FASEB J.
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published as doi: 10.1096/fj.06-6503fje.
This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-6503fjev1
20/14/2618    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lecuona, E.
Right arrow Articles by Sznajder, J. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lecuona, E.
Right arrow Articles by Sznajder, J. I.
(The FASEB Journal. 2006;20:2618-2620.)
© 2006 FASEB

Na,K-ATPase {alpha}1-subunit dephosphorylation by protein phosphatase 2A is necessary for its recruitment to the plasma membrane

Emilia Lecuona*,1, Laura A. Dada*, Haiying Sun*, Maria L. Butti*, Guofei Zhou*, Teng-Leong Chew{dagger} and Jacob I. Sznajder*

* Division of Pulmonary and Critical Care Medicine, Department of Medicine and

{dagger} Cell Imaging Facility, Department of Cell and Molecular Biology, Northwestern University, Chicago, Illinois, USA

1Correspondence: Pulmonary and Critical Care Medicine, Feinberg School of Medicine, Northwestern University, 240 E. Huron, McGaw M410, Chicago, IL 60611, USA. E-mail: e-lecuona{at}northwestern.edu

ABSTRACT

In alveolar epithelial cells, G-protein coupled-receptors agonists (GPCR) induce the recruitment of the Na,K-ATPase to the plasma membrane. Here we report that for the recruitment of the Na,K-ATPase to occur, dephosphorylation of its {alpha}1-subunit at serine 18 is necessary, as demonstrated by in vitro phosphorylation, mutation of the serine 18 to alanine, and use of a specific phospho-antibody. Several approaches strongly suggest dephosphorylation to be mediated by protein phosphatase 2A (PP2A): 1) Na,K-ATPase dephosphorylation and recruitment were prevented by okadaic acid (OA); 2) the Na,K-ATPase {alpha}1-subunit is an in vitro substrate for PP2A; and 3) glutathione S-transferase (GST)-fusion proteins binding assays demonstrate a direct interaction between the catalytic subunit of PP2A and the first 90 amino acids of the Na,K-ATPase {alpha}1-subunit. Finally, GPCR agonists induced a rapid translocation of PP2A from the cytosol to the membrane fraction, which corresponded with increased coimmunoprecipitation and colocalization of PP2A and the Na,K-ATPase. Accordingly, we provide evidence that GPCR agonists promote PP2A translocation to the membrane fraction, leading to the dephosphorylation of the Na,K-ATPase {alpha}1-subunit at the serine 18 residue and its recruitment to the cell plasma membrane, which is of biological and physiological importance.—Lecuona, E., Dada, L. A., Sun, H., Butti, M. L., Zhou, G., Chew, T.-L., Sznajder, J. I. Na,K-ATPase {alpha}1-subunit dephosphorylation by protein phosphatase 2A is necessary for its recruitment to the plasma membrane.


Key Words: alveolar epithelial cells • G-protein-coupled receptor agonists • intracellular trafficking

THE NA,K-ATPASE IS AN ESSENTIAL ENZYME for mammalian cells homeostasis as it transports actively Na+ out of and K+ into the cell. The Na+ and K+ gradients are required to maintain membrane potentials, cell volume, and secondary active transport of other solutes, i.e., the transcellular transport in the intestine, kidney, and lungs (1 , 2) . The minimal functional unit of the Na,K-ATPase is a heterodimer of an {alpha}- and a ß -subunit (3) .

The Na,K-ATPase is subjected to both short- and long-term regulation by a variety of stimuli (i.e., hormones, hypoxia) (4 5 6 7) . Short-term regulation involves either 1) direct effects on the kinetic behavior of the enzyme or 2) translocation of Na,K-ATPases between the plasma membrane and intracellular stores (4 , 8 9 10) . Reversible covalent modification by phosphorylation and dephosphorylation has been reported in the regulation of the Na,K-ATPase trafficking between compartments (11) . It has been recently shown that phosphorylation of the Na,K-ATPase {alpha}1-subunit at the serine 18 residue provided the signal for the removal of the Na,K-ATPase from the plasma membrane and endocytosis into intracellular compartments (6 , 12 , 13) . Dephosphorylation of the pump has been less studied, but a role for protein phosphatases during the intracellular Na,K-ATPase traffic has also been proposed (14 , 15) , and a direct dephosphorylation of the Na,K-ATPase {alpha}1-subunit after stimulation by insulin has been suggested (16 , 17) .

Protein phosphatase 2A (PP2A) is one of the major Ser/Thr phosphatases implicated in the regulation of signal transduction pathways, cell cycle, DNA replication, gene transcription, and protein translation (18 , 19) . The core structure of PP2A comprises a 36 kDa catalytic subunit (PP2AC) and a 65 kDa regulatory subunit (PR65 or A subunit). This core dimeric structure can exist independently or can be associated with a third variable subunit leading to a multitude of assembly combinations of holoenzymes, which may explain the multiple cellular functions of PP2A (20 , 21) .

Reabsorption of pulmonary edema is driven by vectorial Na+ transport across the alveolar epithelium with water following the osmotic Na+ gradient (1) . Up-regulation of the Na,K-ATPase at the basolateral membrane of alveolar epithelial cells (AEC) by G-protein coupled-receptor (GPCR) agonists has been shown to increase lung edema clearance in normal lungs and in models of lung injury (22 23 24 25 26 27) . The existence of Na,K-ATPase intracellular pools ready to be inserted at the plasma membrane on GPCR stimulation has been described (15 , 28 29 30) , and a role for PP2A in this intracellular traffic has been suggested (15) . We set out to determine whether GPCR agonists promoted the dephosphorylation of the Na,K-ATPase {alpha}1-subunit and found that dephosphorylation of the Na,K-ATPase {alpha}1-subunit by PP2A at the Serine 18 residue was necessary for its recruitment to the plasma membrane.

MATERIALS AND METHODS

Reagents
All cell culture reagents were from Mediatech Inc (Herndon, VA, USA). Ouabain was purchased from ICN Biomedicals Inc. (Aurora, OH, USA). Rat brain protein kinase C (PKC) was purchased from Calbiochem (San Diego, CA, USA). [{gamma}-32P]ATP was from Amersham Bioscience (Piscataway, NJ, USA). All other chemicals were purchased from Sigma (St. Louis, MO, USA). The Na,K-ATPase {alpha}1 monoclonal antibody (mAb) (clone 464.6), mAb against the catalytic subunit of PP2A and purified protein phosphatase 2A were from Upstate Biotech (Lake Placid, NY, USA). The Mck1 antibody (Ab) was a kind gift from Dr K. Sweadner (Massachusetts General Hospital, Boston, MA, USA). Polyclonal anti-GFP Ab was from Clontech (Palo Alto, CA, USA) and monoclonal anti-V5 Ab was from Invitrogen (Carlsbad, CA, USA). Secondary goat anti-mouse-HRP was from Bio-Rad (Hercules, CA, USA), and secondary goat anti-mouse-Alexa568 was from Molecular Probes (Eugene, OR, USA). Monoclonal GFP Ab and Protein A/G plus were from Santa Cruz (Santa Cruz, CA, USA).

Cell culture
Human A549 cells (American Type Culture Collection, Manassas, VA, USA; CCL 185) expressing the wild-type (WT)-rat-Na,K-ATPase-{alpha}1-subunit ({alpha}1-A549) (6) , GFP-rat-Na,K-ATPase-{alpha}1-subunit (GFP{alpha}1-A549) (6) , S18A-rat-Na,K-ATPase-{alpha}1-subunit (S18A{alpha}1-A549) (6) , GFP-S18A-rat-Na,K-ATPase-{alpha}1-subunit (GFP-S18A{alpha}1-A549) and rat-Na,K-ATPase-{alpha}1-subunit-V5 ({alpha}1V5-A549) were grown in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin, and 3 µM ouabain to suppress the endogenous Na,K-ATPase {alpha}1 subunit. Cells were incubated in a humidified atmosphere of 5% CO2/95% air at 37°C. The {alpha}1V5-A549 was generated by polymerase chain reaction (PCR) amplification of the rat {alpha}1 sequence from pCMVouabain vector (BD PharMingen; San Jose, CA, USA) [Forward primer: CACCATGGGGAAGGGG GTT GGA CG and Reverse primer: GTAGTAGGT TTCCTTCTCCAC]. The PCR product was gel purified using a DNA Extraction Kit (Stratagene, La Jolla, CA, USA), and the purified product was then used in a TOPO Cloning reaction (pLenti6/V5 D-TOPO; Invitrogen, Carlsbad, CA, USA). Lentivirus was packaged in 293FT cells (Invitrogen), the supernatant containing the virus was harvested and used directly to infect A549 cells. The GFP-S18A{alpha}1 plasmid was generated with the QuikChange XL site-directed mutagenesis kit (Stratagene) [Forward primer: ATGGGGACAAGAAGGCCAAGAAG GCGAAGAA; Reverse primer: TTCTTCGCCTTCTTGGCCTTCTTGTCCCC A T] using the GFP{alpha}1 plasmid as template (31) .

Alveolar epithelial type II cells isolation and culture
ATII cells were isolated from pathogen-free male Sprague-Dawley rats (200–225 g) as described previously (32 , 33) . Briefly, the lungs were perfused via the pulmonary artery, lavaged, and digested with elastase (3 U/ml; Worthington Biochemical, Freehold, NJ, USA). ATII cells were purified by differential adherence to IgG-pretreated dishes, and cell viability was assessed by trypan blue exclusion (>95%). Cells were resuspended in DMEM containing 10% FBS with 2 mM glutamine, 100 U/ml penicillin, 0.25 µg/ml amphotericin B, and 100 µg/ml streptomycin. Cells were incubated in a humidified atmosphere of 5% CO2-95% air at 37°C. The day of isolation and plating is designated cultured day 0. All experimental conditions were tested in day 3 cells.

Immunoprecipitation
GFP{alpha}1-A549 or {alpha}1V5-A549 cells were incubated for the desired time with 10 µM dopamine (DA). The incubation was terminated by placing the cells on ice, aspirating the media, washing twice with ice-cold PBS, and adding immunoprecipitation buffer [20 mM Tris-HCl, 2 mM EGTA, 2 mM EDTA, 30 mM Na4P2O7, 30 mM NaF, 1 mM Na3VO4, 1 mM phenylmethylsulfonyl fluoride (PMSF), 100 µg/ml N-tosyl-L-phenylalanine chloromethyl ketone (TPCK), 10 µg/ml leupeptin (pH 7.4)]. The cells were then scraped from the plates, frozen in liquid nitrogen, thawed, sonicated, frozen again, and centrifuged for 2 min at 14,000 g. After protein determination, SDS, and Triton X-100 were added to each sample to a final concentration of 0.2% and 1%, respectively. Equal amounts of protein (700–1000 µg) were then incubated with anti-GFP or anti-V5 Ab for 2 h at 4°C. Protein A/G PLUS-Agarose was added, and the samples were incubated overnight at 4°C. The samples were then washed twice with immunoprecipitation buffer supplemented with 0.2% SDS and 1% Triton X-100 and once with 20 mM Tris-HCl (pH 7.4).

In vitro phosphorylation
The phosphorylation state of the immunoprecipitated Na,K-ATPase–GFP{alpha}1 subunit was assessed in vitro by the "back phosphorylation" method (6 , 34) . The standard reaction mixture for in vitro phosphorylation of the Na,K-ATPase {alpha}1 subunit by purified PKC (150 ng per 150 µl, 30 min at 30°C) contained 10 mM MgCl2, 0.25 mM EGTA, 0.4 mM CaCl2, 0.32 mg/ml L-{alpha}-phosphatidyl-L-serine, 0.03 mg/ml 1,2-dioleoyl-sn-glycerol (diacylglycerol), 0.1 mg/ml BSA, and 20 mM Tris-HCl (pH 7.5). The phosphorylation reaction was started by the addition of [{gamma} -32P]ATP (final concentration, 100 µM; 1.3 µCi per sample). The reaction was stopped by placing the tubes on ice and washing the beads twice with 20 mM Tris-HCl (pH 7.4). Samples were analyzed by SDS-polyacrylamide gel, transferred to nitrocellulose membranes, and autoradiographed.

In vitro dephosphorylation
The Na,K-ATPase {alpha}1-subunit was immunoprecipitated from {alpha}1V5-A549 cells and an in vitro phosphorylation was performed as above described. To perform the dephosphorylation reaction, the beads were resuspended into 100 µl phosphatase buffer (50 mM Tris-HCl, pH:7.5; 20 mM 2-mercaptoethanol; 2 mM MnCl2; and 0.1% BSA) and 0.4 U PP2A enzyme was added per condition. The reaction was performed at 30°C for 60 min, and the reaction was stopped by resuspending the beads in Laemmli’s sample buffer solution (35) . Samples were analyzed by SDS-polyacrylamide gel, transferred to nitrocellulose membranes and autoradiographed.

Biotinylation of cell surface proteins
Cells were treated with different agonists/inhibitors at 37°C, placed on ice, and washed twice with ice-cold PBS, and surface proteins were labeled for 1 h using 1 mg/ml EZ-link NHS-SS-biotin (Pierce Chemical Co., Rockford, IL, USA) as described before (30) . After labeling, the cells were rinsed three times with PBS containing 100 mM glycine to quench unreacted biotin and then lysed in modified radio-immuno-precipitation assay (RIPA) buffer (50 mM Tris-HCl, pH 8; 150 mM NaCl; 1% Nonidet P-40 and 1% sodium deoxycholate; 10 µg/ml leupeptin; 100 µg/ml TPCK; and 1 mM PMSF). Proteins (150–300 µg) were incubated overnight at 4°C with end-over-end shaking in the presence of Streptavidin beads (Pierce Chemical Co.). Beads were thoroughly washed, resuspended in 30 µl of Laemmli’s sample buffer solution (35) , and analyzed by Western blot.

Coimmunoprecipitation
GFP{alpha}1-A549 or GFP-S18A{alpha}1-A549 cells were incubated for the desire time with 10 µM DA. The incubation was terminated by placing the cells on ice, aspirating the media, washing twice with ice-cold PBS and adding lysis buffer (50 mM Tris; 150 mM NaCl; 2 mM EDTA; 2 mM EGTA; 1% Triton X-100; 2 mM Na3VO4; 30 mM Na4P2O7; 30 mM NaF; 10 µg/ml leupeptin; 100 µg/ml TPCK; and 1 mM PMSF, pH 7.45). The cells were scraped from the plates, and cell lysates were centrifuged for 5 min at 20,000 g. Equal amounts of protein (500–1000 µg) were then incubated with anti-GFP Ab over night at 4°C. Protein A/G PLUS-Agarose was added, and the samples were incubated for 2 h at 4°C. The samples were then washed three times with lysis buffer, and beads were resuspended in Laemmli’s sample buffer solution (35) . Samples were analyzed by SDS-polyacrylamide gel and transferred to nitrocellulose membranes, and a Western blot was performed.

Western blot analysis
Protein was quantified by Bradford assay (36) (Bio-Rad, Hercules, CA, USA) and resolved in 10–15% polyacrylamide gels (SDS-PAGE). Thereafter, proteins were transferred onto nitrocellulose membranes (Optitran, Schleider & Schuell, Keene, NH, USA) using a semidry transfer apparatus (Bio-Rad). Incubation with specific antibodies was performed overnight at 4°C. When more than one primary Ab was used in the same membrane, blots were stripped by incubating 1 h at 55°C in stripping solution (62.5 mM Tris-HCl; 2% SDS; 100 mM 2-mercaptoethanol, pH: 6.8). Blots were developed with a chemiluminescence detection kit (PerkinElmer Life Sciences, Boston, MA, USA) used as recommended by the manufacturer. The bands were quantified by densitometric scan (Image 1.29X, National Institutes of Health, Bethesda, MD, USA).

1% Triton X-100 or 1% Nonidet P-40 soluble fraction
Cells were treated with different agonists/inhibitors at 37°C, placed on ice, and washed twice with ice-cold PBS. Cells were scraped in homogenization buffer (1 mM EDTA; 1 mM EGTA; 10 mM Tris-HCl, pH: 7.5; 1 µg/ml leupeptin; 100 µg/ml TPCK; and 1 mM PMSF) and homogenized. Homogenates were centrifuged at 500 g to discard nuclei and debris, and the supernatant was centrifuged at 100,000 g, 1 h, 4°C (TL ultracentrifuge, Beckman, Rotor TLA 100.2). The pellet containing the crude membrane fraction was resuspended in homogenization buffer + 1% Triton X-100 (or 1% Nonidet P-40) and centrifuged at 100,000 g, 30 min, 4°C. The supernatant was considered as the 1% Triton X-100 (or 1% Nonidet P-40) soluble fraction.

GST pull-down assay
GST fusion proteins of the 6 different intracellular domains of the Na,K-ATPase {alpha}1-subunit were generated ( Fig. 4A ) (3 , 37) . In addition, a GST fusion protein of the first intracellular domain (1–90 amino acids) where the serine 18 has been mutated to an alanine was generated. The corresponding regions of rat Na,K-ATPase {alpha}1-subunit cDNA were amplified by PCR from pCMVouabain vector (or GFP-S18A{alpha}1 plasmid described above), subcloned into the pGEX-6P-3 vector (Amersham Biosciences, Uppsala, Sweden), and verified by sequencing. The fusion proteins were expressed in BL21 bacterial cells and purified by affinity chromatography with glutathione-Sepharose 4B (Amersham Biosciences), and correct size and expression were confirmed by Coomassie staining. GST fusion proteins and GST bound to glutathione-Sepharose beads (0.5 µg) were incubated with 1 mg A549 cells lysates (lysis buffer: 1 mM EDTA; 1 mM EGTA; 10 mM Tris-HCl, pH: 7.5, 1% Nonidet P-40, 1 µg/ml leupeptin, 100 µg/ml TPCK, and 1 mM PMSF), overnight at 4°C. Thereafter, the beads were washed three times with lysis buffer containing 0.3% Nonidet P-40, proteins were eluted by incubating for 5 min at room temperature in elution buffer (50 mM Tris-HCl; 10 mM reduced-glutathione (GSHv), pH 8.0; Amersham Biosciences). Loading buffer (6x) was added, and proteins were analyzed by SDS-PAGE. The amount of fusion protein in each experiment was confirmed by Ponceau staining.


Figure 1
View larger version (15K):
[in this window]
[in a new window]

  		Figure 1. GPCR agonists induce Na,K-ATPase {alpha}1-subunit dephosphorylation at Ser-18, which is necessary for its recruitment to the plasma membrane. A) In vitro backphosphorylation assay performed on the immunoprecipitated Na,K-ATPase {alpha}1-subunit from GFP{alpha}1-A549 (wild-type) and GFP-S18A{alpha}1-A549 (S18A) cells exposed for 0 and 5 min to 10 µM dopamine. Upper panel) Shows a representative autoradiography. Lower panel) Depicts a representative Western blot (n=3). B) ATII cells were exposed for the indicated times to 10 µM dopamine, the 1% Triton X-100 soluble fraction was isolated and V Sec-18 phosphorylation was studied using the Mck1 Ab (upper panel). Equal loading was demonstrated by stripping the membrane and probing with another Ab against the Na,K-ATPase {alpha}1-subunit (lower panel). Graph represents the mean ± SEM of five different experiments. C) ATII cells were exposed for the indicated times to 10 µM dopamine, and the amount of Na,K-ATPase abundance at the plasma membrane was studied by biotin-streptavidin pull-down and subsequent Western blot. Graph represents the mean ± SEM of four different experiments. D) The amount of Na,K-ATPase abundance at the plasma membrane, after exposure to 10 µM dopamine for 5 min, was studied by biotin-streptavidin pull-down and subsequent Western blot in control cells and cells expressing the S18A mutation. Graph represents the mean ± SEM of three different experiments DA: dopamine; i.b.: immunoblot; i.p.: immunoprecipitation. *P < 0.05.


Figure 2
View larger version (12K):
[in this window]
[in a new window]

  		Figure 2. Dephosphorylation of Na,K-ATPase {alpha}1-subunit at Ser-18 by PP2A is necessary for its recruitment to the plasma membrane. A) In vitro backphosphorylation assay performed on the immunoprecipitated Na,K-ATPase {alpha}1-subunit from {alpha}1V5-A549 cells exposed for 5 min to 10 µM dopamine in the presence or absence of 5 nM OA. Upper panel) Shows a representative autoradiography. Lower panel) Depicts a representative Western blot. Graph represents the mean ± SEM of three different experiments. B) ATII cells were exposed for 5 min to 10 µM dopamine in the presence or absence of 5 nM OA, the 1% Triton X-100 soluble fraction was isolated, and S18 phosphorylation was studied using the Mck1 Ab (upper panel). Equal loading was demonstrated by stripping the membrane and probing with another Ab against the Na,K-ATPase {alpha}1-subunit (lower panel). Graph represents the mean ± SEM of three different experiments. C) ATII cells were exposed for 5 min to 10 µM dopamine in the presence or absence of 5 nM OA, and the amount of Na,K-ATPase abundance at the plasma membrane was studied by biotin-streptavidin pull down and subsequent Western blot. Graph represents the mean ± SEM of three different experiments DA: dopamine; OA: OA; i.b.: immunoblot; i.p.: immunoprecipitation. *P < 0.05; **P < 0.01.


Figure 3
View larger version (14K):
[in this window]
[in a new window]

  		Figure 3. The Na,K-ATPase {alpha}1-subunit is a substrate for PP2A. The Na,K-ATPase {alpha}1-subunit from {alpha}1V5-A549 cells was immunoprecipitated and phosphorylated with PKC in an in vitro phosphorylation assay. An in vitro dephosphorylation assay was later performed using purified PP2A. Upper panel) Shows a representative autoradiography. Lower panel) Depicts a representative Western blot. i.b.: immunoblot; i.p.: immunoprecipitation.


Figure 4
View larger version (29K):
[in this window]
[in a new window]

  		Figure 4. Direct interaction between the Na,K-ATPase {alpha}1-subunit and the catalytic subunit of PP2A. A) GST-fusion proteins were generated for the 6 intracellular domains of the Na,K-ATPase {alpha}1-subunit. Fusion proteins were induced in BL21 cells, purified by pull-down with gluthation-bound agarose beads, and correct size and purity were analyzed by PAGE and Coomasie blue staining. Upper panel) Shows a schematic representation of the different GST-fusion proteins. Lower panel) Depicts a Coomasie blue stained gel. B) Ponceau staining (upper panel) or Western blot using an Ab against the catalytic subunit of PP2A (lower panel) of 1 mg cell lysate pulled down with 0.5 µg of GST, 0.5 µg GST-{alpha}1 comprising the first 90 amino acids of the Na,K-ATPase {alpha}1-subunit ({alpha}1 (1–90), or with 0.5 µg GST-{alpha}1 comprising the first 90 amino acids of the Na,K-ATPase {alpha}1-subunit with the Ser-18 mutated to an alanine [S18A-{alpha}1 (1–90)]. Control (CT): same as the pull-down with {alpha}1 (1–90), but without cell lysate.

Immunofluorescence
GFP{alpha}1-A549 cells were fixed in 2% formaldehyde for 7 min, permeabilized with 0.1% Triton X-100, and incubated for 30 min at 37°C with Ab against the catalytic subunit of PP2A (PP2Ac) and mounted using Gelvatol in PBS. Cellular distribution of Na,K-ATPase-GFP{alpha}1 and PP2Ac was analyzed by direct fluorescence using a Zeiss LSM 510 laser-scanning confocal microscope (objective Plan Apochromat, x63/1.4 oil) (Zeiss, Heidelberg, Germany). Cross sections were generated with a 0.2 µm motor step. Contrast and brightness settings were adjusted so that all pixels were in the linear range.

Statistical analysis
Data are represented as means ± SEM. Multiple comparisons were made using a one-way ANOVA followed by a multiple comparison test (Dunnett) when the F statistic indicated significance. Results were considered significant when P < 0.05.

RESULTS

G-protein coupled-receptor agonists promote Na,K-ATPase {alpha}1-subunit dephosphorylation in alveolar epithelial cells
To determine whether the GPCR agonist dopamine (DA) modified the phosphorylation status of the Na,K-ATPase, we incubated A549 cells expressing the rat Na,K-ATPase {alpha}1-subunit with a GFP tag (GFP{alpha}1-A549) with 10 µM DA for 5 min. The Na,K-ATPase {alpha}1 subunit was immunoprecipitated and subjected to an in vitro phosphorylation reaction with purified PKC and [{gamma} -32P]ATP. Proteins that were phosphorylated in the intact cell should not incorporate 32P, because they cannot be further phosphorylated in vitro. Conversely, proteins that were not phosphorylated in the intact cell can then be phosphorylated in the in vitro reaction. As shown in Fig. 1 A, more 32P-labeled phosphate was incorporated into the Na,K-ATPase {alpha}1 subunit during the in vitro phosphorylation in cells treated with dopamine than in control cells, suggesting that GPCR agonists (i.e., dopamine) promote the dephosphorylation of the Na,K-ATPase {alpha}1-subunit in alveolar epithelial cells.

Dephosphorylation of the Na,K-ATPase {alpha}1-subunit occurs at the serine 18 residue
The phosphorylation of the serine residue at the position 18 (Ser-18) in the Na,K-ATPase {alpha}1-subunit has been involved in the endocytosis of the Na,K-ATPase (6 , 34) . To determine whether this residue was dephosphorylated by dopamine in AEC, we used a cell line expressing the rat Na,K-ATPase {alpha}1-subunit where the serine in position 18 was mutated to alanine (S18A). As shown in Fig. 1A , Ser-18 represents the main phosphorylation site in the Na,K-ATPase {alpha}1-subunit, making it not possible to study the phosphorylation-dephosphorylation of this residue by a backphosphorylation technique. Therefore, the phosphorylation at Ser-18 was studied using the Ab-based assay described by Feschenko and Sweadner, using the mAb Mck1 that binds the amino acid sequence DKKS18KK only when Ser-18 is unphosphorylated (38) . We found that dopamine increased the binding of the Mck1 Ab after 1 and 5 min of incubation, suggesting dephosphorylation of the Na,K-ATPase {alpha}1-subunit at Ser-18 (Fig. 1B ). The increased dephosphorylation of the Na,K-ATPase {alpha}1-subunit was paralleled by increased Na,K-ATPase recruitment to the plasma membrane as shown in Fig. 1C . To further determine whether dephosphorylation at Ser-18 was important for the Na,K-ATPase recruitment, cells expressing the S18A mutant were incubated with 10 µM DA for 5 min and as shown on Fig. 1D , these cells behaved as activated forms, not needing stimulation to have increased Na,K-ATPase protein abundance at the plasma membrane. These data suggest that dephosphorylation of Ser-18 in the Na,K-ATPase {alpha}1-subunit is necessary for the DA-mediated translocation from intracellular compartments to the plasma membrane.

Protein phosphatase 2A dephosphorylates the Na,K-ATPase {alpha}1-subunit at Ser-18
Figure 2 A, B shows that preincubation with 5 nM OA prevented the DA-mediated dephosphorylation of the Na,K-ATPase {alpha}1 subunit by two different methods: backphosphorylation (Fig. 2A ) and Mck1 Ab binding (Fig. 2B ), suggesting a role for PP2A. The prevention of dephosphorylation by OA paralleled the inhibition of the DA-mediated recruitment of the Na,K-ATPase to the plasma membrane (Fig. 2C ). Taken together these data suggest that dephosphorylation of Ser-18 by PP2A is necessary for DA-induced translocation of the Na,K-ATPase to the plasma membrane.

The Na,K-ATPase is a substrate for PP2A in vitro
To further determine whether the Na,K-ATPase {alpha}1-subunit is a substrate for PP2A, Na,K-ATPase {alpha}1-subunit immunoprecipitates where subjected to in vitro kinase assay followed by in vitro phosphatase assay. Figure 3 depicts that recombinant PP2A dephosphorylated the Na,K-ATPase {alpha}1-subunit after 60 min incubation at 30°C. These data suggest that the Na,K-ATPase {alpha}1-subunit is a substrate for PP2A phosphatase activity and that PP2A may regulate the phosphorylation state of Na,K-ATPase {alpha}1-subunit in vivo.

PP2A catalytic subunit interacts directly with the N–terminus of the Na,K-ATPase {alpha}1-subunit
To determine whether PP2A interacts with the Na,K-ATPase {alpha}1-subunit, we performed in vitro GST pull-down assays. We generated GST-fusion proteins containing the six intracellular domains of the rat Na,K-ATPase {alpha}1-subunit and incubated them with 1 mg of A549 cell lysate. The complexes were pulled down with glutathione-sepharose beads and analyzed by Western blot using an Ab against the catalytic subunit of PP2A. As shown in Fig. 4 , the catalytic subunit of PP2A was pulled down with the GST fusion protein that contained the first 90 amino acids of the Na,K-ATPase {alpha}1-subunit, but it wasn’t recovered in the pull downs performed with the other GST-fusion proteins (data not shown) nor with GST alone (Fig. 4B ). Mutation of Ser-18 to alanine did not affect the PP2Ac binding to the first intracellular domain of the Na,K-ATPase {alpha}1-subunit (Fig. 4B ). The first 90 amino acids of the Na,K-ATPase {alpha}1-subunit seem to be necessary for the interaction with the catalytic subunit of PP2A, as GST-fusion proteins containing smaller sections (30 and 45 amino acids) failed to pulled down PP2A (data not shown).

GPCR agonists promote PP2A translocation from the cytosol to the membrane fraction and its coimmunoprecipitation and colocalization with the Na,K-ATPase
To study whether GPCR agonists induced the translocation of PP2A to a membrane compartment, ATII cells were incubated with DA for 15, 30, and 60 s; the 1% Nonidet P-40 soluble fraction was isolated, and the amount of PP2A was studied by Western blot analysis using a specific Ab. Figure 5 A shows that DA-mediated translocation of PP2A to the membrane compartment occurred within 15 s. To determine whether the Na,K-ATPase {alpha}1-subunit and the catalytic subunit of PP2A interact in vivo, GFP{alpha}1-A549 cells were incubated for 15 s with DA and a coimmunoprecipitation assay was performed. Cell lysates were immunoprecipiated using an anti-GFP Ab and a Western blot using a specific Ab against the catalytic subunit of PP2A was performed. As shown in Fig. 5B , PP2Ac and the Na,K-ATPase {alpha}1-subunit coimmunoprecipiated together, and, moreover, DA treatment increased the amount of PP2Ac recovered. Mutation of the Ser-18 to alanine in the Na,K-ATPase {alpha}1-subunit prevented the increased recovery of PP2Ac after DA treatment (Fig. 5B ). We also observed, by using confocal microscopy, that the catalytic subunit of PP2A and the Na,K-ATPase {alpha}1-subunit colocalized, colocalization that increased after 15 s of incubation with DA in GFP{alpha}1-A549 cells (Fig. 6 ).


Figure 5
View larger version (16K):
[in this window]
[in a new window]

  		Figure 5. GPCR agonists induce the translocation of PP2A to the membrane fraction and its coimmunoprecipitation with the Na,K-ATPase {alpha}1-subunit. A) ATII cells were incubated with 10 µM dopamine for the indicated times, 1% Nonidet P-40 soluble fraction was isolated and a Western blot using an Ab against the catalytic subunit of PP2A was performed. Upper panel) Shows a composite graph of four different experiments. Lower panel) Depicts a representative Western blot. B) GFP{alpha}1-A549 and GFP-S18A{alpha}1-A549 cells were exposed for 0 and 15 s to 10 µM dopamine. An immunoprecipitation with and anti-GFP Ab and Western blot against PP2Ac were performed (upper panel). Equal loading was confirmed stripping the membrane and performing a Western blot against GFP (lower panel). DA: dopamine; i.b.: immunoblot. *P < 0.05.


Figure 6
View larger version (64K):
[in this window]
[in a new window]

  		Figure 6. PP2A and the Na,K-ATPase colocalize after GPCR stimulation. GFP{alpha}1-A549 cells were grown in coverslips and incubated with 10 µM dopamine for 15 s before fixed with 2% formaldehyde. Immunostaining was performed with an Ab against the catalytic subunit of PP2A. Arrows show colocalization.

DISCUSSION

The phosphorylation-dephosphorylation of many proteins may determine their sorting and trafficking into the different membrane organelles of the cells (39 40 41) . This is the case for the Na,K-ATPase, where regulation by phosphorylation-dephosphorylation has been proposed as a mechanism for its trafficking to and from the plasma membrane (10 , 42) . Here, we describe that dephosphorylation of the Na,K-ATPase {alpha}1-subunit at the Ser-18 residue by PP2A is necessary for its recruitment from intracellular compartments to the plasma membrane. Moreover, we provide evidence for a direct interaction between PP2A and the Na,K-ATPase {alpha}1-subunit, which occurs within the first 90 amino acids of the N terminus.

Dopamine stimulation represents one of the paradoxes in Na,K-ATPase regulation in different tissues. In the kidney, dopamine inhibits Na,K-ATPase, which results in natriuresis due to decreased Na+ reabsorption by the proximal and distal tubules (43) . In contrast, dopamine stimulates Na,K-ATPase activity in the alveolar epithelium, leading to increased edema clearance (10 , 22 , 44) . Inhibition of Na,K-ATPase activity by dopamine occurs via endocytosis of the Na,K-ATPase from the plasma membrane and the sequential internalization into endosomal compartments via a clathrin-coated vesicle-dependent mechanism (12) . This process, initiated at the plasma membrane, requires phosphorylation of the Ser-18 residue within the catalytic {alpha}1-subunit (13 , 34) . However, in the alveolar epithelium, DA increases lung edema clearance and Na,K-ATPase activity by promoting recruitment of Na,K-ATPases from intracellular compartments to the plasma membrane via pathways involving the {delta}- and {epsilon}- isoforms of PKC and PP2A (15 , 23 , 29) .

Here, we provide evidence that the Na,K-ATPase {alpha}1-subunit is dephosphorylated after GPCR agonists treatment and that dephosphorylation is necessary for its recruitment into the plasma membrane. Dephosphorylation was demonstrated by two approaches: 1) we used a backphosphorylation technique (6 , 34) , and 2) an Ab-based assay (17 , 38 , 45 , 46) . The combination of both approaches allowed us not only to demonstrate the GPCR agonists mediated the dephosphorylation of the Na,K-ATPase {alpha}1-subunit but also to focus on the Ser-18 residue. It has been described that at steady-state conditions there is a certain level of phosphorylation at Ser residues (47) and in particular at the Ser-18 residue (17 , 45) , and using a construct with the Ser-18 mutated to an alanine, we effectively demonstrated its dephosphorylation after GPCR stimulation (see Fig. 1 ).

We found that dephosphorylation of the Na,K-ATPase {alpha}1-subunit at Ser-18 was necessary for recruitment of the Na,K-ATPase to the plasma membrane. Sweeney et al. reported that in HEK-293 cells overexpressing a rat Na,K-ATPase {alpha}1-subunit, the magnitude of the insulin-dependent dephosphorylation of the {alpha}1-subunit (30%) correlated with the gain in surface exposure of this protein (17) . The relationship between dephosphorylation of the {alpha}1-subunit and Na,K-ATPase recruitment has been also suggested in RCCD2 cells (48) .

Several protein phosphatases have been shown to regulate Na,K-ATPase activity: calcineurin (49 , 50) , protein phosphatase type1 (PP1) (16) , and PP2A (14 , 15) . Two of them, PP1 and calcineurin, have been shown to dephosphorylate the Na,K-ATPase {alpha}1-subunit (16 , 45) . PP2A has been involved in the regulation of the Na,K-ATPase activity and traffic, and we are now providing first evidence of the direct dephosphorylation of the Na,K-ATPase {alpha}1-subunit. We determined that PP2A is important for the dephosphorylation and trafficking of the Na,K-ATPase (Fig. 2) . Moreover, performing an in vitro dephosphorylation assay we demonstrated that the Na,K-ATPase {alpha}1-subunit is a substrate for PP2A.

PP2A is often found in complexes with its substrates and an array of proteins have been described to be directly associated with the phosphatase (51 52 53) . We performed GST-binding assays by generating six constructs with different intracellular domains of the Na,K-ATPase {alpha}1-subunit and found a direct interaction of the catalytic subunit of PP2A and the first 90 amino acids of the {alpha}1-subunit (Fig. 4) . This finding is in agreement with a recent report where the PP2A catalytic subunit was identified by two hybrid screen as a candidate interacting protein with the Na,K-ATPase {alpha}1-subunit (54) . It is interesting that the interaction with PP2A occurred at the N terminus of the {alpha}1-subunit as this intracellular domain seems to be essential for binding of enzymes involved in the regulation of the Na,K-ATPase trafficking such as phosphatidyl-inositol 3-kinase (55) .

We did not find Ser-18 to be necessary for the in vitro binding of the catalytic subunit of PP2A and the N terminus of the Na,K-ATPase {alpha}1-subunit (see Fig. 4 ). However, it was necessary for their in vivo interaction as we were unable to find increased interaction of PP2Ac and the Na,K-ATPase {alpha}1-subunit in the coimmunoprecipitation assays when a cell expressing the S18A mutation was used, suggesting that phosphorylation of Ser-18 is necessary for PP2A binding during GPCR agonists stimulation.

It has been suggested that PP2A can be rapidly translocated to the membrane fraction after stimulation (56 , 57) . Concordant with these reports was our observation of a rapid translocation of PP2A to the membrane fraction in alveolar epithelial cells that resulted in an increased colocalization of PP2A and the Na,K-ATPase within 15 s of incubation.

In sum, we present evidence that Na,K-ATPase recruitment to the cell plasma membrane is regulated by dephosphorylation of the Na,K-ATPase {alpha}1-subunit at the serine 18 residue by PP2A and that there is a direct interaction between them. We propose a model in where GPCR stimulation in alveolar epithelial cells induces the translocation and activation of PP2A to membrane compartments where it interacts with the Na,K-ATPase {alpha}1-subunit, dephosphorylating it, and triggering the recruitment to the plasma membrane, which results in increased Na,K-ATPase function.

ACKNOWLEDGMENTS

We kindly acknowledge Drs. A. Ciechanover and K. Rundell for valuable discussion and suggestions and the Cell Culture and Physiology Core for providing rat ATII cells. We thank Dr. A. Bertorello for providing the GFP{alpha}1 construct.This work has been supported in part by HL48129 and HL65161.

Received for publication May 16, 2006. Accepted for publication July 11, 2006.

REFERENCES

  1. Sznajder, J. I., Factor, P., Ingbar, D. H. (2002) Lung edema clearance: role of Na+-K+-ATPase. J. Appl. Physiol. 93,1860-1866[Abstract/Free Full Text]
  2. Jorgensen, P. L., Hakansson, K. O., Karlish, S. J. (2003) Structure and mechanism of Na,K-ATPase: functional sites and their interactions. Annu. Rev. Physiol. 65,817-849[CrossRef][Medline]
  3. Blanco, G., Mercer, R. W. (1998) Isozymes of the Na-K-ATPase: heterogeneity in structure, diversity in function. Am. J. Physiol. 275,F633-F650
  4. Therien, A. G., Blostein, R. (2000) Mechanisms of sodium pump regulation. Am. J. Physiol. Cell Physiol. 279,C541-C566[Abstract/Free Full Text]
  5. Dunbar, L. A., Caplan, M. J. (2001) Ion pumps in polarized cells: sorting and regulation of the Na+,K+- and H+,K+-ATPases. J. Biol. Chem. 276,29617-29620[Abstract/Free Full Text]
  6. Dada, L. A., Chandel, N. S., Ridge, K. M., Pedemonte, C., Bertorello, A. M., Sznajder, J. I. (2003) Hypoxia-induced endocytosis of Na,K-ATPase in alveolar epithelial cells is mediated by mitochondrial reactive oxygen species and PKC{zeta}. J. Clin. Invest. 111,1057-1064[CrossRef][Medline]
  7. Clausen, T. (2003) Na+-K+ Pump regulation and skeletal muscle contractility. Physiol. Rev. 83,1269-1324[Abstract/Free Full Text]
  8. Ewart, H. S., Klip, A. (1995) Hormonal regulation of the Na+-K+-ATPase: mechanisms underlying rapid and sustained changes in pump activity. Am. J. Physiol. 269,C295-C311
  9. Teixeira, V. L., Katz, A. I., Pedemonte, C. H., Bertorello, A. M. (2003) Isoform-specific regulation of Na+,K+-ATPase endocytosis and recruitment to the plasma membrane. Ann. N. Y. Acad. Sci. 986,587-594[Abstract/Free Full Text]
  10. Bertorello, A., Sznajder, J. I. (2005) The dopamine paradox in lung and kidney epithelia. Sharing the same target but operating different signaling networks. Am. J. Respir. Cell Mol. Biol. 33,432-437[Abstract/Free Full Text]
  11. Pedemonte, C. H., Efendiev, R., Bertorello, A. (2005) Inhibition of Na,K-ATPase by Dopamine in Proximal Tubule Epithelial Cells. Semin. Nephrol. 25,322-327[CrossRef][Medline]
  12. Chibalin, A. V., Katz, A. I., Berggren, P. O., Bertorello, A. M. (1997) Receptor-mediated inhibition of renal Na+-K+-ATPase is associated with endocytosis of its {alpha}- and ß-subunits. Am. J. Physiol. 273,C1458-C1465
  13. Chibalin, A. V., Pedemonte, C. H., Katz, A. I., Feraille, E., Berggren, P. O., Bertorello, A. M. (1998) Phosphorylation of the catalytic {alpha}-subunit constitutes a triggering signal for Na+,K+-ATPase endocytosis. J. Biol. Chem. 273,8814-8819[Abstract/Free Full Text]
  14. Blot-Chabaud, M., Country, N., Laplace, M., Bonvalet, J. P., Farman, N. (1996) Role of protein phosphatase in the regulation of Na+-K+-ATPase by vasopressin in the cortical collecting duct. J. Membr. Biol. 153,233-239[CrossRef][Medline]
  15. Lecuona, E., Garcia, A., Sznajder, J. I. (2000) A novel role for protein phosphatase 2A in the dopaminergic regulation of Na,K-ATPase. FEBS Lett. 481,217-220[CrossRef][Medline]
  16. Ragolia, L., Cherpalis, B., Srinivasan, M., Begum, N. (1997) Role of serine/threonine protein phosphatases in insulin regulation of Na+/K+-ATPase activity in cultured rat skeletal muscle cells. J. Biol. Chem. 272,23653-23658[Abstract/Free Full Text]
  17. Sweeney, G., Niu, W., Canfield, V. A., Levenson, R., Klip, A. (2001) Insulin increases plasma membrane content and reduces phosphorylation of Na+-K+ pump {alpha}1-subunit in HEK-293 cells. Am. J. Physiol. Cell Physiol. 281,C1797-C1803[Abstract/Free Full Text]
  18. Sontag, E. (2001) Protein phosphatase 2A: the Trojan Horse of cellular signaling. Cell. Signal 13,7-16[CrossRef][Medline]
  19. Janssens, V., Goris, J., Van Hoof, C. (2005) PP2A: the expected tumor suppressor. Curr. Opin. Genet. Dev. 15,34-41[CrossRef][Medline]
  20. Zolnierowicz, S. (2000) Type 2A protein phosphatase, the complex regulator of numerous signaling pathways. Biochem. Pharmacol. 60,1225-1235[CrossRef][Medline]
  21. Mumby, M. C., Walter, G. (1993) Protein serine/threonine phosphatases: structure, regulation, and functions in cell growth. Physiol. Rev. 73,673-699[Abstract/Free Full Text]
  22. Barnard, M. L., Olivera, W. G., Rutschman, D. M., Bertorello, A. M., Katz, A. I., Sznajder, J. I. (1997) Dopamine stimulates sodium transport and liquid clearance in rat lung epithelium. Am. J. Respir. Crit. Care Med. 156,709-714[Abstract/Free Full Text]
  23. Barnard, M. L., Ridge, K. M., Saldias, F., Friedman, E., Gare, M., Guerrero, C., Lecuona, E., Bertorello, A. M., Katz, A. I., Sznajder, J. I. (1999) Stimulation of the dopamine 1 receptor increases lung edema clearance. Am. J. Respir. Crit. Care Med. 160,982-986[Abstract/Free Full Text]
  24. Saldias, F. J., Lecuona, E., Comellas, A. P., Ridge, K. M., Sznajder, J. I. (1999) Dopamine restores lung ability to clear edema in rats exposed to hyperoxia. Am. J. Respir. Crit. Care Med. 159,626-633[Abstract/Free Full Text]
  25. Saldias, F. J., Comellas, A. P., Pesce, L., Lecuona, E., Sznajder, J. I. (2002) Dopamine increases lung liquid clearance during mechanical ventilation. Am. J. Physiol. Lung Cell Mol. Physiol. 283,L136-L143[Abstract/Free Full Text]
  26. Groshaus, H. E., Manocha, S., Walley, K. R., Russell, J. A. (2004) Mechanisms of ß-receptor stimulation-induced improvement of acute lung injury and pulmonary edema. Crit. Care 8,234-242[CrossRef][Medline]
  27. McAuley, D. F., Frank, J. A., Fang, X., Matthay, M. A. (2004) Clinically relevant concentrations of ß 2-adrenergic agonists stimulate maximal cyclic adenosine monophosphate-dependent airspace fluid clearance and decrease pulmonary edema in experimental acid-induced lung injury. Crit. Care Med. 32,1470-1476[CrossRef][Medline]
  28. Bertorello, A. M., Ridge, K. M., Chibalin, A. V., Katz, A. I., Sznajder, J. I. (1999) Isoproterenol increases Na+-K+-ATPase activity by membrane insertion of {alpha} -subunits in lung alveolar cells. Am. J. Physiol. 276,L20-L27
  29. Ridge, K. M., Dada, L., Lecuona, E., Bertorello, A. M., Katz, A. I., Mochly-Rosen, D., Sznajder, J. I. (2002) Dopamine-induced Exocytosis of Na,K-ATPase is dependent on activation of protein kinase C-{epsilon} and -{delta}. Mol. Biol. Cell. 13,1381-1389[Abstract/Free Full Text]
  30. Lecuona, E., Ridge, K., Pesce, L., Batlle, D., Sznajder, J. I. (2003) The GTP-binding protein RhoA mediates Na,K-ATPase exocytosis in alveolar epithelial cells. Mol. Biol. Cell. 14,3888-3897[Abstract/Free Full Text]
  31. Bertorello, A. M., Komarova, Y., Smith, K., Leibiger, I. B., Efendiev, R., Pedemonte, C. H., Borisy, G., Sznajder, J. I. (2003) Analysis of Na+,K+-ATPase motion and incorporation into the plasma membrane in response to G protein-coupled receptor signals in living cells. Mol. Biol. Cell. 14,1149-1157[Abstract/Free Full Text]
  32. Ridge, K., Rutschman, D., Factor, P., Katz, A., Bertorello, A., Sznajder, J. (1997) Differential expression of Na-K-ATPase isoforms in rat alveolar epithelial cells. Am. J. Physiol. 273,L246-L255
  33. Correa-Meyer, E., Pesce, L., Guerrero, C., Sznajder, J. I. (2002) Mechanotransduction in the lung: cyclic stretch activates ERK1/2 via G proteins and EGFR in alveolar epithelial cells. Am. J. Physiol. Lung Cell Mol Physiol. 282,L883-L891[Abstract/Free Full Text]
  34. Chibalin, A. V., Ogimoto, G., Pedemonte, C. H., Pressley, T. A., Katz, A. I., Feraille, E., Berggren, P. O., Bertorello, A. M. (1999) Dopamine-induced endocytosis of Na+,K+-ATPase is initiated by phosphorylation of Ser-18 in the rat {alpha} subunit and is responsible for the decreased activity in epithelial cells. J. Biol. Chem. 274,1920-1927[Abstract/Free Full Text]
  35. Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227,680-685[CrossRef][Medline]
  36. Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of microgram quantities of proteins utilizing the principle of protein-dye binding. Anal. Biochem. 72,248-254[CrossRef][Medline]
  37. Lutsenko, S., Kaplan, J. H. (1995) Organization of P-type ATPases: significance of structural diversity. Biochemistry 34,15607-15613[CrossRef][Medline]
  38. Feschenko, M. S., Sweadner, K. J. (1997) Phosphorylation of Na,K-ATPase by protein kinase C at Ser 18 occurs in intact cells but does not result in direct inhibition of ATP hydrolysis. J. Biol. Chem. 272,17726-17733[Abstract/Free Full Text]
  39. Morgan, A., Burgoyne, R. D. (2004) Membrane Traffic: Controlling Membrane Fusion by Modifying NSF. Curr. Biol. 14,R968-R970[CrossRef][Medline]
  40. Schapiro, F. B., Soe, T. T., Mallet, W. G., Maxfield, F. R. (2004) Role of cytoplasmic domain serines in intracellular trafficking of Furin. Mol. Biol. Cell. 15,2884-2894[Abstract/Free Full Text]
  41. Fiset, A., Faure, R. (2001) Checkpoints for vesicular traffic?. Biochem. Cell Biol. 79,579-585[CrossRef][Medline]
  42. Pedemonte, C. H., Bertorello, A. M. (2001) Short-term regulation of the proximal tubule Na+,K+-ATPase: increased/decreased Na+,K+-ATPase activity mediated by protein kinase C isoforms. J. Bioenerget. Biomem. 33,439-447[CrossRef][Medline]
  43. Brismar, H., Holtbäck, U., Aperia, A. (2000) Mechanisms by which intrarenal dopamine and ANP interact to regulate sodium metabolism. Clin. Exper. Hypertens. 22,303-307
  44. Adir, Y., Sznajder, J. (2003) Regulation of lung edema clearance by dopamine. Isr. Med. Assoc. J. 5,47-50[Medline]
  45. Ibarra, F. R., Cheng, S. X., Agren, M., Svensson, L. B., Aizman, O., Aperia, A. (2002) Intracellular sodium modulates the state of protein kinase C phosphorylation of rat proximal tubule Na+,K+-ATPase. Acta Physiol. Scand. 175,165-171[CrossRef][Medline]
  46. Bertuccio, C. A., Cheng, S. X., Arrizurieta, E. E., Martin, R. S., Ibarra, F. R. (2003) Mechanisms of Na+-K+-ATPase phosphorylation by PKC in the medullary thick ascending limb of Henle in the rat. Pflugers Arch 447,87-96[CrossRef][Medline]
  47. Chibalin, A. V., Kovalenko, M. V., Ryder, J. W., Feraille, E., Wallberg-Henriksson, H., Zierath, J. R. (2001) Insulin- and glucose-induced phosphorylation of the Na+,K+-adenosine triphosphatase {alpha}-subunits in rat skeletal muscle. Endocrinology 142,3474-3482[Abstract/Free Full Text]
  48. Djelidi, S., Beggah, A., Courtois-Country, N., Fay, M., Cluzeaud, F., Viengchareun, S., Bonvalet, J.-P., Farman, N., Blot-Chabaud, M. (2001) Basolateral translocation by vasopressin of the aldosterone-induced pool of latent Na-K-ATPases is accompanied by {alpha}1 subunit dephosphorylation: study in a new aldosterone-sensitive rat cortical collecting duct cell line. J. Am. Soc. Nephrol. 12,1805-1818[Abstract/Free Full Text]
  49. Aperia, A., Ibarra, F., Svensson, L.-B., Klee, C., Greengard, P. (1992) Calcineurin mediates a-adrenergic stimulation of Na+,K+-ATPase activity in renal tubule cells. Proc. Natl. Acad. Sci. U. S. A. 89,7394-7397[Abstract/Free Full Text]
  50. Mallick, B. N., Adya, H. V. A., Faisal, M. (2000) Norepinephrine-stimulated increase in Na+,K+-ATPase activity in the rat brain is mediated through {alpha}1A-adrenoceptor possibly by dephosphorylation of the enzyme. J. Neurochem. 74,1574-1578[CrossRef][Medline]
  51. Marmorstein, L. Y., McLaughlin, P. J., Stanton, J. B., Yan, L., Crabb, J. W., Marmorstein, A. D. (2002) Bestrophin interacts physically and functionally with protein phosphatase 2A. J. Biol. Chem. 277,30591-30597[Abstract/Free Full Text]
  52. Lu, Q., Surks, H. K., Ebling, H., Baur, W. E., Brown, D., Pallas, D. C., Karas, R. H. (2003) Regulation of estrogen receptor {alpha}-mediated transcription by a direct interaction with protein phosphatase 2A. J. Biol. Chem. 278,4639-4645[Abstract/Free Full Text]
  53. Vastiau, A., Cao, L., Jaspers, M., Owsianik, G., Janssens, V., Cuppens, H., Goris, J., Nilius, B., Cassiman, J.-J. (2005) Interaction of the protein phosphatase 2A with the regulatory domain of the cystic fibrosis transmembrane conductance regulator channel. FEBS Lett. 579,3392-3396[CrossRef][Medline]
  54. Pagel, P., Zatti, A., Kimura, T., Duffield, A., Chauvet, V., Rajendran, V., Caplan, M. J. (2003) Ion pump-interacting proteins: promising new partners. Ann. N. Y. Acad. Sci. 986,360-368[Abstract/Free Full Text]
  55. Yudowski, G. A., Efendiev, R., Pedemonte, C. H., Katz, A. I., Berggren, P. O., Bertorello, A. M. (2000) Phosphoinositide-3 kinase binds to a proline-rich motif in the Na+,K+-ATPase {alpha} subunit and regulates its trafficking. Proc. Natl. Acad. Sci. U. S. A. 97,6556-6561[Abstract/Free Full Text]
  56. Ludowyke, R. I., Holst, J., Mudge, L.-M., Sim, A. T. R. (2000) Transient translocation and activation of protein phosphatase 2A during mast cell secretion. J. Biol. Chem. 275,6144-6152[Abstract/Free Full Text]
  57. Holst, J., Sim, A. T. R., Ludowyke, R. I. (2002) Protein phosphatases 1 and 2A transiently associate with myosin during the peak rate of secretion from mast cells. Mol. Biol. Cell. 13,1083-1098[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 Proc. Natl. Acad. Sci. USAHome page
M. Sjostrom, K. Stenstrom, K. Eneling, J. Zwiller, A. I. Katz, H. Takemori, and A. M. Bertorello
SIK1 is part of a cell sodium-sensing network that regulates active sodium transport through a calcium-dependent process
PNAS, October 23, 2007; 104(43): 16922 - 16927.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Heart Circ. Physiol.Home page
N. Bhasin, S. R. Cunha, M. Mudannayake, M. S. Gigena, T. B. Rogers, and P. J. Mohler
Molecular basis for PP2A regulatory subunit B56{alpha} targeting in cardiomyocytes
Am J Physiol Heart Circ Physiol, July 1, 2007; 293(1): H109 - H119.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Summary
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
fj.06-6503fjev1
20/14/2618    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lecuona, E.
Right arrow Articles by Sznajder, J. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lecuona, E.
Right arrow Articles by Sznajder, J. I.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS