|
|
||||||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||



,
,
,
,
,1
Departments of
* Microbiology,
Biochemistry and Molecular Biology, and
Pharmacology, College of Medicine, and
Institute of Mental Health, Hanyang University, Seoul, Korea;
|| Department of Physiology, College of Medicine, Yonsei University, Seoul, Korea;
¶ Department of Physiology, College of Dentistry and Dental Research Institute, Seoul National University, Seoul, Korea; and
** Laboratory of Stem Cell and Tumor Biology, Neurosurgery and Developmental Biology, Sloan Kettering Cancer Institute, New York, New York, USA
1Correspondence: Department of Biochemistry and Molecular Biology, College of Medicine, Hanyang University, #17 Haengdang-dong, Sungdong-gu, Seoul 133791, Korea. E-mail: leesh{at}hanyang.ac.kr
ABSTRACT
Neural precursor cells provide an expandable source of neurons and glia for basic and translational applications. However, little progress has been made in directing naive neural precursors toward specific neuronal fates such as midbrain dopamine (DA) neurons. We have recently demonstrated that transgenic expression of the nuclear orphan receptor Nurr1 is sufficient to drive dopaminergic differentiation of forebrain embryonic rat neural precursors in vitro. However, Nurr1-induced DA neurons exhibit immature neuronal morphologies and functional properties and are unable to induce behavioral recovery in rodent models of Parkinsons disease (PD). Here, we report on the identification of key genetic factors that drive morphological and functional differentiation of Nurr1-derived DA neurons. We show that coexpression of Nurr1, Bcl-XL, and Sonic hedgehog (SHH) or Nurr1 and the proneural bHLH factor Mash1 is sufficient to drive naive rat forebrain precursors into neurons exhibiting the biochemical, electrophysiological, and functional properties of DA neuron in vitro. On transplantation into the striatum of Parkinsonian rats, precursor cells engineered with Nurr1/SHH/Bcl-XL or Nurr1/Mash1 survived in vivo and differentiated into mature DA neurons that can reverse the behavioral deficits in the grafted animals.Park, C.-H., Kang, J. S., Shin, Y. H., Chang, M.-Y., Chung, S., Koh, H.-C., Zhu, M. H., Oh, S. B., Lee, Y.-S., Panagiotakos, G., Tabar, V., Studer, L., and Lee, S.-H. Acquisition of in vitro and in vivo functionality of Nurr1-induced dopamine neurons.
Key Words: Parkinsons disease neural precursor cell transplantation dopaminergic differentiation dopamine neuron Bcl-XL Sonic hedgehog Mash1
NEURAL PRECURSORS ISOLATED from the embryonic central nervous system (CNS) can be proliferated in vitro and differentiated into various neuronal and glial subtypes in vitro and in vivo [for review, see (1)]. Studies on CNS precursor cells provide a valuable tool for probing brain development and for developing a renewable source of specialized neurons for cell replacement strategies. Parkinsons disease (PD) is a neurodegenerative disorder characterized by the progressive loss of midbrain dopamine (DA) neurons. Clinical experience with cell replacement in PD using fetal tissue grafts has spanned more than 10 years (2)
. However, efficient DA neuron differentiation from neural precursors in vitro has been reported only from those of embryonic ventral midbrain origin (3)
. Furthermore, the potential for dopaminergic differentiation of midbrain neural precursors is progressively lost during in vitro cell expansion (4)
. Given the limited success in driving dopaminergic differentiation in naive neural precursors using extrinsic cues, studies have been initiated to induce dopaminergic fate via forced expression of key transcription factors.
Mice lacking the steroid receptor-type transcription factor Nurr1 exhibit a specific loss of midbrain DA neurons (5
6
7)
. We recently demonstrated that ectopic expression of Nurr1 is sufficient to induce a dopaminergic phenotype in neural precursor cells from regions that do not typically yield DA progeny, such as rat embryonic and fetal cortical precursors (8)
. This study further showed that Nurr1-mediated induction of DA phenotype can be observed in neural precursors of multiple CNS regions and developmental stages (8)
. However, Nurr1-induced DA cells were morphologically and functionally immature, and no behavioral improvement was observed on transplantation into 6-hydroxydopamine (6-OHDA) lesioned rats. These findings suggest that Nurr1 is not sufficient to induce fully mature DA neuron progeny from neural precursors and that additional factors are required to yield DA neurons capable of restoring in vivo function.
Here we present data on the identification of cofactors sufficient to promote the differentiation and maturation of Nurr1-induced DA neurons. Combinatorial genetic modification of sonic hedgehog (SHH) and Bcl-XL or Mash1 in neural precursors allows the generation of Nurr1-induced DA neurons with improved functionality capable of reversing dopaminergic deficits in a rodent model of PD.
MATERIALS AND METHODS
Primary cultures for rat embryonic cortical precursor cells
Cultures for neural precursor cells were performed as described previously (8)
. Briefly, cortices were dissected from E14 rat embryos (Sprague Dawley, KOATECK, Seoul, Korea) and triturated in Ca2+/Mg2+-free (CMF)-HBSS (Invitrogen, Carlsbad, CA, USA). Cells were plated at 20,000 cells/cm2 on coverslips (for unpassaged (P0) cultures, 12 mm diameter; Carolina Biological Supply Company, Burlington, NC, USA) or 10 cm tissue culture dishes (for cultures to be passaged (P1), Corning, Corning, NY, USA) precoated with polyornithine/fibronectin). Neural precursor cells were proliferated in N2 medium (9)
supplemented with 20 ng/mL basic fibroblast growth factor (bFGF; R&D Systems, Minneapolis, MN, USA). Precursors reaching 6080% cell confluency (typically requiring 34 d of in vitro bFGF-expansion) were incubated for 1 h in CMF-HBSS followed by mechanical trituration and replating onto precoated coverslips in N2+bFGF (P1 dissociate). For some experiments, CMF-HBSS incubated precursors were dislodged with a cell lifter (Corning) and directly replated onto polyornithine/fibronectin-coated coverslips without further trituration (P1 cluster). Retroviral transductions were carried out in P1 or P0 cells at 5060% confluency (typically 12 d after cell plating; see below). Cell differentiation was induced by bFGF withdrawal in N2 medium supplemented with 200 µM ascorbic acid (AA, Sigma, St. Louis, MO, USA). Cultures were maintained at 37°C in 5% CO2, media changes were carried out every other day and bFGF was supplemented daily. In some experiments, Sonic hedgehog (SHH, R&D Systems) or cyclopamine (Toronto Research Chemicals, North York, Canada,) were added to cultures.
Retroviral production and infection
The construction of the expression vectors used in this study was based on the retroviral vectors pIRES-LacZ or pIRES-GFP described previously (10)
. The retroviral vectors pNurr1-IRES-LacZ and pNurr1-IRES-GFP (N) expressing Nurr1 were constructed by inserting a Nurr1 cDNA fragment amplified by polymerase chain reaction (PCR) into the site upstream to the IRES element of pIRES-LacZ and pIRES-GFP, respectively. The Nurr1 sequence in pNurr1-IRES-LacZ vector was substituted by N-SHH (kindly provided by Haeyoung Suh-Kim, Ajou University, Suwon, Korea), Smo-M2 (kindly provided by Arnon Rosenthal, Genentech, Inc., San Francisco, CA, USA), Bcl-XL, Mash1, Ngn1, or Ngn2 to generate the respective expression vectors. The bicistronic [pNurr1-IRES-SHH (NH), pNurr1-IRES-Bcl-XL (NB), and pNurr1-IRES-Mash1 (NM)] or tricistronic vectors [pNurr1-IRES-SHH-IRES-Bcl-XL (NHB)] were constructed by replacing LacZ of pNurr1-IRES-LacZ with the respective cDNA fragments. The retroviral vectors were transfected into 293 gpg packaging cells (Lipofectamine®, Invitrogen) and supernatant containing viral particles (VSV-G pseudotyped recombinant retrovirus) was harvested 72 h after incubation. Viral titers were adjusted to 5 x 106 particles/ml. Neural precursors were exposed to viral supernatant for 2 h in the presence of polybrene (1 µg/ml), cultured overnight in N2+bFGF, and differentiated the following day by withdrawal of bFGF. Coexpression studies were carried out by infecting cells with the bi-/tricistronic vectors or mixtures of the individual viral constructs (1:1, v:v).
Cell viability assays
The total number of viable cells was monitored over the whole experimental period under phase-contrast microscopy. Cells with fragmented and condensed apoptotic nuclei were visualized by 4',6'-diam idino-2-phenylidole (DAPI) staining. Cell viability was further determined by the lactate dehydrogenase (LDH) assay (Promega, Madison, WI, USA), terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end labeling (TUNEL) assay (Roche, Mannheim, Germany), and immunocytochemistry against cleaved caspase 3. LDH activities in the medium were measured by Cytotox 96 nonradioactive kit (Promega) following the recommendations of the manufacturer. Results were expressed as percentages of maximum LDH release obtained following cell lysis by 1% Triton X-100. Culture medium was used as negative control.
Reverse transcriptase-polymerase chain reaction (RT-PCR) and Immunoblot analyses
Total RNA preparation, cDNA synthesis and RT-PCR reactions were performed as described previously (8)
. Primer sequences (forward and backward), annealing temperatures, PCR cycle numbers, and product sizes (base pairs) were as follows: Otx1 (5'-GCTGTTCGCAAAGACTCGCTAC-3', 5'-ATGGCTCTGGCACTGATACGGATG-3', 62°C, 30 cycles, 425 bp); Emx2 (5'-TTCGAACCGCCTTCTCGCCG -3', 5'-TGAGCCTTCTTCCTCTAG -3', 59°C, 35 cycles, 188 bp); Pax6 (5'-CCAAAGTGGTGGACAAGATTGCC-3', 5'-TAACTCCGCCCATTCACTGACG-3', 58°C, 35 cycles, 419 bp); SHH (5'-GGAAGATCACAAACTCCGAAC-3', 5'-GGATGCGAGCTTTGGATTCATAG-3', 58°C, 32 cycles, 354 bp); Smo (5'-TGCTGTGTGCTGTCTACATGCC-3', 5'-TCTTGGGGTTGTCTGTCCTCAC-3', 58°C, 32 cycles, 240 bp); Ptc (5'-GGCAAGTTTTTGGTTGTGGGTC-3', 5'-CCATGTAACCTGTCTCCGTGATAAG-3', 58°C, 35 cycles, 355 bp); Bcl-XL (5'-CAAGCTTTCCCAGAAAGGAT-3', 5'-TGAAGAGTGAGCCCAGCAGA-3', 58°C, 33 cycles, 702 bp); Synapsin (5'- CCACCCCCACAAGGCCAGCA ACA-3', 5'- GGTCCCCCGGCAGCAGCAATGATG-3', 58°C, 29 cycles, 512 bp); Synaptophysin (5'-TGGTATCCTACCGCATTC-3', 5'-ACTCACCTCATAGCTCC-3', 58°C, 26 cycles, 379 bp); GAP43 (5'-AGAAAGCAGCCAAGCTGAGGAGG-3', 5'-CAGGAGAGACAGGGTTCAGGTGG-3', 58°C, 26 cycles, 167 bp); Rho8 (5'-ACGGGAAGCAGGTAGAGTTG-3', 5'-GATGGGCACATTTGGACAG-3', 58°C, 21 cycles, 191 bp); Scg10 (5'-CTACCCGGAGCCTCGCAAC-3', 5'-ACCTGGGCCTCCTGAGACTTC-3', 58°C, 21 cycles, 231 bp); GAPDH (5'-GGCATTGCTCTCATTGACAA-3', 5'-AGGGCCTCTCTCTTGCTCTC-3', 25°C, 60 cycles, 165 bp).
Proteins were extracted from cultured cell lysates, electrophoresed, and transferred to nitrocellulose membrane as described previously (11)
. The blot was probed with an anti-mouse neuron-specific class III ß-tubulin (TuJ1, Covance, Richmond, CA, USA, 1:1,000), tyrosine hydroxylase (TH, Sigma, 1:5,000), ß-actin (Abcam, Cambridge, UK, 1:5000) antibodies, followed by anti-mouse or rabbit IgG conjugated with peroxidase (Cell Signaling Technology, Beverly, MA, USA, 1:2000). Bands were visualized with enhanced chemiluminescence (ECL) detection kit (Amersham Pharmacia, Buckinghamshire, UK).
DA level determination and DA uptake assay
HPLC analysis for DA level was performed as described previously (11)
with some modification. To determine in vitro DA release from cultured cells, differentiated precursor cells in 24-well plates were incubated in 500 µl N2 + AA medium for 24 h or 15 min (basal release) or in the same medium supplemented with 56 mM KCl for 15 min (evoked release). The media were then collected and stabilized in 0.1 N perchloric acid (PCA) containing 0.1 mM EDTA and extracted by aluminum adsorption. To measure DA amounts in the grafts of transplanted animals, tissues from the center of grafts (
2 mm diameter in size) were homogenized in 0.2 N PCA containing 0.1 mM EDTA and then centrifuged at 5000 g for 10 min. The supernatants were filtered through centrifugal filter devices (microcon YM-10, Millipore Co., Billerica, MA, USA) at 12,000 g for 10 min, and used for DA level determination. DA was separated with a reverse phase µ-Bondapak C18 column (150x3.0 mm, Eicom, Japan) at a flow rate of 0.5 ml/min. Electroactive compounds were analyzed at +750 mV using an analytical cell and an amperometric detector (ECD-300, Eicom). DA levels were calculated using an internal standard (50 nM methyl-DOPA) and catecholamine standard mixtures including 150 nM DA (external standard) injected immediately before and after each experiment. DA transporter (DAT)-mediated specific DA uptakes were carried out as described recently for characterizing human ES cell-derived DA neurons (12)
.
Electrophysiology
Electrophysiological analyses were performed by whole-cell recording using standard whole-cell patch-clamp techniques. Nurr1-expressing cells were identified by GFP expression (Nurr1-IRES-GFP). Coexpression studies of Mash1 or SHH+Bcl-XL in Nurr1-expressing cells were performed as described above. After 10 d of in vitro differentiation, individual GFP+ Nurr1-expressing cells were selected for the electrophysiological analyses. The patch electrodes had resistances of 2 to 4 M
. The cell membrane capacitance and series resistance were compensated (typically >80%) electronically using a patch-clamp amplifier (Axopatch-200A; Axon Instruments, Foster City, CA, USA). Current protocol generation and data acquisition were performed using pClamp 8.2 software on an IBM computer equipped with an analog-to-digital converter (Digidata 1322A; Axon Instruments). All experiments were performed at room temperature (2124°C). For recording of membrane potential in current clamp mode, the patch pipette solution contained (in mM): KCl 134, MgCl2 1.2, MgATP 1, Na2GTP 0.1, EGTA 10, glucose (Glc) 14, and HEPES 10.5 (pH adjusted to 7.2 with KOH). The bath solution contained (in mM); NaCl 134, KCl 5, CaCl2 2.5, MgCl2 1.2, Glc 14, and HEPES 10.5 (pH adjusted to 7.4 with NaOH).
Immunostaining on cultured cells and brain slices
Cultured cells or cryosectioned brain slices were fixed in 4% paraformaldehyde/0.15% picric acid in PBS and incubated with primary antibodies overnight at 4°C. The following primary antibodies were used: anti-rabbit TH (Pel-Freez, Rogers, AR, USA, 1:250), TuJ1 (Covance, 1:2000), anti-mouse-TH (Sigma, 1:10,000), anti-GFP (Roche, 1:400) and microtubule-associated protein 2(a+b) (MAP2, Sigma, 1:500), anti-rabbit cleaved caspase 3 (Cell Signaling, 1:200). Appropriate fluorescence-tagged (Jackson Immunoresearch Laboratories, West Grove, PA, USA) secondary antibodies were used for visualization. Cells and tissue sections were mounted in VECTASHIELD® containing DAPI (Vector Laboratories, Burlingame, CA, USA) and analyzed under either an epifluorescence microscope (Nikon, Tokyo, Japan) or a Carl Zeiss LMS 510 confocal system (Carl Zeiss, Jena, Germany).
Morphometric analysis for neurite outgrowths
The neurite length of TH+ cells was measured as described previously (8)
. Briefly, 2050 TH+ cells were randomly selected from at least three cultures from three independent experiments. Cells were photographed on an Axiovert Phase-Contrast Microscope equipped with an Axiocam digital camera system, and the neurite lengths from the soma to the tip of the branches were measured using Axiovision image analyzer (Carl Zeiss). The total neurite length was defined as the combined length of all neurites per cell.
Surgical procedures and behavioral testing
Animals were housed and treated following National Institutes of Health guidelines. Female, Sprague-Dawley rats (200250 g) were lesioned by unilateral stereotactic injection of 6-OHDA (Sigma) into the substantia nigra and the median forebrain bundle as described previously (11)
. Four weeks after the lesioning, animals were tested for drug-induced rotational asymmetry (Amphetamine 3 mg/kg i.p., Sigma). Rotation scores were monitored for 60 min. in an automatized rotometer system (Med Associate Inc., St. Albans, VT, USA). Animals with
5 turns/min ipsilateral to the lesion were selected for transplantation. Forelimb akinesia was measured by "step adjustment test" (13)
, as described previously (11)
, three times prior to grafting and repeated in weekly intervals for 8 wk after cell transplantation. The number of adjusting steps of the unrestrained forelimb was counted while the animal was moved in backwards direction (90 cm in 10 s). The percentage of steps on the lesioned side vs. unlesioned side was quantified (average of three trials/time point).
Two days after retroviral infection, bFGF expanded precursors were mechanically dissociated, and 3 µl of the cell suspension (1.5x105 cells/µl in PBS) was injected (22 G needle) over a 5 min period into the ipsilateral striatum using KDS310 nano pump (KD Scientific Inc., Holliston, MA, USA). Cells were deposited at 3 sites (coordinates in AP, ML and V relative to bregma and dura (1) 0.03, 0.30, 0.58; (2) 0.03, 0.40, 0.58; (3) 0.03, 0.35, 0.58; incisor bar set at 3.5 mm). The needle was left in place for 5 min following each injection. The rats received daily injections of cyclosporin A (10 mg/kg, i.p.), starting 24 h prior to grafting and continuing for 3 wk followed by a reduced dose of 5 mg/kg for the remaining time.
Histological procedures
Animals were anesthetized (50 mg/kg penobarbital) and intracardially perfused with 4% paraformaldehyde in PBS. Brains were equilibrated in 20% sucrose in PBS and sectioned at 35 µm on a freezing microtome. Free-floating sections were subjected to TH-immunohistochemistry as described above. Estimation of TH+ cell numbers were made as described previously (11)
.
Cell counting and statistic analysis
Cell counting was performed by uniform random selection of 520 microscopic fields/well, 36 wells/experimental condition, and data were confirmed in more than three independent experiments. Data are expressed as mean ± SEM. Statistical comparisons were made by ANOVA with Tukey post hoc analysis (statistical Packages for the Social Sciences 12.0; statistical Packages for the Social Sciences (SPSS) Inc., Chicago, IL, USA) when more than two groups were involved.
RESULTS
Neuronal differentiation of Nurr1-induced DA cells from unpassaged (P0) and passaged (P1) rat embryonic neural precursor cells
While forced expression of Nurr1 induces DA neurotransmitter identity in various neural precursors (8
, 14
, 15)
, the level of neuronal differentiation is highly variable among these cells. Nurr1 expressing long-term expanded adult neural precursors do not exhibit neuronal properties (14)
. However, neuronal identity was reported in subpopulations of short-term expanded Nurr1-induced embryonic neural precursors (8)
. These findings suggest that neuronal differentiation in Nurr1-induced DA cells may depend on the duration of in vitro expansion or the developmental stage of the precursor cells. Our previous study on Nurr1-induced neural precursors was carried out in passaged (P1) cells on several days of in vitro expansion followed by mechanical trituration and replating (8)
. These conditions were chosen to ensure high purity of neural precursors (>95% nestin+cells, <1% of TuJ1+ neurons) in contrast to unpassaged neural precursors (P0) that contain up to 15% postmitotic neurons (16)
.
Here we compared the level of neuronal differentiation in Nurr1-induced DA cells at P0 and P1 (
Fig. 2
). Precursors were transduced with Nurr1-retroviruses at the last day of the precursor cell expansion (P0: in vitro day 3; P1: in vitro day 6). Cells were differentiated for an additional 310 d prior to analysis. We first examined Nurr1 effects on cell apoptosis and morphology. In Nurr1-transduced P0 and P1 cultures, cell apoptosis was increased as compared with LacZ-transduced control cultures. Three days after differentiation, percentages of cells with apoptotic nuclei (fragmented or condensed) were significantly increased in Nurr1-transduced cultures compared with lacZ-transduced control cultures: 16.5 ± 1.0% vs. 10.9 ± 0.8% in P0 cultures; 15.7 ± 0.8% vs. 10.6 ± 0.5% in P1 cultures (n=3560 microscopic fields from 38 coverslips, P<0.001). Interestingly, neurite length was significantly decreased in cells transduced with Nurr1 (Nurr1-IRES-GFP), compared with control cultures (LacZ-IRES-GFP) (Fig. 2A-D
). The mechanisms responsible for the increased rate of apoptosis and the decreased morphological differentiation in Nurr1-transduced cells are currently unclear.
|
|
In both P0 and P1 cultures, Nurr1 transduction efficiently induced expression of TH, a specific marker expressed in DA neurons (Fig. 2E-H
). Morphometry of Nurr1-induced DA cells revealed a marked increase in total length of TH+ fibers in P0 cultures compared with P1 cultures (P0: 84.0±4.9 µm; P1: 14.2±5.7 µm, n=4050, P<0.001, Fig. 2F, H
). Consistent with the data on morphological differentiation, a larger proportion of TH+ cells expressed the neuronal markers TuJ1 and MAP2 in P0 cultures compared with P1 cultures. At day 3 of in vitro differentiation, TuJ1 was colocalized in 37.3 ± 2.4% (P0) and 8.6 ± 1.2% (P1) of TH+ cells (n=25, P<0.001, Fig. 2I, J
). MAP2 expression was observed in 65.0 ± 4.7% of all TH+ cells at P0 and in 11.7 ± 1.8% of TH+ cells at P1 at day 10 of in vitro differentiation (n=30, P<0.001, Fig. 2K, L
). These findings indicate that Nurr1-TH+ cells in P0 cultures exhibit a higher degree of neuronal differentiation in P0 cultures compared with P1 cultures.
SHH-mediated morphological differentiation of Nurr1-TH+ cells
The main differences between P0 and P1 cultures are the longer period of in vitro precursor cell expansion in P1 cells (6 d in P1 vs. 3 d in P0) and the mechanical passaging of P1 (P0 cells are not passaged). We first examined whether the mechanical passaging procedure may be responsible for the decreased level of neuronal differentiation in Nurr1-induced DA cells in P1 vs. P0 cultures. Our routine passaging procedure (see Materials and Methods) is based on CMF-HBSS incubation followed by mechanical trituration of the cell clusters to single cell suspensions (9)
. To test the effect of cell-to-cell interactions, we passaged parallel cultures by replating cell clusters without trituration (P1 clusters). Interestingly, under these conditions the morphological differentiation of the Nurr1-TH cells was not significantly altered compared with P0 cultures, whereas that of P1 cultures with single-cell suspension (P1 dissociates) were much poorer than P0 [Fig. 3
AC; P0 cultures (P0): 67.5 ± 4.2 µm; P1 clusters (P1C): 43.0 ± 11.7 µm; P1 dissociates (P1D): 9.3 ± 0.7 µm, n = 2530]. These data demonstrate that disruption of cell-to-cell contacts during passaging negatively affects neuronal maturation of Nurr1-induced DA cells. Reduced length of TH+ fibers in P1 culture is not likely to be due to the loss of cellular processes during mechanical trituration. It is because we applied very similar levels of mechanical trituration to the dissected cortical tissue at the time of preparation compared to the cells passaged for P1 culture. Consistently, we could not observe major differences in cell morphology 624 h after cell plating comparing P0 and P1 cultures (data not shown).
|
We wanted to gain a molecular understanding of the differences observed between triturated and nontriturated P1 Nurr1-induced DA cells. Gene expression profiles were established from neural precursors in P0, P1 dissociate, and P1 cluster cultures. Among the candidate markers tested, SHH expression was completely lost in P1 dissociates, whereas it was maintained in P1 cluster cultures (Fig. 3D
). SHH is well known for its role during early CNS patterning and the derivation of DA neurons (17
, 18)
. However, SHH is also a powerful chemoattractant that promotes axonal growth from neighboring neurons (19
, 43)
. We found that exposure of P1-dissociated cultures to SHH (500 ng/ml) increased TH fiber length in Nurr1-induced DA cells (SHH treated: 46.0±3.6 µm vs. untreated control: 11.8±1.3 µm, n=45, P<0.001; Fig. 3G, H
). Forced expression of Smo-M2, the constitutively active form of the SHH receptor smoothened (20)
or expression of the 22 kDa SHH N-terminal domain yielded comparable results (Nurr1-IRES-SHH vector, NH, 43.3±4.8 µm, n=20; Fig. 3I
, and data not shown). Furthermore, neurite outgrowth of Nurr1-DA cells in P0 cultures was strikingly reduced on treatment with the well-characterized SHH inhibitor cyclopamine (1 µg/ml, Ref. 21
) vs. control (cyclopamine: 6.5±3.0 µm; control: 76.0±3.6 µm, n=30, P<0.001; Fig. 3E, F
). Treatment of P0 cultures with SHH or treatment of P1 cultures with cyclopamine did not induce significant changes in TH+ fiber lengths compared with untreated control cultures (data not shown). These findings suggest that loss of endogenous SHH during passaging negatively affects the differentiation of Nurr1-induced DA cells.
The role of Bcl-XL on the enhanced differentiation of Nurr1-DA cells in neural precursors derived from later developmental stages
We next tested whether the period of in vitro expansion affects the morphological differences observed between P0 and P1 Nurr1-TH cells. An important variable that influences differentiation of neural precursors is cell density, with higher cell densities promoting differentiation through soluble factors secreted from the precursors (22)
. We minimized density-dependent effects by plating cells at low density (4000 cells/10 cm plate,
80 cells/cm2), followed by transduction with Nurr1 retrovirus at days 2 and 5 of proliferation (passage was not included in either of the cultures). Analysis was performed on an additional 5 d of differentiation in both day 2 and day 5 transduced cultures. Under these conditions fewer than 20 colonies of cells (average size, >1 mm) were observed per 10 cm dish. Although the colonies grew in size from day 25 of expansion (2-fold increase in diameter), overall cell density in the plate remained very low, making interference with paracrine factors unlikely. Interestingly, in contrast to the P0 and P1 culture data, neurite outgrowth was increased in cultures that underwent longer expansion periods (day 5 transduced cells: 6.6±1.0 µm; vs. day 2 transduced cells: 0.6±0.1 µm, n=20, P<0.001, Fig. 4
AD).
|
Previous work has demonstrated distinct precursor cell properties depending on developmental stage and extent of in vitro proliferation (4
, 16
, 23)
. We observed that early embryonic neural precursors expanded in vitro start adopting properties of precursors derived from later developmental stages (16)
. Thus, our results on increased morphological maturation in precursors expanded for extended in vitro periods could reflect changes in precursor cell stage. Therefore, we next tested whether Nurr1 transduction of rat cortical precursors isolated from various developmental stages (E12-E18) yields similar differences. Consistent with our hypothesis, precursors derived from later developmental stages exhibited a higher degree of cell differentiation compared with those from earlier developmental stages (Fig. 4E-H
; E18 P0 cultures: 101.7±5.2 µm; E16 P0: 98.2±3.0 µm; E14 P0: 74.7±8.4 µm; E12 P0: 63.5±5.1 µm, n=3540, P<0.001). These data demonstrate that neural precursor stage affects the degree of neuronal differentiation in Nurr1-induced DA cells.
The antiapoptotic proteins Bcl-2 and Bcl-XL are candidate factors for enhancing DA neuron differentiation (11
, 24
, 25)
. Interestingly, increased Bcl-XL expression (Fig. 4I
) was observed in precursors isolated from later embryonic stages, those associated with increased morphological maturation. We next tested whether forced expression of Bcl-XL enhances neuronal differentiation in Nurr1-DA cells (Nurr1-IRES-Bcl-XL vector, NB). Cells transduced with NB exhibited a marked increase in neurite length compared with Nurr1-IRES-LacZ transduced cells (N) (NB: 62.0±5.2 µm vs. N: 10.3±0.6 µm, n=2025, P<0.001; Fig. 4 J, K
).
Divergent action of bHLH factors on Nurr1-induced DA neuron differentiation
Neuronal bHLH transcriptional factors play an essential role during neuronal specification of precursor cells and during the morphological and functional maturation of postmitotic neurons [for review, see (2629)]. Two classes of neuronal bHLH genes have been identified in drosophila, the achaete-scute and atonal family [for review, see (30, 31)], and the orthologues of these bHLH genes are expressed during mammalian brain development. Results in Nurr1-induced DA cells suggest a disconnection between acquisition of DA neurotransmitter phenotype and neuronal differentiation. We therefore tested whether the well-known neurogenic effects of bHLH proteins could overcome the limited neuronal commitment and maturation of Nurr1-induced DA cells. While all bHLH proteins showed similar effects on overall neuronal differentiation as assessed by TuJ1 (Supplemental Fig. S1AD, F), a striking difference was found between achaete-scute and atonal homologues on the differentiation of Nurr1-induced DA cells. Forced expression of the achaete-scute homologue Mash1 [Nurr1-IRES-Mash1 retrovirus (NM)] caused a dramatic increase in morphological differentiation of the Nurr1-DA cells [NM: 147.4±50.9 µm vs. N: 9.0±1.8 µm; Supplemental Fig. S1GH and (10)] without affecting TH+ cell yield (Supplemental Fig. S1F). Coexpression of Nurr1 and Ngn1 or Ngn2, homologues of the atonal family, caused a near complete loss of TH+ cells [Supplemental Fig. S1AD and F (10)]; % TH+ cells out of total cells were Nurr1+LacZ (N): 41.1 ± 2.0% vs. Nurr1+Ngn1: 1.1 ± 0.6%, and Nurr1+Ngn2: 2.8 ± 0.9%. These findings demonstrate a powerful effect of bHLH proteins on neuronal specification and maturation but divergent effects of Mash1 vs. Ngn1 and Ngn2 on the DA neuron specification of Nurr1-induced neural precursors.
Bcl-XL/ SHH and Mash1 independently regulate the differentiation of Nurr1-DA cells
Additional studies showed that SHH and Bcl-XL have additive effects on neurite growth in Nurr1-DA cells [Nurr1-IRES-SHH-IRES-Bcl-XL (NHB): 82.5±1.5 µm, NH: 38.0±5.8 µm, NB: 62.2±6.1 µm, n=2540]. However, we did not observe additional benefit when expressing Mash1 with either Bcl-XL or SHH, or when expressing Mash1 with both Bcl-XL+SHH in Nurr1-induced DA cells (data not shown). These findings suggest that the two novel strategies presented here (expression of Bcl-XL and SHH or expression of Mash1) may act on a common final pathway that modulates neuronal and dopaminergic differentiation in Nurr1-induced DA cells. We have tested a large number of other candidate genes that proved ineffective in our system, including among others glial-derived neurotrophic factor (GDNF), Wnt-5a, Pax2, DAT, and tissue inhibitor of metalloproteinase (TIMP) (data not shown). While it is possible that future additional cofactors may provide further benefit, the effects of Bcl-XL/SHH and Mash1 are rather specific. We therefore decided to perform subsequent in vitro and in vivo functional studies of Nurr1-DA cells in NHB-, NM-, and N-transduced cultures.
Biochemical and physiological properties of Nurr1-induced DA cells
We next tested whether enhanced morphometric maturation is correlated with the expression of mature neuronal marker MAP2. Quantification of the percentage of Nurr1-induced DA cells expressing MAP2 confirmed our morphometric data on cell differentiation (Fig. 5
AD). TH+/MAP2+ cells out of total TH+ cells were 67.5 ± 4.1% (NHB), 71.0 ± 2.4% (NM), and 11.8 ± 2.1% (N).
|
The effects of NHB and NM on neurite growth and maturation were correlated with increased expression of transcripts associated with growth cone development (GAP43), neurite outgrowths (Rho8 and Scg10), and synapse formation (synapsin and synaptophysin) (Fig. 5E
).
Presynaptic DA neuron function of NHB-, NM-, or N-transduced cells was assessed by measuring DA release in vitro. HPLC analysis revealed no detectable levels of DA at basal levels (15 min exposure to medium), but rather robust DA release on depolarization of the cells (15 min in medium containing 56 mM KCl). While all conditions exhibited KCl-induced DA release, significant quantitative differences were found among the groups (Fig. 6
A). DA levels were NHB: 2558.2 ± 152.4 pg/ml, NM: 3049.9 ± 377.6 pg/ml, and N: 561.2 ± 50.2 pg/ml. Functional differences in DA metabolism were further illustrated by measuring DAT-mediated high-affinity reuptake of DA. While reuptake in Nurr1 cultures was at the limit of detection (N: 0.23±0.01 fmol/min/well), NHB- and NM-transduced cells exhibited robust DA uptake (NHB: 4.59 ± 0.50 fmol/min/well, and NM: 2.90 ± 0.61 fmol/min/well; Fig. 6B
).
|
Electrophysiological analysis of Nurr1-induced DA cells (NHB group) demonstrated well-developed sodium and potassium channels in cells with differentiated neuronal morphologies (data not shown) and the generation of action potentials by prolonged depolarizing current injections (Fig. 6C
), a hallmark feature of differentiated neurons. In addition, as the intensity of the hyperpolarizing current injections was increased, there was a time-dependent reduction in the membrane deflection (Fig. 6D
), indicating an anomalous rectification characteristic for mesolimbic (32)
and nigrostriatal (33)
DA neurons. These cells also showed hyperpolarizing inward current, which can evoke anomalous rectification in current-clamp mode (Fig. 6E
). Similar electrophysiological patterns could also be observed in the cells infected with NM (Fig. 6F-H
).
Enhanced in vitro survival of Nurr1-induced DA cells by Bcl-XL/SHH and Mash1
The survival rate of transplanted DA neurons is critical for preclinical studies in animal models of PD. We therefore determined the effects of our transduction strategies on the viability of precursor progeny. Bcl-XL is one of best characterized antiapoptotic proteins, and SHH-mediated effects on the survival of neural precursors (34)
and postmitotic neurons including midbrain DA neurons (35)
has been demonstrated previously. Consistently, percentages of cells with apoptotic nuclei was decreased in cultures transduced with Bcl-XL (4.2±0.2%) or SHH (7.5±0.6%), compared with LacZ-transduced control cultures (11.3±0.6%, n=40 microscopic fields from four coverslips, significantly different from LacZ-transduced control values at P<0.001). We next examined more closely the effects of Bcl-XL, SHH, and Mash1 on the survival of Nurr1-transduced precursor cells. NHB-transduced cells showed a marked increase in cell viability compared with Nurr1-only (N) cultures. Data are provided on the total number of cells, the total number of TH+ cells, LDH release, percentage of cells with apoptotic nuclei, percentage of TUNEL+ cells, and percentage of cells positive for activated caspase 3 (Fig. 7
). Cell survival in cultures transduced with NHB was significantly greater than in cultures transduced with NH or NB, suggesting additive roles for SHH and Bcl-XL on cell survival. Interestingly, coexpression of Mash1 in Nurr1-transduced cells (NM) also resulted in enhanced survival for all indices tested above.
|
In vivo transplantation studies
The final set of experiments was directed at addressing the capacity of Nurr1-induced DA cells for in vivo survival, integration, and function in Parkinsonian rats. Precursors transduced with N, NM, and NHB were transplanted into the adult striatum of rats with a unilateral 6-OHDA lesion. Histological analysis was performed at 4 and 8 wk after transplantation. Both NHB- and NM-transduced precursors showed a dramatic increase in the number of surviving TH+ cells in the striatum compared with Nurr1-only cells (N) (Fig. 8
G). The average numbers of TH+ cells/animal at 8 wk of post-transplantation were NHB, 7339 ± 66; NM, 5758 ± 50 TH+ cell/animal; N, 1461 ± 18 TH+ cell/animal (n=5 animals/group; P<0.05 for NHB and NM vs. N). In addition to effects on cell survival, there were also marked differences in the degree of morphological maturation in grafted TH+ cells. NM- or NHB-derived TH+ cells within the graft exhibited mature neuronal morphologies with multiple long processes extending into the host striatum, while N-transduced TH+ cells were morphologically immature without any significant neurite arborization (Fig. 8A-F
). The grafts were negative for the proliferation marker PCNA and free of any signs of tumor formation.
|
In vivo graft function was further assessed by measuring striatal DA levels. HPLC analysis revealed significantly increased levels of DA in NHB or NM grafts vs. N grafts: DA levels per tissue were NHB, 316.3 ± 28.6 µg/mg protein of graft; NM, 286.8 ± 32.5 µg/mg; N, 49.6 ± 14.7 µg/mg (n=3; P<0.05 for both NHB and NM vs. N).
Behavioral analysis was performed by measuring amphetamine-induced rotation behavior (Fig. 8I
) and step-adjustment tests (Fig. 8J
). Overall, animals grafted with NM- or NHB-tranduced cells demonstrated significant improvement in both parameters (Fig. 8I, J
and supplementary Tables 1 and 2). Consistent with our published work (8)
, transplantation of precursors transduced with Nurr1 only (N) did not lead to significant behavioral restoration (Fig. 8I, J
). These data suggest that expression of SHH and Bcl-XL or expression of Mash1 potentiates the in vitro and in vivo function of Nurr1-induced DA cells and that genetic manipulation of these genes may represent an important strategy for the development of donor cell sources suitable for cell therapy in PD.
DISCUSSION
In the present study, we identified several factors that modulate the morphological and functional differentiation of DA cells derived from Nurr1-expressed neural precursors. We demonstrated that morphological differentiation of Nurr1-DA cells is dependent on cell-to-cell contact and developmental stage of the cultured neural precursor cells. Our data further indicate that Bcl-XL and SHH are key factors controlling morphological maturation of Nurr1-DA cells and that expression of Bcl-XL and SHH transgenes was sufficient to drive the differentiation of Nurr1-tranduced precursor cells into mature DA neurons. Such precursor-derived DA neurons expressed key dopaminergic and neuronal markers and exhibited characteristic presynaptic DA neuron properties in vitro. Our findings are consistent with previous reports showing enhanced morphological differentiation and synaptic function in ES-derived and primary neurons by Bcl-XL (11
, 36)
and the promotion of neurite outgrowth through SHH-mediated chemoattraction (19
, 43)
.
Our data demonstrate that expression of proneural bHLH transcription factors is an alternative approach for driving neuronal differentiation in Nurr1-induced DA cells in vitro. However, surprisingly, marked differences were found between the achaete-scute related bHLH factor Mash1 and the atonal-related bHLHs Ngn1 and Ngn2 in promoting DA neuron-specific differentiation. While Mash1 promoted the morphological and functional differentiation of Nurr1-induced DA cells, forced expression of Ngn1 or Ngn2 in Nurr1-transduced cells led to a repression of DA neuron phenotype. In agreement with these data, a recent study from our group (10)
observed an inhibitory role of Ngns in Nurr1-induced transactivation of the TH promoter. We have also identified putative functional domains within the Mash1 and Ngn1 and 2 proteins responsible for the divergent role during Nurr1-DA differentiation. While these additional data provide a possible mechanistic link explaining the inhibitory role of Ngn1/Ngn2 on DA-specific differentiation in Nurr1-induced cells, two recent studies suggest an important positive role for Ngn2 in the development of mouse midbrain DA neurons in vivo (37
, 38)
.
Numerous possibilities could explain the contrasting roles of Ngn2 between the in vitro data reported here and the data on midbrain developmental in vivo. First of all, differences in the timing of Ngn2 expression are clear. In our study, Ngn2 was expressed concomitantly to Nurr1 within the same cell, whereas Ngn2 is coexpressed in only a small population of Nurr1-expressing cells during mouse midbrain development in vivo. In early midbrain development Ngn2 expression is restricted to the ventricular zone. Nurr1 expression is observed within the mantel zone of the ventral midbrain at slightly later developmental stages (37
, 38)
. It is possible that Ngn2 has dual roles in the midbrain DA neuron development. While Ngn2 expression in early midbrain development prior to Nurr1 expression is required for the DA neuron formation, Ngn2 negatively regulates DA phenotype acquisition in the small population of the cells coexpressing Nurr1 at later developmental stages. Such the negative regulation of Ngn2 may serve to establish an appropriate number of DA cells in the developing midbrain. While such questions may be the basis for future studies aimed at more fully elucidating normal mechanisms of midbrain DA neuron development in vivo, our study was directed at defining the molecular steps to generate functional DA neurons from naive neuron precursor in vitro. In fact our data provide the first example of successfully manipulating naive nonmidbrain neural precursors toward a DA neuron phenotype that can restore behavioral deficits in a rodent model of PD.
Donor cell survival is a critical factor for the success of DA neuron transplantation in preclinical models of PD. Our study demonstrates enhanced in vitro and in vivo survival of Nurr1-induced DA cells transduced with SHH/Bcl-XL or with Mash1. The observed effects of Bcl-XL and SHH on the survival of Nurr1-induced DA cells can likely be explained by the well-established antiapoptotic roles of Bcl-XL and SHH in neuronal cells (34
, 35)
. In contrast, Mash1-induced increase of DA cell survival was unexpected. Neuronal differentiation induced by neurogenic factors is often coupled with cell cycle arrest and apoptosis. We observed increased levels of SHH mRNAs in cultured precursor cells transduced with Mash1 but not in cultures transduced with Ngn1 or Ngn2 (Jo et al., our unpublished data). Thus, increased expression of SHH in Mash1-transduced cells may represent a possible mechanisms to explain survival effects on Nurr1-induced DA cells.
We finally demonstrated in vivo survival and functions of NHB- and NM-transduced precursor cells. Based on robust in vivo TH+ cell survival and DA production in NHB and NM grafts, it is reasonable to assume that the behavioral improvements are due to restored DA neurotransmission of graft-derived TH+ neurons. However, other groups have reported that some degree of behavioral recovery can be achieved through graft-derived trophic effects on the remaining endogenous DA population (39)
. SHH has previously shown efficacy as a pharmacological agent in preclinical models of PD (40
41
42)
. Thus, we cannot rule out that SHH secreted from NHB- and NM-transduced cells could have contributed to behavioral recovery.
In conclusion, our study demonstrates that the genetic manipulation of novel cofactors acting in concert with Nurr1 provide a powerful strategy to enhance the differentiation and function of precursor-derived DA neurons. Extensive functional characterization in vitro and in vivo suggests that DA neurons derived from naive neural precursors adopt properties characteristic of midbrain type DA neurons. Finally, our study provides the first example for achieving functional restoration in Parkinsonian rats using DA neurons derived from naive nonmidbrain-derived neural precursors. The use of genetically manipulated forebrain precursors could provide an interesting alternative to the use of human fetal midbrain tissue given the availability and scalability of human forebrain progenitors. However, it remains to be determined whether our approach is applicable to human cells, and whether the risk of introducing multiple transgenes is manageable in a therapeutic setting.
ACKNOWLEDGMENTS
We thank Dr. Arnon Rosenthal for Smo-M2 cDNA and Dr. Haeyoung Suh-Kim for N-SHH cDNA. This work was supported by SC2130 and SC2150 (Stem Cell Research Center of the 21st Century Frontier Research Program) funded by the Ministry of Science and Technology, Republic of Korea.
Received for publication March 28, 2006. Accepted for publication July 11, 2006.
REFERENCES
This article has been cited by other articles:
![]() |
A. K. Singh, S. Gupta, Y. Jiang, M. Younus, and M. Ramzan In vitro Neurogenesis from Neural Progenitor Cells Isolated from the Hippocampus Region of the Brain of Adult Rats Exposed to Ethanol during Early Development through Their Alcohol-Drinking Mothers Alcohol Alcohol., March 1, 2009; 44(2): 185 - 198. [Abstract] [Full Text] [PDF] |
||||
![]() |
Weidong Le, Shen Chen, and J. Jankovic Etiopathogenesis of Parkinson Disease: A New Beginning? Neuroscientist, February 1, 2009; 15(1): 28 - 35. [Abstract] [PDF] |
||||
![]() |
J.-W. Shim, C.-H. Park, Y.-C. Bae, J.-Y. Bae, S. Chung, M.-Y. Chang, H.-C. Koh, H.-S. Lee, S.-J. Hwang, K.-H. Lee, et al. Generation of Functional Dopamine Neurons from Neural Precursor Cells Isolated from the Subventricular Zone and White Matter of the Adult Rat Brain Using Nurr1 Overexpression Stem Cells, May 1, 2007; 25(5): 1252 - 1262. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |