FASEB J. Cell Migration Consortium
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published as doi: 10.1096/fj.06-6315fje.
This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-6315fjev1
20/14/2639    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, G.
Right arrow Articles by Greeley, G. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, G.
Right arrow Articles by Greeley, G. H., Jr.
(The FASEB Journal. 2006;20:2639-2641.)
© 2006 FASEB

Characterization of the 5'-regulatory regions of the rat and human apelin genes and regulation of breast apelin by USF

Guiyun Wang, Xiang Qi, Wei Wei, Ella W. Englander and George H. Greeley, Jr.1

Department of Surgery, University of Texas Medical Branch, Galveston, Texas, USA

1Correspondence: Department of Surgery, University of Texas Medical Branch, 301 University Blvd., Galveston, TX 77555, USA. E-mail: ggreeley{at}utmb.edu

ABSTRACT

Apelin, a peptide widely expressed in the body, is the endogenous ligand for the APJ receptor. To investigate how the apelin gene is regulated transcriptionally, we cloned and characterized ~3000 and ~4000 bp 5'-upstream fragments of the rat and human apelin genes. Putative CAAT-like box, but not TATA-box sites were identified. The rat (–207/–1 bp) and human (–100/+74 bp) core promoter sequences contain putative binding sites for upstream stimulatory factor (USF)-1/-2. Mutagenesis and overexpression assays showed that USF up-regulates basal and inducible apelin transcription. EMSA and supershift experiments indicated binding of USF-1/-2 to the rat (–114/–109 bp) and human (–84/–79 bp) apelin promoters. ChIP experiments show that USF is recruited to the putative USF binding site in the human apelin promoter in cultured breast cells. In concert with increased breast apelin expression during pregnancy and lactation in rats, EMSAs demonstrate an elevated binding of pregnant and lactating rat breast nuclear proteins to a consensus USF oligonucleotide. In vivo ChIP assays verified increased USF binding to the apelin promoter in breast of lactating rats. Together, our findings show that USF exerts a stimulatory role in regulation of breast apelin expression during pregnancy and lactation.—Wang, G., Qi, X., Wei, W., Englander, E. W., and Greeley, G. H., Jr. Characterization of the 5'-regulatory regions of the rat and human apelin genes and regulation of breast apelin by USF.


Key Words: hormone • transcription • ChIP assay • in vivo peptide

APELIN IS THE ENDOGENOUS LIGAND for the APJ receptor (1 2 3 4 5) . The APJ receptor is a member of the G-protein-coupled receptor (GPCR) family and is related structurally to the angiotensin (ANG) and CXC chemokine receptors (3 , 6 , 7) . ANG II, however, does not bind to the APJ receptor and the APJ receptor was considered an "orphan receptor" until the discovery of apelin.

Apelin exerts a broad range of physiological actions including effects on heart contractility, blood pressure, blood vessel growth, appetite and drinking behavior, the hypothalamic-pituitary-adrenal axis, gastric acid secretion, intestinal cholecystokinin (CCK), and pancreatic insulin secretion (8 9 10 11 12 13 14 15) . Apelin shows a widespread distribution; in the body, apelin is expressed in the brain, kidney, adipose tissue, heart, lung, mammary gland, and gastrointestinal tract (1 , 13 , 16 17 18 19 20 21) .

Upstream stimulatory factors (USF-1, USF-2) are ubiquitous transcription factors (43 and 44 kDa, respectively), characterized by the evolutionary conserved carboxy-terminal basic helix-loop-helix and leucine zipper domains that are involved in dimerization and DNA binding activities (22 23 24) . The E-box is the binding site for USF and controls transcription of several metabolic genes, including those involved in glucose (Glc) and lipid metabolism, hypoxia, cell proliferation, and xenobiotic metabolism (22 , 25 26 27 28 29 30) .

Transcriptional regulation of apelin is unknown, in part, because of the lack of information on the apelin gene promoter. To better understand regulation of apelin expression, the 5'-upstream regions of the rat and human apelin genes were cloned into a promoterless luciferase expression vector. 5'-upstream sequences necessary for transcriptional activity were identified by scanning deletional analyses. Core promoter regions were identified by ability to activate luciferase transcription in cells derived from tissues that produce apelin. In rats, breast apelin expression increases dramatically during pregnancy and lactation. Sequence analyses of apelin core promoters iden-tified USF as a potential regulator of apelin expression.

The stimulatory role of USF over apelin gene transcription was confirmed in transient expression, EMSA and chromatin immunoprecipitation (ChIP) assays showing that overexpression of USF increases apelin expression in cultured breast cells and that endogenous USF directly binds to and regulates the apelin promoter. Furthermore, ChIP analysis revealed that breast USF proteins of lactating rats are recruited to the putative USF motif in the apelin core promoter in vivo but not in cyclic rats. These results indicate that USF is a positive regulator of apelin gene expression in lactating rats.

MATERIALS AND METHODS

Animals
All animal experiments were done in accordance with mandated standards of humane care and were approved by the Institutional Animal Care and Use Committee. Adult female Sprague-Dawley rats were maintained in a temperature (23±2°C) and light-regulated (12L:12D lights on) room and allowed free access to standard rat pellet food and tap water. Breast tissues were harvested from virgin cyclic (control), timed-pregnant and lactating rats for preparation of total cellular RNA (13 , 31) , nuclear protein extracts (32) and ChIP assays. Estrous cycles and the onset of pregnancy were monitored by microscopic examination of daily vaginal smears. The presence of sperm in vaginal washings was evidence of pregnancy.

Chemicals and reagents
Buffers, chemicals and chemicals and oligonucleotides were from Sigma (St. Louis, MO, USA) and Invitrogen (Carlsbad, CA, USA). Cell culture media were purchased from Mediatech, Inc. (Herndon, VA, USA) and Life Technologies, Inc. (Carlsbad, CA, USA). Site-directed mutagenesis kits were purchased from Stratagene (La Jolla, CA, USA), and the nuclear protein extraction kits were from Active Motif (Carlsbad, CA, USA). An Ambion RNAqueousTM RNA kit (Austin, TX, USA) was used to prepare total cellular RNA from cells. Reverse transcriptase-polymerase chain reaction (RT-PCR) kits were purchased from BD Biosciences-Clontech (Palo Alto, CA, USA). Antibodies for USF-1/-2 and histone H3 were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA) and Cell Signaling Technology, Inc. (Beverly, MA, USA).

Measurement of apelin expression
For measurement of apelin expression in cell lines, total cellular RNA was extracted and purified by means of the RNAqueousTM kit (Ambion). RNA was quantified by spectrophotometry. Before real-time PCR analyses, total RNA was used as a template to synthesize first-strand cDNA by the random priming method using the AdvantageTM RT-for-PCR kit (BD Biosciences-Clontech). Briefly, 1 µg of total RNA was incubated with 1 µl random primer at 70°C for 2 min, chilled on ice, and mixed with a solution containing 4 µl reaction buffer (5x), 1 µl deoxynucleotide (dNTP) (10 mM), 0.5 µl recombinant RNase inhibitor (40 U/µl), and 1.0 µl of MMLV reverse transcriptase (200 U/µl). The mixture (20 µl) was incubated for 1 h at 42°C, and the reverse transcriptases were denaturated at 94°C for 5 min. Apelin mRNA levels were then measured by real-time RT-PCR assays as described previously (13) . Assays were done using an Applied Biosystems (Foster City, CA, USA) 7000 sequence detection system. Applied Biosystems Assays-By-Design containing a 20x assay mix of primers and TaqMan MGB probes (6-FAM dye-labeled probe) were used for the target genes: rat apelin (accession no. AF179679); human apelin (accession no. NM 017413); mouse apelin (accession no. NM 013912); and a predeveloped rat 18S rRNA (VIC dye-labeled probe). TaqMan assay reagent (P/N 4319413E) was used for the internal control. Primers were designed to span exon-exon junctions. Probe sequences were searched against the Celera database.

For measurement of breast apelin expression in rats total cellular RNA was extracted and purified from breast tissue, and Northern blotting analysis was done using previously published procedures (13 , 31) .

Cell culture, transient transfection, and luciferase assays
All cells were maintained in a humidified incubator at 37°C in an atmosphere of 5% CO2-95% air. Human stomach adenocarcinoma cells (AGS) (33 , 34) were grown in Ham’s F10 media containing 10% FBS. Human colon cells (Caco-2) (35) were grown in Minimum essential medium (Eagle’s) with 1.0 mM sodium pyruvate, 0.1 mM nonessential amino acids, and 20% FBS. Mouse hypothalamic (GT1–7) (36) , and rat heart (H9C2) cells (37) were grown in Dulbecco’s modified Eagle medium (DMEM) containing 10% FBS. Human placenta (BeWo) cells were grown in Ham’s F12K medium with 10% FBS (38) . Rat lung (RFL-6) cells were grown in Ham’s F12K medium with 20% FBS (39) . Human liver (HepG2) cells were grown in minimum essential medium (Eagle’s) with 0.1 mM nonessential amino acids, and 1.0 mM sodium pyruvate, 10% FBS (40) . Human breast (Hs578T) cells were grown in DMEM containing 10% FBS and 0.1 U/ml bovine insulin (41) . All media were supplemented with 100 U/ml of penicillin and 100 µg/ml of streptomycin.

For transient transfection studies, cells were plated onto 6-well tissue culture plates at optimal densities. Approximately 24 h after plating, cells were cotransfected with apelin 5'-upstream fragment-luciferase reporter gene constructs (2 µg) and an internal control vector pRL-null (100 ng) per well using Lipofectamine reagent (Invitrogen) following the manufacturer’s instructions. For the upstream stimulatory factor (USF) experiments Hs578T cells were cotransfected with either USF-1 or -2 expression plasmids [pN3, pN4, kindly provided by M. Sawadogo (42) ] and apelin core promoter constructs. An empty vector (pSG424) was used in control overexpression experiments, and pRL-SV40 (20 ng) was used as an internal control vector. Plasmids were diluted with Opti-MEM (Life Technologies, Inc.), mixed, and then transfected in triplicate. Five hours later, media were changed to media containing serum. Cells were harvested 40 h later. All cells were rinsed with PBS and lysed in 200 µl of Passive Lysis Buffer (Promega, Madison, WI, USA). Cell lysates were analyzed for firefly and renilla luciferase activities using the Dual-Luciferase Reporter Assay System (Promega) in a luminometer (Monolight 2010, Analytical Luminescence Laboratory, San Diego, CA, USA) as recommended by the manufacturer. Chemiluminescence measurements were made at 10-s intervals. pRL-null or pRL-SV40 activities were measured according to the manufacturer’s protocol (Promega). All plasmids-constructs were purified with the Qiagen plasmid purification kit (Valencia, CA, USA).

Cloning of the rat and human apelin 5'upstream sequences and construction of luciferase expression vectors containing rat and human apelin 5'-upstream sequences
The rat and human apelin 5'-upstream regulatory sequences were obtained by PCR amplification of rat and human genomic DNA (BD Biosciences). The –3926/+74 bps fragment of the 5'-upstream regulatory region of the human apelin gene and –3000/–1 bps fragment of the 5'-upstream regulatory region of the rat apelin gene were cloned into KpnI and XhoI sites of the promoterless luciferase expression vector pGL3-Basic (Promega). For the human, the forward primer was 5'-CGACGCGTTCACCACAATGTAGAATCA-3'; and the reverse primer: 5'-CCCTCGAGTCCGGGAGCGGCAGCGGCGAGCTCTTTCTTA-3'. For rat, the forward primer was: 5'-CTAGGAGCTCCCAGGATCTCCTGCACG-3'; and the reverse primer: 5'-CTAGCTCGAGCCGCGACTCCCAACTACCC-3'. Scanning deletion constructs of the 5'-upstream region were generated by PCR using the cloned rat and human promoters. 5'-upstream fragments were then subcloned into the KpnI and XhoI sites of the pGL3-Basic vector (Promega). Primers were designed to include restriction sites for KpnI and XhoI. For both species, sequences of the 5'-upstream fragments were verified by sequencing.

Site-directed mutagenesis of USF binding sites in the rat and human apelin 5'-upstream sequences
Putative USF binding sites of the –207/–1 bp rat apelin promoter construct and the —100/+74 bp human apelin promoter construct (the transcription start site was designated as +1) were mutated by PCR using Quick Change Site-Directed Mutagenesis Kits (Stratagene). After 18 cycles of PCR using pfu Turbo DNA polymerase at 95°C for 30 s, 55°C for 1 min, and 68°C for 10 min, the parental, double-stranded DNA was digested with DpnI. Mutant sequences were confirmed by DNA sequencing.

Preparation of nuclear protein extracts and electrophoretic mobility shift assays (EMSAs)
For cultured cells, nuclear protein extracts were prepared using the nuclear protein extraction kit (Active Motif Inc.) as described (43) . Protein concentrations were assayed by the Bradford assay (Bio-Rad Laboratories, Inc., Richmond, CA, USA). For rat breast tissue, nuclear protein extracts were prepared according to a previously published protocol (32) .

Rat and human apelin promoter fragments or a USF consensus oligonucleotide were end-labeled with [{gamma}-32P]-ATP (3000 Ci/mmol) using T4 polynucleotide kinase. Approximately, 50,000 cpm of 32P-labeled DNA were added to the nuclear extract, and preparations were incubated with 50 ng/µl of Poly (dI-dC)· Poly (dI-dC) and 5 ng/µl of poly L-lysine in binding buffer [20 mM HEPES (pH 7.6), 1 mM DTT, 30 mM KCI, 10 mM (NH4)2SO4, 0.2% Tween 20, 1 mM EDTA] at room temperature for 20 min. DNA-protein complexes were resolved on a 4% polyacrylamide gel in 0.5x TBE buffer. Gels were dried and autoradiographed with intensifying screens at –70°C. For competition experiments, nuclear extracts were incubated with a 100-fold molar excess of double-stranded, nonradiolabeled oligonucleotides at room temperature for 10 min before adding radiolabeled oligonucleotides. In supershift experiments, either an USF-1 or -2 antibody (Ab) was added to the reaction prior to addition of radiolabeled probe and incubated at room temperature for 30 min. For the control experiment, a nonspecific goat anti-rabbit IgG Ab was added.

Western blot analysis
Nuclear protein extracts of breast tissue obtained from control cyclic, pregnant, and lactating rats were boiled for 5 min in the presence of sample buffer (NuPAGE LDS sample buffer) (Invitrogen) before separation on a 4–12% sodium dodecyl sulfate-polyacrylamide gel. After gel separation, proteins were transferred onto nitrocellulose membranes and blocked with 10% nonfat milk in TBST for 2 h at room temperature. Membranes were incubated with a histone H3 Ab in washing buffer (1% milk in TBST with 0.1% Tween 20) overnight at 4°C. After three washes, membranes were incubated for 45 min at room temperature with a conjugated anti-rabbit IgG-horseradish peroxidase Ab in washing buffer. Membranes were rinsed three times, and detection was performed using the enhanced chemiluminescence (ECL) (NEN Life Science Products, Boston, MA, USA) according to the manufacturer’s instructions. Membranes were exposed to X-ray film.

Chromatin immunoprecipitation (ChIP) assays
ChIP assays using human breast Hs578T cells were done according to the protocol supplied by Upstate Biotechnology (Lake Placid, NY, USA). Either a nonspecific goat anti-rabbit IgG, USF-1 or -2 (2.5 µl) Ab was used in ChIP reactions. For an input control, 2% of the DNA amount used for immunoprecipitation was used for PCR. Precipitated DNA was subjected to PCR amplification using the Advantage HF-2 PCR kit (Clontech). PCR was done using primers-5' GCTGCAGAGTGCGTGCCTGGAG3' and 5' GAGCGGCAGCGGCGAGCTCTTTCTTAG3' that were designed to amplify a region containing the putative USF binding site in the human apelin promoter (–171/+69 bp). PCR conditions included one cycle (1 min at 94°C) and 35 cycles (30 s at 94°C and 50 s at 68°C) with a final extension step (7 min at 68°C).

Rat breast tissue for ChIP assays was harvested from control cyclic and 3-d lactating rats, diced on ice, and suspended in PBS containing 1% (v/v) formaldehyde at 37°C for 10 min. Reactions were stopped by the addition of glycine (0.125 M, 5 min, ambient temperature) and then rinsed with ice-cold PBS. Breast tissues were then crushed, filtered with a cell strainer (70 µm), and pelleted by centrifugation at 800 g for 3 min at 4°C. Pellets were suspended in cell lysis buffer (50 mM Tris, pH 8.0; 2 mMEDTA, pH 8.0; 0.1% IGEPAL; 10% glycerol; 1 mM DTT) including PMSF (1 mM) and a protease inhibitor cocktail from Roche (Indianapolis, IN, USA), incubated on ice for 15 min, and pelleted by centrifugation at 800 g for 3 min. Pellets were washed once with cell lysis buffer and resuspended in nuclei lysis buffer (1% SDS, 10 mM EDTA, and 50 mM Tris, pH 8.0, including protease inhibitors) and incubated on ice for 10 min. Chromatin was sonicated and then treated as described for breast Hs578T cell ChIP assays. PCR was done using primers-5' GATAGGGCTGCAGCATGCTTCCCGGG3' and 5'GCTTCCCTGCTCACTTCGGGGTCTGC3' that were designed to amplify a region containing the putative USF binding site of the rat apelin promoter (–215/–45 bp).

Statistical analyses
Results are expressed as the mean ± SEM. Data were analyzed by t test or one-way ANOVA and subsequently with Newman-Keuls test when appropriate. P < 0.05 was considered significant. P < 0.01 was considered significant.

RESULTS

Cloning of the 5'-flanking regions of the rat and human apelin genes
Sequences of the 5'-upstream regulatory regions for the rat and human apelin genes were obtained from the rat and human genome databases on a NCBI web site. The rat apelin gene is mapped to Xq35, and the human apelin gene is mapped to Xq25–26.3. By means of PCR, ~3000 and ~4000 bp 5'-upstream fragments of the rat and human apelin genes were obtained and sequences were verified. The GenBank accession numbers for the rat and human apelin 5'-upstream sequences are DQ385613 and DQ385612. The rat and human core promoters were identified as –207/–1 bp and –100/+74 bp, respectively, by scanning deletion analyses (Figs. 1 and 3 ). Sequence analyses identified putative binding sites for the transcription factors AP1, AP2, STAT, SP-1, USF, and GKLF in the core promoter region of the rat, and AP1, USF, NF1, and AP4 in the core promoter region of the human apelin gene (Fig. 1A ). Alignment of nucleotide sequences of the proximal promoter regions indicates a high sequence homology (~82%). A CAAT-like, but not TATA motifs, was identified in the rat and human apelin 5'-upstream regulatory regions (Fig. 1) .


Figure 1
View larger version (36K):
[in this window]
[in a new window]

  		Figure 1. A) Schematic representation of the core promoter sequences for the rat and human apelin genes. Core promoters were identified by scanning deletion analyses (see Fig. 3 ), nucleotide position + 1 corresponds to the transcription start site. Putative transcription factor binding sites are underlined and identified. B) Alignment of the nucleotide sequences of the core promoter regions of the rat and human apelin genes. Homologous nucleotides are identified by the tick marks.


Figure 2
View larger version (9K):
[in this window]
[in a new window]

  		Figure 2. Apelin gene expression in cell lines. Apelin expression was measured by real-time RT-PCR of RNA purified from cultured cell lines derived from various tissues that express apelin in the body. Apelin expression levels are normalized to 18S rRNA expression levels. The highest apelin mRNA levels were found in human stomach (KATOIII), human breast (Hs578T), and mouse hypothalamic (GT1–7) cells. Data are presented as mean of duplicate measurements of same sample ± SEM


Figure 3
View larger version (43K):
[in this window]
[in a new window]

  		Figure 3. Scanning deletion analyses of the rat (A) and human (B) apelin promoters in different cell types. Deletion constructs were generated as described in Materials and Methods. Breast Hs578T, liver HepG2, colon Caco-2, heart H9C2, lung RFL-6, placenta BeWo, stomach KATOIII, and hypothalamic GT1–7 cells were transiently transfected with constructs of either the rat or human apelin promoter fragments fused to a luciferase reporter gene (pGL3-basic). pRL-null plasmid was used as an internal control. Luciferase activities were measured 48 h after transfection. Data are presented as mean ± SEM for triplicate analyses. Activities are normalized to pGL-3 Basic.

Expression of the apelin gene in cell lines
Expression levels of the apelin gene were determined by real-time RT-PCR analyses of RNA from cultured cell lines derived from tissues that express apelin in the body. For the cell lines examined, the highest apelin mRNA levels were found in human stomach (KATO III), human breast (Hs578T), and mouse hypothalamic (GT1–7) cells (Fig. 2 ). Moderate apelin mRNA levels were measured in human colon (Caco-2) and in rat heart (H9C2) and lung (RFL6) cells. Low-apelin mRNA levels were measured in human placenta (BeWo) and liver (HepG2) cells. Apelin expression levels in stomach, breast, and hypothalamic cells were 6- to 8-fold higher than those levels measured in colon, heart, and lung cells, ~20-fold higher than those levels in placental cells, and ~70-fold higher than apelin expression levels in liver cells.

5'-Deletion scanning analyses of apelin promoter activity in different cell types
5'-Deletion scanning was used to characterize regions essential for basal transcriptional activity. Because apelin shows a wide expression pattern, transcriptional activity of deletion constructs was examined in cell lines originating from diverse tissues in the body. 5'-Upstream fragments were fused to a luciferase reporter gene (pGL-3 Basic). The identified rat core promoter is –207/–1 bp. 5'-Upstream rat sequences showed the highest activity in breast, liver, and colon cells (Fig. 3) . Activity of the rat 5'-upstream fragments in breast cells was 180-fold higher when compared to the activity of the promoterless vector. In breast and liver cells, deletion of the 5'-upstream region from –1500 to –1001 resulted in a significant increase (~1-fold) in transcriptional activity compared to the –1000/–1 bp fragment, suggesting the presence of a transcriptional inhibitor in the –1500 to –1001 bp region. In breast cells, activity of fragments further upstream of the –1500/–1 bp fragment were higher when compared with the –1500/–1 bp fragment, suggesting presence of a transcriptional stimulator in breast cells. In liver cells, activity of the larger constructs (–3000/–1, –2500/–1, –2000/–1, –1500/–1 bp) was 1-fold lower when compared with the activities of the shorter, more proximal constructs, which suggests the presence of a transcriptional inhibitor in the –3000 to –1001 bp region. In contrast, in colon cells, the larger constructs (–3000/–1, –2500/–1, –2000/–1 bp) showed higher transcriptional activities when compared with the more proximal constructs. In heart, lung, placental, and stomach cells, activities of rat apelin promoter constructs were lower by ~50% when compared to the activities measured in breast, liver, and colon cells. Rat apelin promoter activity was marginal in mouse hypothalamic cells.

Like the rat, human 5'-upstream sequences showed the highest transcriptional activity in breast and liver cells. Basal promoter activity was conferred by the –100/+74 bp fragment in all cell types tested. Activity of the human 5'-upstream fragments in breast cells was 120-fold higher when compared with the activity of the promoterless vector. In liver cells, activities of the longer constructs (–3926/+74, –2981/+74, –023/+74, –1541/+74, –1061/+74 bp) were lower when compared with the shorter, more proximal constructs and with the transcriptional activities of these constructs in breast cells. Activities of the human 5'-upstream fragments in colon, lung, heart, and stomach cells were ~50% of transcriptional activities measured in breast and liver cells. Activities of the human apelin promoter constructs in placenta and hypothalamic cells were marginal.

USF-1/-2 binding in the apelin core promoter region
Sequence analyses identified putative USF binding sites in the core promoter regions of the rat and human apelin genes (Fig. 1) . For the rat, a USF binding site is located at –114/–109 bp and for the human, a USF site is located at –84/–79 bp. The sequence for these USF binding sites is CACATG for both species (consensus, CACGTG). The extent to which USF-1 and -2 bind to these putative USF binding sites was examined by EMSAs using a nuclear protein extract from breast Hs578T cells. In the rat and human, a single DNA-protein complex was detected (Fig. 4 A, B, lane 1). For the rat and human, DNA-protein complexes were competed by a nonradioactive apelin 5'-upstream oligo fragment (rat: –126/–94 bp; human: –98/–64 bp) containing the putative USF site and by a nonradioactive consensus USF oligonucleotide fragment (Fig. 4A, B , lanes 2, 3). Incubation with a mutated, consensus USF oligonucleotide (nonradioactive) did not displace the radioactive apelin 5'-upstream fragment containing the putative USF site (lane 4). Incubation of a mutated, radioactive apelin 5'-upstream fragment containing the putative USF site with nuclear extract resulted in a single DNA-protein complex (lane 5); however, migration of the single band was slower when compared to the wild-type (WT) DNA-protein complex (lane 1). Incubation with either an Ab against USF-1 or USF-2 resulted in a supershift of the DNA-protein complexes (lanes 7, 8), whereas incubation with a nonspecific Ab did not shift the DNA-protein complexes (lane 6).


Figure 4
View larger version (35K):
[in this window]
[in a new window]

  		Figure 4. EMSAs using 5'-upstream WT or mutated (Mut) fragments of the rat (A) and human (B) apelin genes that contain putative USF binding sites. EMSAs were done using 32P-labeled wild-type or Mut fragments as probes and either nonradioactive WT, consensus USF-1, or mutated consensus USF oligonucleotides (MUSF) as competitors. Nuclear extract (15 µg) prepared from Hs578T cells were used. Double-stranded competitor DNA fragments were added in 100-fold molar excess. Specific DNA-nuclear protein complexes are identified by arrows. DNA-protein complexes supershifted by either an USF-1 or USF-2 Ab are identified by asterisks. Free = free probe.

Overexpression of USF-1/-2 increases apelin promoter activity
The influence of USF-1 and -2 overexpression on rat and human apelin core promoter transcriptional activities was examined in transient transfection experiments. Overexpression of USF-1 increased rat and human apelin core promoter activities approximately 10- and 20-fold, and overexpression of USF-2 increased the rat and human apelin core promoters activities approximately 8- and 15-fold (Fig. 5 ).


Figure 5
View larger version (14K):
[in this window]
[in a new window]

  		Figure 5. Transient transfection experiments show that overexpression of either USF-1 or -2 increases rat and human apelin promoter activity. Breast Hs578T cells were cotransfected with either a rat or human apelin core promoter- reporter construct (1 µg) plus USF-1 or -2 expression vectors (1 µg). Control cells were transfected with an empty vector (pSG424). Luciferase activities were normalized to empty vector readings. pRL-SV40 (0.02 µg) served as an internal transfection control.

Core promoter activities are reduced by site-directed mutagenesis of putative USF binding sites
The extent to which putative USF sites influence apelin core promoter activity was assessed by site-directed mutagenesis. Transient transfection experiments were done using WT constructs (rat, –207/–1 bp; human, –100/+74 bp) or constructs with mutations of putative USF sites. Mutation of putative USF sites decreased rat and human core promoter activity by 87% and 63%, respectively (Fig. 6 ).


Figure 6
View larger version (26K):
[in this window]
[in a new window]

  		Figure 6. Apelin transcriptional activity is reduced by mutation of putative USF binding sites in apelin core promoter regions. At the top, putative USF binding sites are identified in the WT sequences and mutated nucleotides of the putative USF binding sites are indicated in bold in the mutated (Mut) sequences. Only partial sequences of WT and Mut core promoters are shown. Putative USF binding sites were mutated as described in Methods and Materials. At the bottom, luciferase activities are shown for breast Hs578T cells transfected with either rat (–207/–1 bp) or human (–100/+74 bp) WT and Mut apelin core promoters. Data are given as the mean ± SEM of triplicates. *P < 0.05 vs. WT.

Evidence that endogenous USF interacts with the putative USF site in the apelin promoter in breast cells
To investigate the extent to which endogenous USF binds to the putative USF binding site within the promoter of the human apelin gene, we performed ChIP assays using chromatin isolated from breast Hs578T cells. Chromatin was cross-linked, sheared, and immunoprecipitated by either USF-1 or -2 antibodies. Control immunoprecipitations were done with a nonspecific IgG. The apelin 5'-upstream region containing the putative USF binding site was amplified by PCR of DNA precipitated by either USF-1 or -2 antibodies (Fig. 7 ). As a positive input control, cross-linked and sheared genomic DNA from Hs578T cells served as a template (Fig. 7 , lane 4). These results indicate that both USF-1 and -2 are recruited to the human apelin promoter.


Figure 7
View larger version (17K):
[in this window]
[in a new window]

  		Figure 7. ChIP assays indicate that USF is recruited to the putative USF site in the human apelin promoter in breast cells. A) Schematic of the proximal promoter region depicting location of a putative USF binding site and start sites of distal and proximal primers (arrows) used in PCR amplification. –171 and + 69 bp = start sites. B) Chromatin was immunoprecipitated with either USF-1 (lane 2) or -2 (lane 3) antibodies. A control immunoprecipitation was done with a nonspecific IgG Ab (lane 1). Immunoprecipitations were followed by PCR amplification of the promoter region (–171/+69 bp) containing the putative USF binding site. Positive input DNA (lane 4) used for PCR was 2% of the amount used for immunoprecipitation. DNA size markers are shown.

Evidence that USF up-regulates breast apelin expression in the rat
Northern blot analysis showed that rat breast apelin expression increases significantly during pregnancy and lactation (Fig. 8 A). Breast apelin expression was low in control cyclic rats (Fig. 8A ). When compared with apelin expression in control cyclic rats, breast apelin expression increased 3.3- and 2.4-fold during early and late pregnancy and 6.3- and 3.1-fold during early and late lactation (Fig. 8B ). EMSAs using nuclear protein extracts harvested from either control cyclic, timed-pregnant, or lactating rats showed that USF binding activity to a consensus USF oligonucleotide was highest during early and late pregnancy and early lactation (Fig. 8C ). USF binding activity then decreased at late lactation, in concert with the decrease in breast apelin expression. Western blotting analysis (Fig. 8C , lower part) confirmed consistent histone H3 levels in nuclear protein extracts used in EMSAs, indicating that changes in USF binding are not due to differences in extraction.


Figure 8
View larger version (18K):
[in this window]
[in a new window]

  		Figure 8. Evidence that USF up-regulates breast apelin expression during pregnancy and lactation in the rat. A) Northern blotting analysis shows that breast apelin expression increases during pregnancy and lactation when compared with control cyclic rats. Northern blot analysis of three rats per group is shown. B) Mean ± SEM of densitometric readings of apelin expression levels in control cyclic, 6 d pregnant (6 d preg), 21 d preg, 3 d lactating (3 d lac), and 16 d lact; n = 5. Apelin expression levels are normalized to 18S rRNA expression levels. C) EMSAs show that binding of a consensus USF oligonucleotide to breast nuclear extract is greatest during early pregnancy and early lactation in the rat. EMSAs were done using a 32P-labeled consensus USF oligonucleotide and breast nuclear extracts (10 µg) harvested from control cyclic, 6 d preg, 21 d preg, 3 d lac, and 16 d lac female rats. Two DNA-protein complexes were formed (arrows). Western blotting analysis of protein extracts used in EMSAs indicates consistent histone H3 levels in all nuclear protein extracts. *P < 0.01 vs. control cyclic; {dagger}P < 0.05 vs. 3 d lac; {Delta}P < 0.05 vs. 6 d preg, 3 d lac and 16 d lac.

Evidence that USF regulates breast apelin expression in vivo
ChIP assays showed that breast DNA of 3-d lactating rats was amplified using primers specific for the putative USF binding site within the rat apelin proximal promoter (Fig. 9 B), whereas breast DNA of control cyclic rats was not amplified (Fig. 9B ). This finding agrees with and extends the EMSA findings (Fig. 8) and indicates that USF is involved in the up-regulation of breast apelin transcription. Control immunoprecipitations were done with a nonspecific IgG (Fig. 9D ). For a positive input control, cross-linked and sheared genomic DNA from rat breast tissue served as a template (Fig. 9C ).


Figure 9
View larger version (50K):
[in this window]
[in a new window]

  		Figure 9. ChIP assay indicates that USF binding to the breast apelin promoter in vivo is increased during lactation when compared with control cyclic rats. Breast tissue harvested from five control cyclic and six 3-day lactating rats was processed as described in Methods and Materials. A) Schematic of proximal promoter region of rat apelin gene depicting location of a putative USF binding site and start sites of distal and proximal primers (arrows) used in PCR amplification. –215 and –45 bp = start sites. B) Chromatin of control cyclic (n=5) and 3-d lactating (n=6) rats was immunoprecipitated with USF-1 antibodies and followed by PCR amplification of promoter region (–215/–45 bp) containing the putative USF binding site. C) Positive input DNA used for PCR was 2% of the amount used for immunoprecipitation. D) Control immunoprecipitation was done with a nonspecific IgG Ab. DNA size markers are shown.

DISCUSSION

Apelin and its receptor, the APJ receptor, are expressed widely in the body (1 , 13 , 16 17 18 19 20) . Molecular regulation of apelin expression appears complex since stomach apelin expression is activated before birth and declines dramatically after weaning, whereas lung apelin expression is marginal at birth and increases during the developmental period in rats (13) . The present study demonstrates breast apelin expression is low in the cyclic rat but increases dramatically during pregnancy and lactation. Rat breast milk contains large amounts of apelin peptide [~300–600 ng/ml (13) ].

To understand molecular mechanisms underlying regulation of apelin gene expression, we have cloned the 5'-upstream regions of the rat and human apelin genes. Regulation of the apelin gene occurs partly at the transcriptional level since, for both species, transcriptional activities of 5'-upstream fragments were highest in stomach, breast, heart, and lung cells—a finding that correlates well with either apelin mRNA levels in the tested cell lines, in the respective tissues in vivo or both. Deletion analyses identified the core promoters as –207/+1 and –100/+74 bp for the rat and human apelin genes, respectively. In contrast to other gastrointestinal peptides [gastrin, ghrelin, CCK, glucagon, peptide YY, neurotensin (43 44 45 46 47 48 49 50) ], a TATA-box was not identified in the apelin promoters; however, putative CAAT-like boxes were identified. The rat and human apelin core promoter regions are GC rich (>60%), and previous reports indicate that many GC-rich promoters lack a typical TATA box (51) . In some TATA-less promoters, GC-rich promoter regions will contain SP1 binding sites that activate transcription (52 , 53) . Putative SP1 binding sites were identified in the apelin core promoter regions. We also identified putative E-box DNA-binding sites in the core promoters of the apelin genes. USF-1 and -2 are ubiquitous transcription factors that bind to E-box sites (54) and have been implicated in transcriptional activation of numerous metabolic genes (43 , 55 56 57) and breast tissue genes, including the estrogen receptor {alpha} (ER {alpha}) and the IGF2 receptor (58 , 59) . USF is also important for normal lactation (60) .

In the present studies, evidence for functionality for the putative USF sites in regulation of apelin core promoter activity is given in overexpression and site-directed mutagenesis experiments. Furthermore, ChIP assays indicate that endogenous USF binds to the apelin promoter in breast cells in vitro. EMSAs show that binding of a consensus USF oligonucleotide to a breast nuclear protein extract is significantly higher in pregnant and lactating rats when compared with control cyclic rats. This increase in binding activity correlates well with the increased breast apelin expression during pregnancy and lactation. Results from in vivo ChIP assays indicate involvement of USF in regulation of breast apelin expression during lactation. Breast DNA from lactating rats but not control cyclic rats is amplified by primers specific for the USF binding site in the proximal promoter region of the rat apelin gene. These findings along with the USF overexpression and mutation data indicate that USF exerts a stimulatory role in regulation of breast apelin expression.

Interestingly, the core promoters show a uniformly high transcriptional activity in all cell lines examined and, with the exception of the findings in breast (Hs578T) and colon (Caco-2) cells, the magnitudes of transcriptional activities for the rat core promoters and the larger 5'-upstream constructs are nearly equivalent, which suggests that cis-regulatory elements that control basal transcriptional activity of the rat apelin gene are located primarily in the core promoter region. In contrast to the rat, transcriptional activities of the larger 5'-upstream human constructs are much greater than the activity of the core promoter. Additionally, repressive elements that can inhibit transcription are present in the distal, upstream region of the human apelin promoter (between –3926 and –582 bp), since fragments upstream of –581/+74 bp showed a 50–60% reduction in activity in liver, heart, lung, placental, and hypothalamic cells. Inhibitory elements in the distal upstream region for the rat apelin promoter were not evident, with the exception of liver cells.

In two instances, transcriptional activities of the rat and human 5'-upstream constructs did not correlate with expression of the endogenous gene in cell lineages or in vivo. In murine hypothalamic (GT1–7) cells apelin promoter activity was low and did not agree with the high apelin expression levels in GT1–7 cells or in hypothalamic extracts (19) ; one possible explanation is that rat and human apelin promoter fragments are less active in murine-derived cells. In liver cells (HepG2) transcriptional activities of the rat and human 5'-upstream constructs, especially shorter fragments, are substantial and do not correlate with expression of the endogenous gene in HepG2 cells and in the liver in vivo (19) .

In summary, we have characterized the 5'-upstream regulatory regions of the rat and human apelin genes and demonstrated by transient transfection, mutagenesis, EMSA, and ChIP assays that the transcription factor USF is involved in regulation of breast apelin gene expression. More importantly, findings from in vivo ChIP assays indicate that endogenous USF exerts a stimulatory role in the up-regulation of breast apelin expression during lactation and possibly pregnancy in the rat.

ACKNOWLEDGMENTS

The authors thank Eileen Figueroa and Steve Schuenke for the preparation of this manuscript. This work was supported by National Institutes of Health grant PO1 DK35608, Broad Medical Research Foundation IBD-0118, and John Sealy Memorial Endowment CON13501.

Received for publication April 28, 2006. Accepted for publication July 5, 2006.

REFERENCES

  1. Kawamata, Y., Habata, Y., Fukusumi, S., Hosoya, M., Fujii, R., Hinuma, S., Nishizawa, N., Kitada, C., Onda, H., Nishimura, O., Fujino, M. (2001) Molecular properties of apelin: tissue distribution and receptor binding. Biochim. Biophys. Acta. 1538,162-171[Medline]
  2. Lee, D. K., Saldivia, V. R., Nguyen, T., Cheng, R., George, S. R., O’Dowd, B. F. (2005) Modification of the terminal residue of apelin-13 antagonizes its hypotensive action. Endocrinology 146,231-236[Abstract/Free Full Text]
  3. O’Dowd, B. F., Heiber, M., Chan, A., Heng, H. H., Tsui, L. C., Kennedy, J. L., Shi, X., Petronis, A., George, S. R., Nguyen, T. (1993) A human gene that shows identity with the gene encoding the angiotensin receptor is located on chromosome 11. Gene 136,355-360[CrossRef][Medline]
  4. Tatemoto, K., Hosoya, M., Habata, Y., Fujii, R., Kakegawa, T., Zou, M. X., Kawamata, Y., Fukusumi, S., Hinuma, S., Kitada, C., et al (1998) Isolation and characterization of a novel endogenous peptide ligand for the human APJ receptor. Biochem. Biophys. Res. Commun. 251,471-476[CrossRef][Medline]
  5. Masri, B., Morin, N., Pedebernade, L., Knibiehler, B., Audigier, Y. (2006) The apelin receptor is coupled to Gi1 or Gi2 protein and is differentially desensitized by apelin fragments. J. Biol. Chem. [epub ahead of print]
  6. Devic, E., Paquereau, L., Vernier, P., Knibiehler, B., Audigier, Y. (1996) Expression of a new G protein-coupled receptor X-msr is associated with an endothelial lineage in Xenopus laevis. Mech. Dev. 59,129-140[CrossRef][Medline]
  7. Devic, E., Rizzoti, K., Bodin, S., Paquereau, L., Knibiehler, B., Audigier, Y. (1999) Expression of a new family of receptors similar to CXC chemokine receptors in endothelial cell precursors. Pathol. Biol. (Paris) 47,330-338[Medline]
  8. Lee, D. K., Cheng, R., Nguyen, T., Fan, T., Kariyawasam, A. P., Liu, Y., Osmond, D. H., George, S. R., O’Dowd, B. F. (2000) Characterization of apelin, the ligand for the APJ receptor. J. Neurochem. 74,34-41[CrossRef][Medline]
  9. O’Shea, M., Hansen, M. J., Tatemoto, K., Morris, M. J. (2003) Inhibitory effect of apelin-12 on nocturnal food intake in the rat. Nutr. Neurosci. 6,163-167[CrossRef][Medline]
  10. Reaux, A., De Mota, N., Skultetyova, I., Lenkei, Z., El Messari, S., Gallatz, K., Corvol, P., Palkovits, M., Llorens-Cortes, C. (2001) Physiological role of a novel neuropeptide, apelin, and its receptor in the rat brain. J. Neurochem. 77,1085-1096[CrossRef][Medline]
  11. Sunter, D., Hewson, A. K., Dickson, S. L. (2003) Intracerebroventricular injection of apelin-13 reduces food intake in the rat. Neurosci. Lett. 353,1-4[CrossRef][Medline]
  12. Taheri, S., Murphy, K., Cohen, M., Sujkovic, E., Kennedy, A., Dhillo, W., Dakin, C., Sajedi, A., Ghatei, M., Bloom, S. (2002) The effects of centrally administered apelin-13 on food intake, water intake and pituitary hormone release in rats. Biochem. Biophys. Res. Commun. 291,1208-1212[CrossRef][Medline]
  13. Wang, G., Anini, Y., Wei, W., Qi, X., AM, O. C., Mochizuki, T., Wang, H. Q., Hellmich, M. R., Englander, E. W., Greeley, G. H., Jr (2004) Apelin, a new enteric peptide: localization in the gastrointestinal tract, ontogeny, and stimulation of gastric cell proliferation and of cholecystokinin secretion. Endocrinology 145,1342-1348[Abstract/Free Full Text]
  14. Lambrecht, N. W., Yakubov, I., Zer, C., Sachs, G. (2006) The transcriptomes of purified gastric ECL and parietal cells: identification of a novel pathway regulating acid secretion. Physiol. Genomics. 25,153-165[Abstract/Free Full Text]
  15. Cox, C. M., D’Agostino, S. L., Miller, M. K., Heimark, R. L., Krieg, P. A. (2006) Apelin, the ligand for the endothelial G-protein-coupled receptor, APJ, is a potent angiogenic factor required for normal vascular development of the frog embryo. Dev. Biol. [epub ahead of print]
  16. Habata, Y., Fujii, R., Hosoya, M., Fukusumi, S., Kawamata, Y., Hinuma, S., Kitada, C., Nishizawa, N., Murosaki, S., Kurokawa, T., et al (1999) Apelin, the natural ligand of the orphan receptor APJ, is abundantly secreted in the colostrum. Biochim. Biophys. Acta. 1452,25-35[Medline]
  17. Ishida, J., Hashimoto, T., Hashimoto, Y., Nishiwaki, S., Iguchi, T., Harada, S., Sugaya, T., Matsuzaki, H., Yamamoto, R., Shiota, N., et al (2004) Regulatory roles for APJ, a seven-transmembrane receptor related to angiotensin-type 1 receptor in blood pressure in vivo. J. Biol. Chem. 279,26274-26279[Abstract/Free Full Text]
  18. Kleinz, M. J., Davenport, A. P. (2004) Immunocytochemical localization of the endogenous vasoactive peptide apelin to human vascular and endocardial endothelial cells. Regul. Pept. 118,119-125[CrossRef][Medline]
  19. Medhurst, A. D., Jennings, C. A., Robbins, M. J., Davis, R. P., Ellis, C., Winborn, K. Y., Lawrie, K. W., Hervieu, G., Riley, G., Bolaky, J. E., et al (2003) Pharmacological and immunohistochemical characterization of the APJ receptor and its endogenous ligand apelin. J. Neurochem. 84,1162-1172[CrossRef][Medline]
  20. O’Carroll, A. M., Selby, T. L., Palkovits, M., Lolait, S. J. (2000) Distribution of mRNA encoding B78/apj, the rat homologue of the human APJ receptor, and its endogenous ligand apelin in brain and peripheral tissues. Biochim. Biophys. Acta. 1492,72-80[Medline]
  21. Daviaud, D., Boucher, J., Gesta, S., Dray, C., Guigne, C., Quilliot, D., Ayav, A., Ziegler, O., Carpene, C., Saulnier-Blache, J. S., et al (2006) TNF{alpha} up-regulates apelin expression in human and mouse adipose tissue. FASEB J. [epub ahead of print]
  22. Corre, S., Galibert, M. D. (2006) USF as a key regulatory element of gene expression. Med. Sci. (Paris) 22,62-67
  23. Gregor, P. D., Sawadogo, M., Roeder, R. G. (1990) The adenovirus major late transcription factor USF is a member of the helix-loop-helix group of regulatory proteins and binds to DNA as a dimer. Genes Dev. 4,1730-1740[Abstract/Free Full Text]
  24. Sirito, M., Walker, S., Lin, Q., Kozlowski, M. T., Klein, W. H., Sawadogo, M. (1992) Members of the USF family of helix-loop-helix proteins bind DNA as homo- as well as heterodimers. Gene Expr. 2,231-240[Medline]
  25. Girard, J., Ferre, P., Foufelle, F. (1997) Mechanisms by which carbohydrates regulate expression of genes for glycolytic and lipogenic enzymes. Annu. Rev. Nutr. 17,325-352[CrossRef][Medline]
  26. Griffin, M. J., Sul, H. S. (2004) Insulin regulation of fatty acid synthase gene transcription: roles of USF and SREBP-1c. IUBMB Life 56,595-600[Medline]
  27. Jiang, B., Mendelson, C. R. (2005) O2 enhancement of human trophoblast differentiation and hCYP19 (aromatase) gene expression are mediated by proteasomal degradation of USF1 and USF2. Mol. Cell. Biol. 25,8824-8833[Abstract/Free Full Text]
  28. Sellak, H., Choi, C., Browner, N., Lincoln, T. M. (2005) Upstream stimulatory factors (USF-1/USF-2) regulate human cGMP-dependent protein kinase I gene expression in vascular smooth muscle cells. J. Biol. Chem. 280,18425-18433[Abstract/Free Full Text]
  29. Shoulders, C. C., Naoumova, R. P. (2004) USF1 implicated in the aetiology of familial combined hyperlipidaemia and the metabolic syndrome. Trends Mol. Med. 10,362-365[CrossRef][Medline]
  30. Takahashi, Y., Kamataki, T. (2001) Competitive inhibition of the transcription of rabbit CYP1A1 gene by upstream stimulatory factor 1 (USF1). Drug Metab. Rev. 33,37-47[CrossRef][Medline]
  31. Gomez, G., Zhang, T., Rajaraman, S., Thakore, K. N., Yanaihara, N., Townsend, C. M., Jr, Thompson, J. C., Greeley, G. H. (1995) Intestinal peptide YY: ontogeny of gene expression in rat bowel and trophic actions on rat and mouse bowel. Am. J. Physiol. 268,G71-G81
  32. Lee, H. M., Hu, Z., Ma, H., Greeley, G. H., Jr, Wang, C., Englander, E. W. (2004) Developmental changes in expression and subcellular localization of the DNA repair glycosylase, MYH, in the rat brain. J. Neurochem. 88,394-400[Medline]
  33. Hocker, M., Zhang, Z., Merchant, J. L., Wang, T. C. (1997) Gastrin regulates the human histidine decarboxylase promoter through an AP-1-dependent mechanism. Am. J. Physiol. 272,G822-G830
  34. Segal, E. D., Falkow, S., Tompkins, L. S. (1996) Helicobacter pylori attachment to gastric cells induces cytoskeletal rearrangements and tyrosine phosphorylation of host cell proteins. Proc. Natl. Acad. Sci. U. S. A. 93,1259-1264[Abstract/Free Full Text]
  35. Grindstaff, K. K., Blanco, G., Mercer, R. W. (1996) Translational regulation of Na, K-ATPase alpha1 and beta1 polypeptide expression in epithelial cells. J. Biol. Chem. 271,23211-23221[Abstract/Free Full Text]
  36. Martinez-Fuentes, A. J., Hu, L., Krsmanovic, L. Z., Catt, K. J. (2004) Gonadotropin-releasing hormone (GnRH) receptor expression and membrane signaling in early embryonic GnRH neurons: role in pulsatile neurosecretion. Mol. Endocrinol. 18,1808-1817[Abstract/Free Full Text]
  37. Levy, A. P., Levy, N. S., Goldberg, M. A. (1996) Post-transcriptional regulation of vascular endothelial growth factor by hypoxia. J. Biol. Chem. 271,2746-2753[Abstract/Free Full Text]
  38. Gualillo, O., Caminos, J., Blanco, M., Garcia-Caballero, T., Kojima, M., Kangawa, K., Dieguez, C., Casanueva, F. (2001) Ghrelin, a novel placental-derived hormone. Endocrinology 142,788-794[Abstract/Free Full Text]
  39. Suttner, D. M., Sridhar, K., Lee, C. S., Tomura, T., Hansen, T. N., Dennery, P. A. (1999) Protective effects of transient HO-1 overexpression on susceptibility to oxygen toxicity in lung cells. Am. J. Physiol. 276,L443-L451
  40. Yamaguchi, Y., Heiny, M. E., Suzuki, M., Gitlin, J. D. (1996) Biochemical characterization and intracellular localization of the Menkes disease protein. Proc. Natl. Acad. Sci. U. S. A. 93,14030-14035[Abstract/Free Full Text]
  41. Littlewood-Evans, A. J., Bilbe, G., Bowler, W. B., Farley, D., Wlodarski, B., Kokubo, T., Inaoka, T., Sloane, J., Evans, D. B., Gallagher, J. A. (1997) The osteoclast-associated protease cathepsin K is expressed in human breast carcinoma. Cancer Res. 57,5386-5390[Abstract/Free Full Text]
  42. Meier, J. L., Luo, X., Sawadogo, M., Straus, S. E. (1994) The cellular transcription factor USF cooperates with varicella-zoster virus immediate-early protein 62 to symmetrically activate a bidirectional viral promoter. Mol. Cell. Biol. 14,6896-6906[Abstract/Free Full Text]
  43. Wei, W., Wang, G., Qi, X., Englander, E. W., Greeley, G. H., Jr (2005) Characterization and regulation of the rat and human ghrelin promoters. Endocrinology 146,1611-1625[Abstract/Free Full Text]
  44. Evers, B. M., Wang, X., Zhou, Z., Townsend, C. M., Jr, McNeil, G. P., Dobner, P. R. (1995) Characterization of promoter elements required for cell-specific expression of the neurotensin/neuromedin N gene in a human endocrine cell line. Mol. Cell. Biol. 15,3870-3881[Abstract]
  45. Ito, R., Sato, K., Helmer, T., Jay, G., Agarwal, K. (1984) Structural analysis of the gene encoding human gastrin: the large intron contains an Alu sequence. Proc. Natl. Acad. Sci. U. S. A. 81,4662-4666[Abstract/Free Full Text]
  46. Jiang, Q., Troyanovskaya, M., Jayaraman, G., Healy, D. P. (2000) Aminopeptidase-A. II. Genomic cloning and characterization of the rat promoter. Am. J. Physiol. Regul. Integr. Comp. Physiol. 278,R425-R434[Abstract/Free Full Text]
  47. Takahashi, Y., Fukushige, S., Murotsu, T., Matsubara, K. (1986) Structure of human cholecystokinin gene and its chromosomal location. Gene 50,353-360[CrossRef][Medline]
  48. Sharma, S. K., Leinemann, U., Ratke, R., Oetjen, E., Blume, R., Dickel, C., Knepel, W. (2005) Characterization of a novel Foxa (hepatocyte nuclear factor-3) site in the glucagon promoter that is conserved between rodents and humans. Biochem. J. 389,831-841[CrossRef][Medline]
  49. Kohri, K., Nata, K., Yonekura, H., Nagai, A., Konno, K., Okamoto, H. (1993) Cloning and structural determination of human peptide YY cDNA and gene. Biochim. Biophys. Acta. 1173,345-349[Medline]
  50. Krasinski, S. D., Wheeler, M. B., Leiter, A. B. (1991) Isolation, characterization, and developmental expression of the rat peptide-YY gene. Mol. Endocrinol. 5,433-440[Abstract]
  51. Golubovskaya, V., Kaur, A., Cance, W. (2004) Cloning and characterization of the promoter region of human focal adhesion kinase gene: nuclear factor kappa B and p53 binding sites. Biochim. Biophys. Acta. 1678,111-125[Medline]
  52. Petersenn, S., Rasch, A. C., Bohnke, C., Schulte, H. M. (2002) Identification of an upstream pituitary-active promoter of human somatostatin receptor subtype 5. Endocrinology 143,2626-2634[Abstract/Free Full Text]
  53. Ross, S., Tienhaara, A., Lee, M. S., Tsai, L. H., Gill, G. (2002) GC box-binding transcription factors control the neuronal specific transcription of the cyclin-dependent kinase 5 regulator p35. J. Biol. Chem. 277,4455-4464[Abstract/Free Full Text]
  54. Roy, A. L., Meisterernst, M., Pognonec, P., Roeder, R. G. (1991) Cooperative interaction of an initiator-binding transcription initiation factor and the helix-loop-helix activator USF. Nature 354,245-248[CrossRef][Medline]
  55. Hasegawa, J., Osatomi, K., Wu, R. F., Uyeda, K. (1999) A novel factor binding to the glucose response elements of liver pyruvate kinase and fatty acid synthase genes. J. Biol. Chem. 274,1100-1107[Abstract/Free Full Text]
  56. Matsukawa, T., Inoue, Y., Oishi, Y., Kato, H., Noguchi, T. (2001) Up-regulation of upstream stimulatory factors by protein malnutrition and its possible role in regulation of the IGF-binding protein-1 gene. Endocrinology 142,4643-4651[Abstract/Free Full Text]
  57. Wang, D., Sul, H. S. (1995) Upstream stimulatory factors bind to insulin response sequence of the fatty acid synthase promoter. USF1 is regulated. J. Biol. Chem. 270,28716-28722[Abstract/Free Full Text]
  58. Szentirmay, M. N., Yang, H. X., Pawar, S. A., Vinson, C., Sawadogo, M. (2003) The IGF2 receptor is a USF2-specific target in nontumorigenic mammary epithelial cells but not in breast cancer cells. J. Biol. Chem. 278,37231-37240[Abstract/Free Full Text]
  59. DeGraffenried, L. A., Hopp, T. A., Valente, A. J., Clark, R. A., Fuqua, S. A. (2004) Regulation of the estrogen receptor alpha minimal promoter by Sp1, USF-1 and ERalpha. Breast Cancer Res. Treat. 85,111-120[CrossRef][Medline]
  60. Hadsell, D. L., Bonnette, S., George, J., Torres, D., Klementidis, Y., Gao, S., Haney, P. M., Summy-Long, J., Soloff, M. S., Parlow, A. F., et al (2003) Diminished milk synthesis in upstream stimulatory factor 2 null mice is associated with decreased circulating oxytocin and decreased mammary gland expression of eukaryotic initiation factors 4E and 4G. Mol. Endocrinol. 17,2251-2267[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Am. J. Physiol. Regul. Integr. Comp. Physiol.Home page
S. Han, G. Wang, X. Qi, H. M. Lee, E. W. Englander, and G. H. Greeley Jr.
A possible role for hypoxia-induced apelin expression in enteric cell proliferation
Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2008; 294(6): R1832 - R1839.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-6315fjev1
20/14/2639    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wang, G.
Right arrow Articles by Greeley, G. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wang, G.
Right arrow Articles by Greeley, G. H., Jr.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS