deshpande, M., Payne, R. (2002) 2-Aminoethoxydiphenyl borate inhibits phototransduction and blocks voltage-gated potassium channels in Limulus ventral photoreceptors. Cell Calcium 32,209-216[CrossRef][Medline]
  31. Holthues, H., Vollrath, L. (2004) The phototransduction cascade in the isolated chick pineal gland revisited. Brain Res. 999,175-180[CrossRef][Medline]
  32. Morin, F., Lugnier, C., Kameni, J., Voisin, P. (2001) Expression and role of phosphodiesterase 6 in the chicken pineal gland. J. Neurochem. 78,88-99[CrossRef][Medline]
  33. Fu, Y., Zhong, H., Wang, M. H., Luo, D. G., Liao, H. W., Maeda, H., Hattar, S., Frishman, L. J., Yau, K. W. (2005) Intrinsically photosensitive retinal ganglion cells detect light with a vitamin A-based photopigment, melanopsin. Proc. Natl. Acad. Sci. U. S. A. 102,10339-10344[Abstract/Free Full Text]
  34. Chomczynski, P., Sacchi, N. (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162,156-159[Medline]
  35. Babity, J. M., Newton, R. A., Guido, M. E., Robertson, H. A. (1997) The application of differential display to the brain. Adaptations for the study of heterogeneous tissue. Methods Mol. Biol. 85,285-295[Medline]
  36. Brocco, M., Pollevick, G. D., Frasch, A. C. (2003) Differential regulation of polysialyltransferase expression during hippocampus development: Implications for neuronal survival. J. Neurosci. Res. 74,744-753[CrossRef][Medline]
  37. Bradford, R., Wang, C., Zack, D. J., Adler, R. (2005) Roles of cell-intrinsic and microenvironmental factors in photoreceptor cell differentiation. Dev. Biol. 286,31-45[CrossRef][Medline]
  38. Berson, D. M. (2003) Strange vision: ganglion cells as circadian photoreceptors. Trends Neurosci. 26,314-320[CrossRef][Medline]
  39. Crousillac, S., LeRouge, M., Rankin, M., Gleason, E. (2003) Immunolocalization of TRPC channel subunits 1 and 4 in the chicken retina. Vis. Neurosci. 20,453-463[CrossRef][Medline]
  40. Mey, J., Thanos, S. (2000) Development of the visual system of the chick. I. Cell differentiation and histogenesis. Brain Res. Brain Res. Rev. 32,343-379[CrossRef][Medline]
  41. Quiring, R., Walldorf, U., Kloter, U., Gehring, W. J. (1994) Homology of the eyeless gene of Drosophila to the Small eye gene in mice and Aniridia in humans. Science 265,785-789[Abstract/Free Full Text]
  42. Liu, W., Khare, S. L., Liang, X., Peters, M. A., Liu, X., Cepko, C. L., Xiang, M. (2000) All Brn3 genes can promote retinal ganglion cell differentiation in the chick. Development 127,3237-3247[Abstract]
  43. Erkman, L., Yates, P.A., McLaughlin, T., McEvilly, R. J., Whisenhunt, T., O’Connell, S. M., Krones, A. I., Kirby, M. A., Rapaport, D. H., Bermingham, J. R., et al (2000) A POU domain transcription factor-dependent program regulates axon pathfinding in the vertebrate visual system. Neuron 28,779-792[CrossRef][Medline]
  44. Wang, S. W., Gan, L., Martin, S. E., Klein, W. H. (2000) Abnormal polarization and axon outgrowth in retinal ganglion cells lacking the POU-domain transcription factor Brn-3b. Mol. Cell Neurosci. 16,141-156[CrossRef][Medline]
  45. Iuvone, P. M., Tosini, G., Pozdeyev, N., Haque, R., Klein, D. C., Chaurasia, S. S. (2005) Circadian clocks, clock networks, arylalkylamine N-acetyltransferase, and melatonin in the retina. Prog. Retin. Eye Res. 24,433-456[CrossRef][Medline]
  46. Zatz, M., Gastel, J. A., Heath, J. R., III, Klein, D. C. (2000) Chick pineal melatonin synthesis: light and cyclic AMP control abundance of serotonin N-acetyltransferase protein. J. Neurochem. 74,2315-2321[CrossRef][Medline]
  47. Klein, D. C. (2004) The 2004 Aschoff/Pittendrigh lecture: Theory of the origin of the pineal gland–a tale of conflict and resolution. J. Biol. Rhythms. 19,264-279[Abstract]
  48. Sernagor, E. (2005) Retinal development: second sight comes first. Curr. Biol. 15,R556-R559[CrossRef][Medline]



This article has been cited by other articles:


Home page
 J. Neurophysiol.Home page
D. M. Graham, K. Y. Wong, P. Shapiro, C. Frederick, K. Pattabiraman, and D. M. Berson
Melanopsin Ganglion Cells Use a Membrane-Associated Rhabdomeric Phototransduction Cascade
J Neurophysiol, May 1, 2008; 99(5): 2522 - 2532.
[Abstract] [Full Text] [PDF]

Home page
 J Biol RhythmsHome page
L. S. Mure, C. Rieux, S. Hattar, and H. M. Cooper
Melanopsin-Dependent Nonvisual Responses: Evidence for Photopigment Bistability In Vivo
J Biol Rhythms, October 1, 2007; 22(5): 411 - 424.
[Abstract] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF)
Right arrow Supplemental Data
Right arrow All Versions of this Article:
fj.06-6133fjev1
20/14/2648    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Contin, M. A.
Right arrow Articles by Guido, M. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Contin, M. A.
Right arrow Articles by Guido, M. E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS