|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
,






* Laboratory of Tumor and Development Biology, Centre de recherche en cancérologie expérimentale (CRCE), Université de Liège, Liège, Belgium;
Center of Immunology, Université de Liège, Liège, Belgium;
Department of Gynecology and Obstetrics, CHR-Citadelle, Liège, Belgium;
INSERM U135, Paris, France;
|| Collège de France, INSERM U36, Paris, France;
¶ Institute of Reproductive and Developmental Biology, Imperial College Faculty of Medicine, Hammersmith Campus, London, UK;
# Department of Physiology, University of Turku, Turku, Finland
1Correspondence: University of Liège, Laboratory of Tumor Biology and Development, Institute of Pathology CHU-B23, B-4000 Liège, Sart-Tilman, Belgium. E-mail: jmfoidart{at}ulg.ac.be
ABSTRACT
Successful embryo development requires an extensive endometrial angiogenesis in proximity of implantation site. The glycoprotein hCG is produced even before implantation by trophoblast in normal pregnancy. In this manuscript, we demonstrate an angiogenic effect of hCG in several in vivo (chick chorioallantoïc membrane, matrigel plug assay, aortic ring assay) and in vitro experimental models. In contrast, human placental lactogen (hPL) did not display angiogenic properties. LH/hCG receptor was detected in endothelial cells by reverse-transcriptase polymerase chain reaction (RT-PCR) and by Western blotting. In mice aortic ring assay, angiostimulation by hCG was abrogated by deletion of LH/hCG receptor (LuRKO mice). Use of recombinant hCG and antihCG antibody (Ab) further confirmed the specificity of this angiogenic activity. By using dibutyryl cAMP, adenylate cyclase, or protein kinase A inhibitors, we demonstrate that hCG-mediated angiogenesis involves adenylyl-cyclaseprotein kinase A activation. Addition of hCG to endometrial epithelial epithelial cells, but not to cultured endothelial cells, stimulated vascular endothelial growth factor (VEGF). VEGF and hCG also displayed additive activities. Altogether, these data demonstrate that peritrophoblastic angiostimulation may result from a paracrine dialogue between trophoblast, epithelial, and endothelial cells through hCG and VEGF.Berndt, S., Perrier dHauterive, S., Blacher, S., Péqueux, C., Lorquet, S., Munaut, C., Applanat, M., Hervé, M. A., Lamandé, N., Corvol, P., van den Brûle, F., Frankenne, F., Poutanen, M., Huhtaniemi, I., Geenen, V., Noël, A., Foidart, J.-M. Angiogenic activity of human chorionic gonadotropin through LH receptor activation on endothelial and epithelial cells of the endometrium.
Key Words: angiogenesis hCG
SUCCESSFUL EMBRYO IMPLANTATION requires a precise synchrony between the blastocyst and the uterine environment where a complex series of interactions occurs. Indeed implantation involves a complex interplay of growth factors, cytokines and prostaglandins resulting in inflammatory responses in the human endometrium [for a review see Kelly et al. (1)
]. Although the precise mechanisms regulating implantation are still unknown, increasing evidence suggests that hCG, one of the major hormonal products of the first trimester human placental trophoblast cells plays an important role in these maternoembryonic interactions (2)
.
hCG is required to maintain pregnancy in the primate and exerts its effects in the ovary, through LH/hCG receptors, by stimulating progesterone secretion from the corpus luteum during the first trimester. Several studies indicate that hCG signals act also directly on endometrium (3)
and modulate stromal and epithelial cell activities, already prior to and in preparation for blastocyst implantation [for a review, see Cameo et al. (4)
]. For example, injection of hCG reduces apoptosis in human endometrium (5)
and a local infusion of hCG to nonpregnant baboons functionally alters the major cell types present in baboon uterine endometrium, in a pattern that resembles that observed after implantation (6
, 7)
.
hCG and LH activities are mediated by the same receptor (LH/hCG R). The expression of this receptor was previously thought to be restricted to gonadal tissue. However, recent studies have shown its presence in many other tissues throughout the reproductive and nonreproductive organs such as neural retina (8)
, adult rat spinal cord (9)
, human skin (10)
, mammary gland (11)
, and vascular tissue (12
, 13)
. This G protein-coupled receptor activates mainly cAMP/PKA pathway (14
, 15)
.
hCG increases uterine arterial blood flow (12)
and also stimulates angiogenesis in the ovary, by stimulating vascular endothelial cell proliferation and VEGF expression (16)
. LH/hCG R expression has been documented in uterine endothelial cells by ligand binding of 125I hCG and activity measurements (12)
.
A recent report has depicted urinary hCG as a proangiogenic factor (17)
. It remains possible, however, that such an activity could be the consequence of a contaminant present in the urinary extract, since anti HIV activity ascribed to hCG is considered in some studies to be the consequence of an urinary contaminant present in the preparation (18)
. Nevertheless, others provided evidence for induction of apoptosis in Kaposis sarcoma spindle cells by the recombinant hCG ß subunit (19)
.
One of the key local adaptations to pregnancy is the stimulation of maternal vessel network at the embryo implantation site. Normal fetal development requires extensive angiogenesis and important vascular remodeling that allows adequate supply of nutrients as well as gas and metabolite exchanges. Abnormal uterine blood supply is associated with higher perinatal morbidity and mortality caused by preterm delivery, preeclampsia, or intrauterine growth restriction. Stimulation of angiogenesis in many organs is mediated through enhanced expression of VEGF, an angiogenic cytokine produced by endometrial epithelial and stromal cells with the highest levels in the late secretory and premenstrual phases (20)
. Therefore, in this study, we aimed at (1)
reevaluating the proangiogenic effect of hCG in different in vivo and in vitro models of angiogenesis, elucidating molecular mechanisms of this effect (2)
and identifying the endometrial cellular target(s) triggered by hCG (3)
.
MATERIALS AND METHODS
Materials
Reagents tested were purified urinary hCG (Pregnyl®, Organon, Roseland, NJ, USA), human recombinant hCG (Ovitrelle® Serono, Geneva, Switzerland), hPL (Sigma, St. Louis, MO, USA), VEGF (PeproTech, London, UK), antihCG Ab (Sc-7821, Santa Cruz Biotechnology, Santa Cruz, CA, USA), dibutyryl-cAMP (D0260, Sigma), H89 dihydrochloride (Calbiochem, La Jolla, CA, USA), MDL-12 330A hydrochloride (Calbiochem), recombinant human FGF basic (R&D Systems, Abingdon, UK), polyclonal goat anti-mouse LHR Ab (Sc-26343, Santa Cruz Biotechnology).
LuRKO mice
LH/hCG receptor knockout mice (LuRKO) were generated by disruption of exon 11 of LHR gene (21)
. For aortic ring assay, thoracic aortas were removed from six male mice of 6 wk old.
Aortic ring assay
Rat aortic rings were cultured in three-dimensional collagen gels as described previously (22
, 23)
. Effects of different compounds were tested by adding them into culture medium at day 0. In some studies, aortic explants resected from wild-type (WT) or LuR KO mice with the same genetic background (C57Bl) were used and maintained in the presence of 2% serum collected from WT or KO mice. For quantification, image analysis was performed on a Sun SPARC30 workstation with the software Visilog 5.0 from Noesis according to Blacher et al. (23)
. The following parameters were determined: number of microvessels (Nv); maximal microvessel length (Lmax); and total number of branching in microvessels (Nb).
In vivo mouse Matrigel plug assay
The mouse Matrigel plug assay was performed as described previously (24)
. Briefly, C57BL/6J mice were injected subcutaneously (s.c.) with 0.5 ml Matrigel containing heparin (10 U/ml) and the indicated amount of hCG or basic fibroblast growth factor (bFGF) (250 ng/ml). After 7 d, Matrigel plugs were carefully dissected and frozen. Plugs were lyophilized, weighed, and homogenized for 1 h in 400 µl of saponine 0.1%. Samples were spun at 10,000 rpm in a microcentrifuge for 6 min, and supernatants were collected for hemoglobin (Hb) measurement by using Total Hb kit (Sigma Diagnostics) (25)
. Results are expressed as Hb concentration normalized to plug wt.
Chicken chorioallantoic membrane (CAM) assay
Fertilized chicken eggs were incubated at 38°C in a humidified incubator and were prepared for implantation on day 3 of incubation. Incubation was performed with cell adhesion molecule (CAM) out of shells, in ventilated cell culture dishes (26)
. On day 8 of incubation, depending on CAM development, up to three silicone rings (with a thickness of 0.3 mm and an inner diameter of 9 mm) were placed on each membrane, hCG solutions (25 µl) containing 50, 200, or 500 IU were spotted into rings. Four days later, CAMs were injected intravenously (i.v.) with FITC-dextran to facilitate vasculature identification. To quantify angiogenesis (27)
, the following global parameters were determined: (a) the vessel area density defined as number of pixels forming the vascular network divided by total area, (b) the vessel length density defined as number of pixels forming the skeleton of vascular network divided by total area, (c) the first-order vessel density per area defined as number of vessel extremities divided by total area; and (d) the branching density defined as the number of crossing vessels divided by total area.
HUVEC culture
Human umbilical vein endothelial cells (HUVEC) isolated with collagenase I (Sigma) were grown on 0.2% gelatin-coated dishes in 10% FBS MCDB 131 supplemented with HEPES 25 mM, glutamin 2 mM, endothelial cell growth supplement (12 ng/ml), heparin (2.5 mg/ml), and antibiotics (penicillinstreptomycin 100 U/ml) as described previously (28)
. These cells were cultured in 5% CO2 at 37°C, and media were replaced every 2 d. Cells at passage two to six were used for experiments.
Isolation of endometrial cells
Endometrial biopsies were collected from fertile women (one previous delivery) with normal cycles (n=18) undergoing surgery for voluntary sterilization or during hysteroscopy before assisted medical procreation (AMP) because of male infertility. The stage of menstrual cycle was established from womens menstrual history (based on the first day of last menstruation) and from histological dating performed by experienced pathologists, according to criteria of Noyes et al. (29)
. Nine patients were in proliferative phase, and nine were in secretory phase. The mean age was 33.5 yr. None of the patients received any hormonal treatment for three months prior to biopsy. Stromal and epithelial cells were isolated and cultured as described previously (30)
. The purity of the cell population was verified as described previously (2;30) by using appropriate antibodies to identify the epithelial cells (anti cytokeratin Ab), the stromal cells (anti vimentin and alpha smooth muscle actin), or the endothelial cells (CD34 Ab). All cultures had a purity higher than 97%.
HUVEC and endometrial epithelial cell (EEC) proliferation assay
HUVEC were allowed to adhere and spread on 96-well, gelatin-coated dishes (5x103 cells/well). Cells were treated with or without hCG (101000 U/ml) in MCDB131 containing 2% FBS for 3 d. Endothelial cell proliferation was evaluated using a 5-bromo-2'deoxyuridine (bromodeoxyuridine) colorimetric immunoassays applied according to manufacturers instructions (Roche, Indianapolis, IN, USA). To study epithelial cell proliferation, EEC from three different endometria were cultured for 72h using bromodeoxyuridine (BrdU) cell proliferation colorimetric immunoassay applied according to manufacturers instructions (Roche).
RT-PCR analysis
Total RNA was extracted from HUVEC cell monolayer supplemented or not with uhCG (100 IU/ml) or granulosa cells using an RNeasy Mini Kit® from Qiagen (Valencia, CA, USA), according to the manufacturers instructions. Total RNA (250 ng) were subjected to reverse-transcriptase using the First Strand cDNA Synthesis Kit (Roche). In this method, RNA is reverse transcribed by avian myeloblastosis virus (AMV) into single-stranded cDNA. The cDNA was secondarily amplified by FastStart TaqDNA Polymerase (Roche) using the primers corresponding to human hCG/LHR cDNA sequence (upper primer 5'-TTCCTTAGGGTCCTGATTTGG 3'; and lower primer 5'- GTGAATAGCATAGGTGATGGTGTG 3'). PCR reaction mixture (50 µl) contained 20 pmol of each oligonucleotide primer and 2 IU of TaqDNA polymerase. The reaction was started at 94°C for 5 min and run for 40 cycles (45 s at 94°C, 1 min at 56°C, and 1 min at 72°C). The expected PCR product was 349 bp in length. 28S PCR primer pair (Eurogentec, Belgium) was used, resulting in a PCR product of 200 bp. PCR conditions for 28S were 95°C for 2 min, 17 cycles consisting of 94°C/15 s, 68°C/20 s, 72°C/10 s, and a final elongation step of 72°C/2 min. The amplification products were electrophoresed on a polyacrylamide gel, stained with Gelstar (Sanver Tech, Antwerpen, Belgium), and scanned with FluorSImager. Aliquots of 15 µl of amplified fragments were visualized in ethidium bromide-stained 2% agarose gel.
Western blot analysis
Total cell extracts were prepared by incubating cells in radioimmune precipitation assay buffer (50 mM Tris-HCl, ph 7.4; 150 mM NaCl; 1% Nonidet P40, 1% Triton X-100; 1% sodium deoxycholate; 0.1% SDS; 5 mM iodoacetamide; 2 mM phenylmethylsulfonyl fluoride). After centrifugation at 15,000 rpm for 30 min, at 4°C, the supernatant was stored frozen at 20°C. Protein concentration was determined by using DC protein assay Kit (Bio-Rad Laboratories, Hercules, CA) and adjusted to 5 mg/ml. HUVEC extracts were resolved by SDS-PAGE 10% concentrated under reducing conditions and transferred to nitrocellulose membranes (Hybond-enhanced chemiluminescence membrane; Amersham, Arlington Heights, IL). Membranes were exposed to polyclonal primary Ab raised against rat LH receptor (1/2500) (BP605 Ab, Acris antibodies, Hiddenhausen, Germany). After extensive washings, membranes were incubated with a secondary horseradish peroxidase-conjugated swine anti-rabbit Ab at 1/1000 (DAKO, Glostrup, Denmark). Signals were detected using an enhanced chemiluminescence (ECL) kit (PerkinElmer Life Sciences, Boston, MA, USA) according to manufacturers instructions.
Cytokine and Db cAMP immunoassays
VEGF concentrations were measured by using ELISA kit (R&D Systems) with a sensitivity of 5 pg/ml and a range of 15.61000 pg/ml. Inter- and intra-assay coefficients of variation (CV) were <8.5% and <6.5%, respectively. To determine cAMP concentration, cyclic AMP enzyme immunoassay (EIA) kit (Cayman Chemical, Ann Arbor, MI, USA) was used.
Statistical analysis
All experimental data are reported as mean ± SEM, and statistical analysis was performed by ANOVA test or Students t test. P < 0.05 was considered as significant.
RESULTS
hCG stimulates in vivo angiogenesis
The angiogenic activity of hCG was first investigated by using rat aortic ring assay. Incubation with physiological concentrations of urinary hCG (uhCG) (8800 IU/ml) or recombinant hCG (rhCG) (10400 IU/ml) resulted in an important stimulation of vessel outgrowth (Fig. 1
A). A dose-dependent effect of both recombinant and uhCG was observed on the number of vessels (Nv), of branchings (Nb) as well as on the length of vessels (Lmax) (Fig. 1B
). This dose-response curve displayed a bell-shape with maximal effect of uhCG and rhCG between 100 to 200 IU/ml. The specificity of the angiogenic effect of uhCG was further assessed by complete inhibition with a neutralizing anti-hCG Ab (Fig. 1C
). The angiogenic effect of uhCG was also evaluated in two other in vivo models: the CAM and the Matrigel plug assays. Similarly, uhCG enhanced the complexity of vascular network in the CAM assay (Fig. 2
). An original computer-assisted method of quantification based on image analysis (27)
revealed that uhCG stimulated different morphological vessel parameters such as: end point density (2579±879.107 in the absence of hCG vs. 3278±811.107 in the presence of uhCG (50 IU) for 4 d; P<0.05), branching density (3465±1194.107 in the absence of hCG vs. and 4615±1265.107 in the presence of uhCG (50 IU) for 4 d; P<0.05), vessel area density (1596±214.104 in the absence of hCG vs. and 1787±229.104 in the presence of uhCG (50 IU) for 4 d; P<0.05) and length densities (1821±374.105 in the absence of hCG vs. 2142±4189.105 in the presence of uhCG (50 IU) for 4 d; P>0.05). Similar results were obtained at day 1 and day 4 post-uhCG supplementation (data not shown).
|
|
In matrigel plug assay, uhCG (500 IU/ml gel) stimulated the invasion of matrix by functional blood vessels to an extent comparable with that of 250 ng bFGF (Fig. 3
). Higher doses (2500 IU) were less active. hPL (7.5 µg/ml) failed to stimulate blood vessel formation (data not shown).
|
hCG stimulates in vitro endothelial cell proliferation
As shown in Fig. 4
A, uhCG (10200 U/ml) significantly increased HUVEC proliferation (P<0.01). hCG induced a three-fold increase in HUVEC proliferation rate at 200 U/ml, respectively (0.023±0.002 and 0.067±0.005; P<0.01). This effect is specific to endothelial cells, since hCG did not affect endometrial epithelial (Fig. 4B
).
|
The angiogenic effect of hCG on endothelial cells is mediated via activation of LH/hCGReceptor and cAMP/PKA pathway
hCG is known to exert its effect by interacting with its LH/hCG R leading to activation of the Gs/adenylyl cyclase (AC)/cAMP/protein kinase A (PKA) pathway (15)
. LH/hCG R mRNA was depicted by RT-PCR in HUVEC, stimulated or not with uhCG [granulosa cells extracted from large (>20 mm) antral follicles were used as positive control, while extracts from liver or dermal fibroblasts were constantly negative (data not shown) (Fig. 5
A)]. Western blot analysis also identified LH/hCG R in cellular extracts of HUVEC (Fig. 5B
). Two bands corresponding to a partial processing of the full-length LHR (31)
were detected in granulosa extracts used as positive control. Only one band was identified in endothelial cells. Treatment of HUVEC for 48 h with uhCG did not affect the expression of this receptor.
|
Dibutyryl cAMP stimulated vessel outgrowth from aortic ring (Fig 6
Aa, suggesting the importance of the PKA pathway during this angiogenic response. MDL12, an adenylate cyclase inhibitor could abolish the cAMP increase after uhCG (100 IU/ml) stimulation in HUVEC culture for 24 h (Fig. 6A
b). However, H89, an inhibitor of PKA (32)
, reduced angiogenesis both in the presence or absence of hCG in the aortic ring assay (Fig. 6B
), probably by reducing the endothelial cell proliferation that is stimulated by hCG (Fig. 6C
).
|
In earlier studies, some of the extragonadal effects of gonadotropins might have been caused by biologically active contaminants, for instance growth factors (33)
. It is, therefore, important to use also recombinant hormones, free from contaminants, and LuRKO tissues and cells for functional studies. We, therefore, evaluated the effect of uhCG and rhCG on vascular outgrowth from aortice rings from WT and LuRKO mice. Although hCG induced an angiogenic response in aortic rings of WT mice, no stimulation was achieved when aortic rings of LuRKO mice were used (Fig. 7
). The presence of LHR in WT aorta and its absence in LuRKO were assessed by immunostaining using a polyclonal goat anti-mouse Ab raised against the C-terminal part of the receptor, which has been deleted in LuRKO mice (data not shown).
|
hCG exerts a paracrine effect on VEGF production by EEC
To determine whether hCG could modulate angiogenesis by affecting VEGF production, the effect of hCG on VEGF production was evaluated in endometrial epithelial cells (EEC) and HUVEC. Treatment with hCG failed to modulate VEGF production by HUVEC (data not shown) but significantly enhanced VEGF secretion by EEC. Indeed, a 1.5-fold increase of VEGF secretion was evidenced by ELISA in the medium of EEC conditioned for 48 h with uhCG (Fig. 8
).
|
hCG and VEGF display additive activities
Knowing that hCG could enhance VEGF production by endometrial epithelial cells in culture, we hypothesize that a combination of these two factors could potentialize the angiogenic response. This was confirmed in the aortic ring assay (Fig. 9
), where we could observe an additive effect between VEGF (10 ng/ml) and uhCG (100 IU/ml). This increased angiogenic response is significant regarding their stimulating effect when two factors are tested alone.
|
DISCUSSION
The effects of hCG are well-documented in gonadal tissue, for example, the luteotropic support for the corpus luteum (34)
. hCG prevents luteolysis process by maintaining luteal blood flow, limiting tissue remodeling through a reduction of matrix metalloproteinase-2 (MMP-2) activation and macrophage influx (35)
, and preventing apoptosis via an increase in BclII/Bax ratio (36)
. During gestation, hCG may play an autocrine/paracrine role in trophoblast invasion (37
, 38)
.
In normal pregnancy, hCG expression is associated with endometrial angiostimulation occurring early in gestation. hCG increases blood supply and alters the uterine vasculature via vasodilatation, increasing permeability, development, and maturation of new vessel. (12, 3941).
Our study demonstrates clearly a direct angiogenic effect of dimeric u and rhCG on endothelial cells in the aortic ring, CAM, matrigel plug, and endothelial cell proliferation assays. A dose-dependent effect was demonstrated on vessel sprouting in the aortic ring and in the matrigel plug assays, as well as on endothelial cell proliferation in HUVEC cultures, with optimal doses of 100200 IU hCG/ml, while lower but also higher doses were less effective. Thus, our study is in line with the report by Zygmunt et al. (17)
. The blockade of angiogenesis in the aortic ring assay with anti-hCG Ab, the use of recombinant hCG, adenylcyclase activator/inhibitor (dbCAMP/MDL12), and PKA inhibitors demonstrate that hCG acts through interaction with LH/hCG R. In addition, the abrogation of hCG proangiogenic action in LHR/ aortic rings confirmed the authenticity of this effect. It could, therefore, not be ascribed to a contaminant present in the urinary extracts of hCG, as documented by others for the anti-HIV activities of hCG (18)
. In addition, we are providing evidence that hCG can exert angiogenic activity by a direct interaction with LH/hCG R expressed by endothelial cells.
LH/hCG R expression has been evidenced on different cell types. Several studies indicate that LH/hCG R is present in endothelium and smooth muscle of uterine blood vessels in vivo (12, 42). This observation is in accordance with previous reports showing that hCG elicits VEGF A mRNA and/or protein production in ovarian hyperstimulation syndrome (43
44
45)
and in granulosa cells of various species (46)
. hCG was also depicted for stimulating markedly, in a dose-dependent manner, VEGF 165 secretion of cytotrophoblastic cells (47)
and in human endometrium (38)
.
Furthermore, LH/hCG R has also been identified in endometrium with a maximal expression during the implantation window (48)
. We demonstrate here that addition of hCG to endometrial epithelial cells enhanced VEGF secretion.
Collectively, our data suggest that the trophoblast may stimulate the maternal endometrial angiogenesis via at least two mechanisms: the first one is related to a direct activation of endothelial cells mediated by hCG; and the second one implicates a paracrine loop involving an enhanced secretion of VEGF by EEC under the control of hCG. Finally, the additive effect of hCG and VEGF indicate that these two growth factors operate through different but converging signaling pathways. While VEGF acts through VEGFR-1 and R-2 tyrosine kinase receptors (49)
, hCG interacts with LH/hCG G-protein-coupled receptor and activates adenylate cyclase/cAMP pathway (15)
. Incubations of EEC with hCG were documented not to significantly increase intracellular cAMP, compared with Chinese hamster ovary cells stably transfected with the full-length hCG/LH R (50)
. hCG induced phosphorylation of extracellular signal regulated protein kinases 1 and 2 (ERK1/2). Phosphorylation of ERK1/2 in human endometrial epithelial cells was independent of protein kinase A, on the basis of the lack of cAMP production and lack of inhibition of phosphorylation in the presence of the protein kinase A inhibitor H-89 in hCG-stimulated EEC cells.
In our study, we provide evidence for a cAMP/PKA mediated pathway of angiostimulation in the aortic ring assay, since dbcAMP increased angiogenesis and the increased levels of cAMP in the presence of hCG could be abolished by MDL12, an adenylate cyclase inhibitor. Finally, H89, a PKA inhibitor, also reduced the ex vivo capillary sprouting stimulated by hCG. Others have previously shown in different models that the PKC transduction pathway plays an important role in capillary formation and survival phases of angiogenesis (51
52
53
54)
.
Although estrogens and progesterone have long been believed to be essential for developing an appropriate endometrial environment for blastocyst implantation, it is now evident that these effects are further modulated by peptide hormones and peptide growth factors secreted by a variety of cell types within the uterine endometrium [for a review, see Filicori et al. (33)
].
In conclusion, hCG appears to play a key role in the angiogenic synchrony between blastocyst and maternal endometrium through interactions that involve the LH/hCG R activation present at the surface of maternal endometrial endothelial and epithelial cells. This results in the induction of genes that might play a critical role in modulating the local angiogenesis, which ultimately results in an environment that is favorable to embryo implantation.
Received for publication March 31, 2006. Accepted for publication July 6, 2006.
REFERENCES
This article has been cited by other articles:
![]() |
N. J. Hannan, P. Paiva, E. Dimitriadis, and L. A. Salamonsen Models for Study of Human Embryo Implantation: Choice of Cell Lines? Biol Reprod, February 1, 2010; 82(2): 235 - 245. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Berndt, S. Blacher, S. Perrier d'Hauterive, M. Thiry, M. Tsampalas, A. Cruz, C. Pequeux, S. Lorquet, C. Munaut, A. Noel, et al. Chorionic Gonadotropin Stimulation of Angiogenesis and Pericyte Recruitment J. Clin. Endocrinol. Metab., November 1, 2009; 94(11): 4567 - 4574. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. A. Rahman and C.V. Rao Recent progress in luteinizing hormone/human chorionic gonadotrophin hormone research Mol. Hum. Reprod., November 1, 2009; 15(11): 703 - 711. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Alvarez, I. Alonso-Muriel, G. Garcia, J. Crespo, J. Bellver, C. Simon, and A. Pellicer Implantation is apparently unaffected by the dopamine agonist Cabergoline when administered to prevent ovarian hyperstimulation syndrome in women undergoing assisted reproduction treatment: a pilot study Hum. Reprod., December 1, 2007; 22(12): 3210 - 3214. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |